ID: 1182714010

View in Genome Browser
Species Human (GRCh38)
Location 22:32340731-32340753
Sequence CTGTCCTCATCTCCCGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182714010_1182714018 -5 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714018 22:32340749-32340771 GACAGAGGGACAGTGGGGTGGGG No data
1182714010_1182714020 -1 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714020 22:32340753-32340775 GAGGGACAGTGGGGTGGGGTGGG No data
1182714010_1182714016 -7 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714016 22:32340747-32340769 AGGACAGAGGGACAGTGGGGTGG No data
1182714010_1182714021 0 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714021 22:32340754-32340776 AGGGACAGTGGGGTGGGGTGGGG No data
1182714010_1182714015 -10 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714015 22:32340744-32340766 ATGAGGACAGAGGGACAGTGGGG No data
1182714010_1182714017 -6 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714017 22:32340748-32340770 GGACAGAGGGACAGTGGGGTGGG No data
1182714010_1182714019 -2 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714019 22:32340752-32340774 AGAGGGACAGTGGGGTGGGGTGG No data
1182714010_1182714022 17 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714022 22:32340771-32340793 GTGGGGTCAGATCATGTTGTTGG No data
1182714010_1182714023 23 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714023 22:32340777-32340799 TCAGATCATGTTGTTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182714010 Original CRISPR CTGTCCTCATCTCCCGACAC TGG (reversed) Intergenic