ID: 1182711069

View in Genome Browser
Species Human (GRCh38)
Location 22:32323688-32323710
Sequence GCCTCTGCTTGGTTTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182711067_1182711069 -7 Left 1182711067 22:32323672-32323694 CCAGGTGATGGTCGAGGCCTCTG 0: 1
1: 0
2: 2
3: 11
4: 103
Right 1182711069 22:32323688-32323710 GCCTCTGCTTGGTTTCCCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182711069 Original CRISPR GCCTCTGCTTGGTTTCCCCC AGG Intergenic
900482972 1:2908269-2908291 CCCTCTGCTTGGCTTGGCCCAGG - Intergenic
900609779 1:3539628-3539650 GCCCCAGCTTGGTTTCCCAGGGG - Intronic
900937777 1:5777679-5777701 TCCTCTGCTTGGGATCCCACAGG + Intergenic
901852448 1:12024323-12024345 CCTTCTGGCTGGTTTCCCCCTGG + Intronic
902202528 1:14844707-14844729 GTCTCTTCTTGGCTTCCACCAGG + Intronic
903592720 1:24469417-24469439 GCCTCTGCCTGGATTAGCCCAGG + Intronic
904655397 1:32041992-32042014 GCCCTTGCTTGGTTTTCCCAGGG + Intronic
904975291 1:34451551-34451573 ATCTCTGCTTGGTTGGCCCCTGG - Intergenic
905907088 1:41626354-41626376 GCCTCTGCCTGTGTTCTCCCTGG - Intronic
906567613 1:46812155-46812177 CCCTCTGCTTGGCTGTCCCCAGG + Intronic
908272684 1:62436565-62436587 ACTTCTGATTGGCTTCCCCCGGG + Intronic
910746989 1:90584475-90584497 CCCTGTGCTTGATTTCCCCCAGG - Intergenic
913703321 1:121396007-121396029 GCCGCTGCTTTGTGCCCCCCCGG + Intergenic
915282428 1:154831676-154831698 GTCTCTGCTTGATTTTCTCCAGG + Intronic
915656810 1:157367417-157367439 GCCTCTGCTTGGTTAATTCCAGG - Intergenic
917470898 1:175324919-175324941 GCCTCAGCCTGGCTTCTCCCTGG + Intronic
918045549 1:180938960-180938982 GGCTCTGCTAGCTTTGCCCCAGG - Intronic
918187953 1:182144270-182144292 GCCTCTGCTTGTTTTCTTCAGGG + Intergenic
919030717 1:192238482-192238504 TCCTCTGCTAAGTTTCGCCCAGG + Intergenic
919866415 1:201786444-201786466 GCCTCTCCTTGGTCTCCTCCTGG - Exonic
922749766 1:228064919-228064941 GCCTGGGCTTGGTGTGCCCCGGG + Intergenic
922831562 1:228557052-228557074 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922832039 1:228609034-228609056 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922832600 1:228611275-228611297 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922833160 1:228613516-228613538 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922833721 1:228615757-228615779 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922834280 1:228617998-228618020 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922834840 1:228620229-228620251 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922835389 1:228622432-228622454 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922835948 1:228624674-228624696 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922836507 1:228626914-228626936 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922837065 1:228629155-228629177 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922837624 1:228631397-228631419 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922838183 