ID: 1182714740

View in Genome Browser
Species Human (GRCh38)
Location 22:32348452-32348474
Sequence CCTTCCTGGCCTCCACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182714740_1182714751 -7 Left 1182714740 22:32348452-32348474 CCTCCCAGTGGAGGCCAGGAAGG No data
Right 1182714751 22:32348468-32348490 AGGAAGGAGGGGAGAGCTGGGGG No data
1182714740_1182714754 14 Left 1182714740 22:32348452-32348474 CCTCCCAGTGGAGGCCAGGAAGG No data
Right 1182714754 22:32348489-32348511 GGTGGTGGTGTTACCAGAAAAGG No data
1182714740_1182714749 -9 Left 1182714740 22:32348452-32348474 CCTCCCAGTGGAGGCCAGGAAGG No data
Right 1182714749 22:32348466-32348488 CCAGGAAGGAGGGGAGAGCTGGG No data
1182714740_1182714747 -10 Left 1182714740 22:32348452-32348474 CCTCCCAGTGGAGGCCAGGAAGG No data
Right 1182714747 22:32348465-32348487 GCCAGGAAGGAGGGGAGAGCTGG No data
1182714740_1182714755 15 Left 1182714740 22:32348452-32348474 CCTCCCAGTGGAGGCCAGGAAGG No data
Right 1182714755 22:32348490-32348512 GTGGTGGTGTTACCAGAAAAGGG No data
1182714740_1182714753 -1 Left 1182714740 22:32348452-32348474 CCTCCCAGTGGAGGCCAGGAAGG No data
Right 1182714753 22:32348474-32348496 GAGGGGAGAGCTGGGGGTGGTGG No data
1182714740_1182714750 -8 Left 1182714740 22:32348452-32348474 CCTCCCAGTGGAGGCCAGGAAGG No data
Right 1182714750 22:32348467-32348489 CAGGAAGGAGGGGAGAGCTGGGG No data
1182714740_1182714752 -4 Left 1182714740 22:32348452-32348474 CCTCCCAGTGGAGGCCAGGAAGG No data
Right 1182714752 22:32348471-32348493 AAGGAGGGGAGAGCTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182714740 Original CRISPR CCTTCCTGGCCTCCACTGGG AGG (reversed) Intergenic
No off target data available for this crispr