ID: 1182715171

View in Genome Browser
Species Human (GRCh38)
Location 22:32352543-32352565
Sequence CATCTCCTGCAGAATCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182715171_1182715177 2 Left 1182715171 22:32352543-32352565 CCCTCCAGATTCTGCAGGAGATG No data
Right 1182715177 22:32352568-32352590 GGGAAGACTCCTCCTTCCCCTGG No data
1182715171_1182715183 28 Left 1182715171 22:32352543-32352565 CCCTCCAGATTCTGCAGGAGATG No data
Right 1182715183 22:32352594-32352616 CACCTCCACCGCTGTCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182715171 Original CRISPR CATCTCCTGCAGAATCTGGA GGG (reversed) Intergenic
No off target data available for this crispr