1:228633638-228633660 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922838742 1:228635863-228635885 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922839300 1:228638103-228638125 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922839861 1:228640334-228640356 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922840422 1:228642575-228642597 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922840984 1:228644806-228644828 CTCTCTTCTGGGTTTCCCCCTGG - Intergenic
922841551 1:228647013-228647035 CACTCTTCTGGGTTTCCCCCTGG - Intergenic
922958999 1:229628985-229629007 GCCTCCCCTTTGTTTCACCCTGG - Intronic
1063338668 10:5242439-5242461 GCCTCTGCTGGACTTCTCCCGGG + Intergenic
1063435707 10:6028152-6028174 CACTCTGCTTGGGTTCCACCTGG - Intronic
1065798826 10:29332412-29332434 GCCTCTCCTGGCTTTTCCCCTGG - Intergenic
1070278452 10:75030429-75030451 GCTTGTGCTTGGGGTCCCCCAGG - Exonic
1070398436 10:76032584-76032606 GGCTCTGCCTGGGCTCCCCCAGG - Intronic
1070800791 10:79243385-79243407 GCCTATGATTGGCTTCGCCCGGG + Intronic
1071693208 10:87844374-87844396 CCCTCTGCTGGGATTCCCCCAGG - Intergenic
1073576522 10:104630744-104630766 GCCCCTGCGTGGTTTCCAGCAGG + Intergenic
1075075167 10:119345739-119345761 GCTGCTGCTGGGTTTCCCCAAGG - Intronic
1076577213 10:131477323-131477345 GCCTCTTCCTGGTTTCCAGCCGG - Intergenic
1076726772 10:132417509-132417531 GACTCAGCTTGGTCTCCCGCAGG + Exonic
1077378184 11:2215415-2215437 ATCTCTGCTTCCTTTCCCCCAGG - Intergenic
1082810646 11:57477059-57477081 GCCTCTCCTTGCCTGCCCCCTGG + Exonic
1083298743 11:61729115-61729137 GCCCCTGCCCGGTCTCCCCCCGG + Intronic
1083903818 11:65657190-65657212 GCCTCTGCTTGGAATGCCCAAGG - Intronic
1084571534 11:69962754-69962776 TCCTCTGCTTGGTTCCCAACAGG + Intergenic
1084957414 11:72698659-72698681 GCCTCTGCTTGCTCGCCTCCAGG + Intronic
1085510105 11:77083887-77083909 GCCTTGCCTTGGTTTCCCTCAGG + Intronic
1087504597 11:99003478-99003500 GCCTCTACCTGGTCTCTCCCTGG - Intergenic
1088830466 11:113532221-113532243 GGCTCTGCTTGTTCTCCTCCAGG - Intergenic
1089735816 11:120549651-120549673 GCCTCTGCTTGTCTTGTCCCAGG - Intronic
1092123328 12:6059255-6059277 TTCTCTGCTTTATTTCCCCCAGG + Intronic
1092387612 12:8048103-8048125 GCCCCAGCTTGCTTTCCCCCTGG - Exonic
1094168173 12:27464019-27464041 GCCTCTGCTGGGATTCCACTGGG - Intergenic
1094490992 12:30960507-30960529 CCCTCTGCCTGCTTTCCTCCAGG + Intronic
1095939359 12:47716129-47716151 ACCTCTCCTTGGCTTCCCCCTGG + Intronic
1103014601 12:117484239-117484261 GGCCCTGCTCTGTTTCCCCCTGG - Intronic
1103207380 12:119140773-119140795 GCCTCTGGGTGCTTTCTCCCAGG + Intronic
1104312253 12:127663916-127663938 GCCTCTGCCTGGCATCCTCCAGG + Intergenic
1104763672 12:131313212-131313234 GCCTCTGCTTGGGGTCCTGCGGG + Intergenic
1108693859 13:52885428-52885450 GCCTCTGCTTAGTTTCAGCAGGG - Intergenic
1110360722 13:74621648-74621670 GCATCTGCTTGGTTTTTGCCAGG - Intergenic
1113430502 13:110246278-110246300 GCCCGTGCTGGGTTTCACCCTGG + Intronic
