ID: 1182714126

View in Genome Browser
Species Human (GRCh38)
Location 22:32341329-32341351
Sequence AGCAAGAAGGGCGGCCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182714117_1182714126 22 Left 1182714117 22:32341284-32341306 CCTGGTCTCTAAGATCAGGGAGA No data
Right 1182714126 22:32341329-32341351 AGCAAGAAGGGCGGCCGTGAGGG No data
1182714116_1182714126 23 Left 1182714116 22:32341283-32341305 CCCTGGTCTCTAAGATCAGGGAG No data
Right 1182714126 22:32341329-32341351 AGCAAGAAGGGCGGCCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182714126 Original CRISPR AGCAAGAAGGGCGGCCGTGA GGG Intergenic