ID: 1182712831

View in Genome Browser
Species Human (GRCh38)
Location 22:32333270-32333292
Sequence CTGTGCTGGAAGTGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182712827_1182712831 -7 Left 1182712827 22:32333254-32333276 CCACGGGGCTCTCTGACTGTGCT No data
Right 1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG No data
1182712818_1182712831 19 Left 1182712818 22:32333228-32333250 CCCTCACCCAGTCCAGTGGAAAC No data
Right 1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG No data
1182712826_1182712831 7 Left 1182712826 22:32333240-32333262 CCAGTGGAAACAGGCCACGGGGC No data
Right 1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG No data
1182712821_1182712831 13 Left 1182712821 22:32333234-32333256 CCCAGTCCAGTGGAAACAGGCCA No data
Right 1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG No data
1182712816_1182712831 23 Left 1182712816 22:32333224-32333246 CCTGCCCTCACCCAGTCCAGTGG No data
Right 1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG No data
1182712822_1182712831 12 Left 1182712822 22:32333235-32333257 CCAGTCCAGTGGAAACAGGCCAC No data
Right 1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG No data
1182712815_1182712831 28 Left 1182712815 22:32333219-32333241 CCAGTCCTGCCCTCACCCAGTCC No data
Right 1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG No data
1182712819_1182712831 18 Left 1182712819 22:32333229-32333251 CCTCACCCAGTCCAGTGGAAACA No data
Right 1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182712831 Original CRISPR CTGTGCTGGAAGTGGGCAGC AGG Intergenic
No off target data available for this crispr