1115786990 14:36837396-36837418 CCCTCTGCTTGGTCTTGCCCTGG - Intronic
1120731601 14:88008981-88009003 GCCTCTGCTTGGTTTCTGTGAGG - Intronic
1121798681 14:96755753-96755775 GCCTCTGCTTTGGTGCCCACTGG + Intergenic
1122689342 14:103524302-103524324 GCCACTGCTCTGTGTCCCCCTGG - Intergenic
1124407175 15:29403708-29403730 GCCTCTGCCTGGTTTTTCCCAGG + Intronic
1127161958 15:56197882-56197904 GACTCTGCTTTCTCTCCCCCAGG + Intronic
1127961067 15:63891337-63891359 CCCTCTGCCTCGTTTCCCTCAGG - Intergenic
1130217872 15:81989274-81989296 GCATCTGCTTGGCTTGTCCCTGG - Intergenic
1132064215 15:98717031-98717053 TCCCCTGCTTGTTTTCCCCATGG + Intronic
1133121667 16:3612140-3612162 ACCTCTGCTACCTTTCCCCCAGG - Intronic
1133285988 16:4691086-4691108 GCCTCTGCCTGGCTTCCCTCTGG + Intergenic
1134490377 16:14691604-14691626 GCCTCTGCTCGGGTTCCTGCTGG - Intronic
1134495758 16:14730721-14730743 GCCTCTGCTCGGGTTCCTGCTGG - Intronic
1134501304 16:14771032-14771054 GCCTCTGCTTGAGTTCCTGCTGG - Intronic
1134579277 16:15358002-15358024 GCCTCTGCTTGAGTTCCTGCTGG + Intergenic
1134723305 16:16399552-16399574 GCCTCTGCTTGAGTTCCTGCTGG - Intergenic
1134797335 16:17053636-17053658 GCCTGTGCTTGGTTTCACAGGGG + Intergenic
1134944123 16:18312318-18312340 GCCTCTGCTTGAGTTCCTGCTGG + Intergenic
1135398026 16:22146214-22146236 GCCTCTGCTTGCCTTAACCCAGG + Exonic
1136165547 16:28450666-28450688 GCCTCTGCTTGGGTTCCTGCTGG + Intergenic
1136197425 16:28664343-28664365 GCCTCTGCTTGGGTTCCTGCTGG - Intergenic
1136213764 16:28778490-28778512 GCCTCTGCTTGGGTTCCTGCTGG - Intergenic
1136258498 16:29058414-29058436 GCCTCTGCTTGGGTTCCTGCTGG - Intergenic
1136319997 16:29477902-29477924 GCCTCTGCTCGGGTTCCTGCTGG + Intergenic
1136434567 16:30217243-30217265 GCCTCTGCTCGGGTTCCTGCTGG + Intergenic
1136605746 16:31332149-31332171 GCCGCTGCTGGGTTTTCCTCCGG + Exonic
1138310097 16:56016366-56016388 GCCTCAGCCTCGCTTCCCCCAGG - Intergenic
1138496746 16:57413478-57413500 AGCTCTGCTTGGTTTCTGCCTGG + Intronic
1139681885 16:68571509-68571531 CCACCTGCTTGGTTTCCCTCAGG + Intronic
1140587365 16:76309286-76309308 GCCTCTGCTTGATTTCCTTTGGG - Intronic
1141189581 16:81814715-81814737 GCCTGTGCTTCATGTCCCCCAGG - Intronic
1141628783 16:85275738-85275760 CCCTTCGCTTGGTTTCCACCTGG - Intergenic
1142225109 16:88873396-88873418 GCATCTGCTTCTCTTCCCCCAGG - Intergenic
1142342185 16:89530939-89530961 GCACCTGCTTGGTGTCCCCATGG - Intronic
1142743070 17:1941858-1941880 CCCCCTGCTGGGTTTCTCCCAGG + Intronic
1143630973 17:8140238-8140260 GCCTCAGCTGGGTTTGCCCTGGG - Intergenic
1143756858 17:9073645-9073667 GCCTCTGCTTCCTTCCCTCCAGG + Intronic
1146737043 17:35247376-35247398 GCCTCTGCTTGTTCTCATCCAGG + Intronic
1148072014 17:44914063-44914085 GCCTCAGGTTGGTTTCATCCTGG + Exonic
1148725381 17:49785926-49785948 GCCTCTGACTGGTTGCCCCCTGG - Intronic
1149303319 17:55325627-55325649 GCCTCTGCGTGGATCCCCCAAGG - Intergenic
1149348329 17:55761409-55761431 GCCTCTGCCTGGTTTCTTCTTGG + Intronic
