ID: 1182714022

View in Genome Browser
Species Human (GRCh38)
Location 22:32340771-32340793
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182714010_1182714022 17 Left 1182714010 22:32340731-32340753 CCAGTGTCGGGAGATGAGGACAG No data
Right 1182714022 22:32340771-32340793 GTGGGGTCAGATCATGTTGTTGG No data
1182714008_1182714022 24 Left 1182714008 22:32340724-32340746 CCAAGTGCCAGTGTCGGGAGATG No data
Right 1182714022 22:32340771-32340793 GTGGGGTCAGATCATGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182714022 Original CRISPR GTGGGGTCAGATCATGTTGT TGG Intergenic