ID: 1182715255

View in Genome Browser
Species Human (GRCh38)
Location 22:32352942-32352964
Sequence CACAAGCTCCAGCCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182715251_1182715255 5 Left 1182715251 22:32352914-32352936 CCAACCACAGCGAGGCGAGCGGT No data
Right 1182715255 22:32352942-32352964 CACAAGCTCCAGCCTCCAGCAGG No data
1182715246_1182715255 17 Left 1182715246 22:32352902-32352924 CCATGGCCGCCACCAACCACAGC No data
Right 1182715255 22:32352942-32352964 CACAAGCTCCAGCCTCCAGCAGG No data
1182715249_1182715255 8 Left 1182715249 22:32352911-32352933 CCACCAACCACAGCGAGGCGAGC No data
Right 1182715255 22:32352942-32352964 CACAAGCTCCAGCCTCCAGCAGG No data
1182715253_1182715255 1 Left 1182715253 22:32352918-32352940 CCACAGCGAGGCGAGCGGTGGTG No data
Right 1182715255 22:32352942-32352964 CACAAGCTCCAGCCTCCAGCAGG No data
1182715248_1182715255 11 Left 1182715248 22:32352908-32352930 CCGCCACCAACCACAGCGAGGCG No data
Right 1182715255 22:32352942-32352964 CACAAGCTCCAGCCTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182715255 Original CRISPR CACAAGCTCCAGCCTCCAGC AGG Intergenic
No off target data available for this crispr