1150266501 17:63835461-63835483 TCCCCTGCTGGGGTTCCCCCAGG + Exonic
1152366175 17:79857838-79857860 GCCTCTGCTGGGGCTCGCCCAGG + Intergenic
1152475040 17:80512448-80512470 TCCTCTGAGTGGTTTGCCCCAGG - Intergenic
1152687496 17:81701803-81701825 GTCTCTGCTTTCTTTCCCCAGGG + Exonic
1152867379 17:82732339-82732361 GCCTCTGCTTGGGGTGGCCCAGG + Intergenic
1154339458 18:13491125-13491147 GACTCTGCCTGGTGTCCCACAGG - Intronic
1157492310 18:48132675-48132697 GCCTCTGCTAGATTTCCCTAGGG + Intronic
1157754133 18:50203369-50203391 GCCTCTGCTTGCATTCTTCCAGG - Intergenic
1157761699 18:50270085-50270107 GATACTGCTTTGTTTCCCCCAGG - Intronic
1157762610 18:50275526-50275548 GCCTCTGCTTCCTTTCAACCTGG - Intronic
1160120792 18:76129023-76129045 GCCTCAGCTTGGATTTCCTCTGG - Intergenic
1160318474 18:77869072-77869094 ACCTCTGCTTGGATTCCTGCAGG - Intergenic
1160472373 18:79147705-79147727 ACCTCTGCTTGTTTCCCCACAGG - Intronic
1161361844 19:3854581-3854603 GCCTCTGAGTGGTTTCTCTCTGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1161672881 19:5623822-5623844 TCGGCTGCTTGGTTTCCCCAGGG + Intronic
1162830592 19:13282037-13282059 CCCGCAGCCTGGTTTCCCCCAGG - Intronic
1164137151 19:22426155-22426177 GCCACTGCTAGGTCTCCCCAGGG - Intronic
1164161036 19:22625479-22625501 GCCACTGCTAGGTCTCCCCAGGG + Intergenic
1165997969 19:39858644-39858666 GCCTCTGATTGGTTGCTTCCTGG - Intergenic
1166357460 19:42235596-42235618 CCCTGTGCTTGGTCTCCTCCAGG + Intronic
1202681392 1_KI270712v1_random:7031-7053 GCCGCTGCTTTGTGCCCCCCCGG - Intergenic
925291049 2:2748929-2748951 GCCTCTGCCTGGCCTGCCCCTGG - Intergenic
925408342 2:3624127-3624149 GCCTCTCATTAGTTTCCCCTAGG + Intronic
926424646 2:12729786-12729808 GCCTCTGCTTGGTTTGCTTGAGG - Intronic
928861201 2:35859010-35859032 GGTTCTGCCTGGTTTTCCCCTGG - Intergenic
930028256 2:47042995-47043017 GCCACAGCTTCGATTCCCCCTGG + Intronic
932354702 2:71059131-71059153 GCCTGGGCTTTGTTTCCCTCAGG - Intergenic
936977651 2:118235540-118235562 GGCTGTGCATGGATTCCCCCAGG - Intergenic
938090344 2:128427191-128427213 GCCTTTACCTGGTTTCCTCCAGG + Intergenic
938314204 2:130315103-130315125 CACTCTGCTTGCATTCCCCCAGG + Intergenic
941987623 2:171523584-171523606 GCCTCTGCTCGGGATGCCCCCGG + Intronic
947088023 2:226477528-226477550 GTCTCTGCTTGGTGTCCCAAAGG + Intergenic
948368800 2:237474812-237474834 GCCTCTGCGTGGTCAGCCCCTGG - Intergenic
948766644 2:240225448-240225470 GACCCTGCTTGGGTTCACCCAGG + Intergenic
1170699086 20:18687171-18687193 ACCTCTGCATGATTGCCCCCTGG - Intronic
1171850756 20:30306417-30306439 GCCTCTGCTGTGTTTCCTGCTGG + Intergenic
1172787023 20:37475175-37475197 TCCTCTGCTTCTCTTCCCCCAGG + Intergenic
1173140248 20:40475526-40475548 ATCTCTGCTTGGATTCCCCTGGG - Intergenic
1173306580 20:41856299-41856321 GTCTCTCCGTGTTTTCCCCCAGG - Intergenic
1175409054 20:58754071-58754093 GTCTCTGCTTGGTGCACCCCAGG + Intergenic
1175804023 20:61817342-61817364 GCCTCTGCCTGGTTGCTCTCTGG + Intronic
