ID: 1182711370

View in Genome Browser
Species Human (GRCh38)
Location 22:32325346-32325368
Sequence TCTTGGGGCCCTGGCCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182711361_1182711370 9 Left 1182711361 22:32325314-32325336 CCCACGCTGTGTCAGTGGTGAGT No data
Right 1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG No data
1182711362_1182711370 8 Left 1182711362 22:32325315-32325337 CCACGCTGTGTCAGTGGTGAGTG No data
Right 1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG No data
1182711359_1182711370 28 Left 1182711359 22:32325295-32325317 CCAAAACAAGAGCAGCAGACCCA No data
Right 1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG No data
1182711357_1182711370 30 Left 1182711357 22:32325293-32325315 CCCCAAAACAAGAGCAGCAGACC No data
Right 1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG No data
1182711358_1182711370 29 Left 1182711358 22:32325294-32325316 CCCAAAACAAGAGCAGCAGACCC No data
Right 1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182711370 Original CRISPR TCTTGGGGCCCTGGCCGGGG TGG Intergenic
No off target data available for this crispr