1178615489 21:34129372-34129394 GCCTCTGCTCTGTTTCTACCGGG + Intronic
1179722260 21:43322492-43322514 GCCTCTGCTTGGTTTCTGGCTGG - Intergenic
1181172609 22:21018163-21018185 GCCTGTGCTCGGTGTCCCCCAGG + Intronic
1181176752 22:21042218-21042240 GCATGTGCTTAGTGTCCCCCAGG - Intergenic
1182711069 22:32323688-32323710 GCCTCTGCTTGGTTTCCCCCAGG + Intergenic
1183454002 22:37911698-37911720 GCCTCTGCTTGGATGCCTCCAGG + Intronic
952695414 3:36259955-36259977 GCCTCTAGTTGGTATCCCCAGGG + Intergenic
956647290 3:71468695-71468717 CCCTTTCCTTGTTTTCCCCCTGG + Intronic
957421827 3:79980900-79980922 GCATCTGCTTGGATTCGACCAGG + Intergenic
961170720 3:124796054-124796076 GCCTCTTCTTGATTGCCTCCTGG - Intronic
962107410 3:132405922-132405944 GCCTCTGCTTGGTTCACCAGTGG - Intergenic
963345955 3:144096949-144096971 CCCTTTGCTTGCTTTCCCCTGGG + Intergenic
965320775 3:167249399-167249421 TCCTCTGCTGGGGTTGCCCCTGG - Intronic
966832216 3:184019245-184019267 GACTCTTCTTGCTTTCCCCACGG - Intergenic
967979590 3:195057881-195057903 GCCTCTGCTTGCACACCCCCAGG + Intergenic
971385349 4:26136570-26136592 GCCTCTCCTTGGATTGCCACTGG + Intergenic
979025984 4:115576202-115576224 GCTACTGATTGTTTTCCCCCCGG - Intergenic
983266516 4:165513434-165513456 GCTTCTGCTTCTTTTCCACCAGG - Intergenic
985761144 5:1749530-1749552 GGCTCTGCGTGGTCTCCCCGTGG - Intergenic
987229547 5:15879345-15879367 GCCTCTGCTTGCCCTCCACCAGG + Intronic
990615963 5:57508700-57508722 GCTTCTGCTTGGTTTCGCCTGGG + Intergenic
994855443 5:105113658-105113680 GCCTCTGCTTGATTTACCTATGG + Intergenic
994895276 5:105695222-105695244 TCTTCTCCTTGTTTTCCCCCTGG - Intergenic
995331803 5:110955025-110955047 GCCTATGCCTGGTTTCTCCTAGG + Intergenic
997841353 5:137243234-137243256 GCCTCAGCGTGCTTTTCCCCAGG - Intronic
999176993 5:149638778-149638800 GCCAGTCCTGGGTTTCCCCCGGG - Intergenic
999388732 5:151174517-151174539 GCCTCTGCCTGATTTCCTTCTGG - Intergenic
1000201226 5:159012913-159012935 GCCTTTGCATGGTCTTCCCCTGG - Intronic
1000988635 5:167888713-167888735 GCCTTTCCTTTGATTCCCCCAGG + Intronic
1001981513 5:176040975-176040997 GCCTCTGCTTGAATTCCCTGAGG + Intergenic
1002235954 5:177803091-177803113 GCCTCTGCTTGAATTCCCTGAGG - Intergenic
1002807966 6:596208-596230 GCCTCTGCTTGCTTCCTCCTGGG + Intronic
1005898619 6:30198524-30198546 GCCACTGCTTGTTTTTCCACAGG - Exonic
1006515920 6:34545466-34545488 GCCCCGGCTTGGTTTTGCCCAGG + Intronic
1007744794 6:44036950-44036972 GCCTGTGCTTGGTCTCCGCACGG - Intergenic
1007774263 6:44216099-44216121 GCCTCTACTTTTCTTCCCCCAGG + Intergenic
1013946590 6:115729137-115729159 GCCTCTGCTGTGTGTCACCCAGG + Intergenic
1014148155 6:118022040-118022062 GACTCTGTTTCTTTTCCCCCTGG - Intronic
1017777024 6:157688494-157688516 CCTCCTGCTTGGTTTCCCCATGG - Intergenic
1018708179 6:166478058-166478080 TCCCCTGCTTGGCCTCCCCCTGG - Intronic
1019285259 7:220082-220104 GTCTTGGCTTGGCTTCCCCCAGG - Intronic
1019294729 7:267648-267670 GCCTTTGCATGGCTGCCCCCTGG + Intergenic
1019488959 7:1302172-1302194 GCCTCCACGTGGTTTCTCCCAGG - Intergenic
1019867137 7:3722483-3722505 GCTCCTGCCTGCTTTCCCCCTGG - Intronic
1021237163 7:18156198-18156220 GCCTCAGCTTTTTTTCCCCAAGG - Intronic
1022472021 7:30687888-30687910 GCCTGTGCTAGGTGTCCCCGTGG + Intronic
1023108750 7:36789233-36789255 GCCTCTGCTAGGTTCCTCACTGG + Intergenic
1023183884 7:37513681-37513703 GACTCTGCTTGGTCCCTCCCCGG - Intergenic
1023909641 7:44544251-44544273 GCCTCTGCCAGGTGTCACCCCGG - Intergenic
1026910766 7:74090591-74090613 GACTCTGCTTAGTCTCCCTCGGG + Intronic
1027233671 7:76285853-76285875 GACTCAGCTTGGTGCCCCCCTGG + Exonic
1032845445 7:135748075-135748097 GCTTCTGCTCTGGTTCCCCCAGG + Intronic
1034967202 7:155398742-155398764 GTCTCCACTTGGTCTCCCCCAGG - Intergenic
1035185971 7:157125941-157125963 GCCTCTGCGGGGTTTCCCGTGGG - Intergenic
1035594362 8:843506-843528 GCCTCTCCTGGGGTTCCACCGGG + Intergenic
1038481536 8:27905169-27905191 CCCTCTCCTTTGTTTTCCCCTGG - Intronic
1040291261 8:46126390-46126412 GCTTCTGCTTGATGTCACCCTGG - Intergenic
1041008958 8:53522949-53522971 GCTTCTGCTTGATGTCACCCTGG + Intergenic
1041778608 8:61553045-61553067 CCCTCTGCATGGCATCCCCCAGG + Exonic
1044557445 8:93579077-93579099 GCCTTTGCTTGGATTCCATCCGG - Intergenic
1045036125 8:98177902-98177924 TCCTCTGCCTGGATTCCCTCAGG - Intergenic
1047337973 8:123954327-123954349 GCCTCTGCTTGCATGCCTCCAGG + Intronic
1048177169 8:132163302-132163324 TCCTCTGCCTGGTTTCCTTCTGG - Intronic
1048941373 8:139403450-139403472 GCCTCTGCTTGCTCTCCTCTGGG + Intergenic
1049719891 8:144110944-144110966 GCCTCTGCCTGGTGTCCCACAGG + Exonic
1049808404 8:144551815-144551837 GCCCCTGCTGGGCTTCCTCCTGG + Intronic
1050137130 9:2478018-2478040 GCCTTTGCTTGGTCTGACCCAGG - Intergenic
1051857825 9:21589508-21589530 CCCTCTCCTTGGTCTCCTCCTGG + Intergenic
1056723158 9:89088855-89088877 GCCTCTGCTGGGTTCTCCCCTGG - Intronic
1057389613 9:94631912-94631934 GCCTCTGCTTGCATTCACCGGGG + Intronic
1057835689 9:98443216-98443238 GCCTCCTCTTTGTTTCTCCCAGG + Intronic
1059239688 9:112793443-112793465 GCCTGTGCTTGGCATCCCCTTGG + Intronic
1060477726 9:123998817-123998839 CCCTCTGCTTGGTGTCAACCAGG + Intergenic
1060959061 9:127666144-127666166 GCATCTCCCTGTTTTCCCCCAGG + Exonic
1061303281 9:129718450-129718472 CCCTCTGGTTGGTCTCTCCCCGG + Intronic
1061312523 9:129773397-129773419 GCCCCTGCCTGGTTACCACCAGG + Intergenic
1062327368 9:136018599-136018621 GCCTCTGCTTGGGTGTCCCTGGG - Intronic
1062500427 9:136849745-136849767 GCCCCTGCTAGGTTTGACCCAGG + Intronic
1062547772 9:137071293-137071315 GCCTCTGCTGTGTTTCCAGCTGG + Intergenic
1186778567 X:12890782-12890804 GCCTCTGGTTGGCTCCACCCCGG + Intergenic
1189116543 X:38349037-38349059 GCTTCTTCTTCTTTTCCCCCTGG - Intronic
1194666262 X:96680940-96680962 GCCTTTTATTGGTCTCCCCCAGG + Intergenic
1196334563 X:114516491-114516513 GCCTGTCCTTGATTTCTCCCAGG - Intergenic
1200053308 X:153445942-153445964 GCCTCTGCCTGCTTGCCCCCAGG + Intronic
1200120628 X:153788611-153788633 GCCTCTGCTTCCCTTCCTCCAGG - Intronic