ID: 1182716215

View in Genome Browser
Species Human (GRCh38)
Location 22:32357840-32357862
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 3, 1: 0, 2: 1, 3: 9, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182716210_1182716215 0 Left 1182716210 22:32357817-32357839 CCTAGGAGGTGGTGAAATGACCC 0: 1
1: 2
2: 1
3: 11
4: 140
Right 1182716215 22:32357840-32357862 CAGCTCGCTGTTCCTCACATGGG 0: 3
1: 0
2: 1
3: 9
4: 101
1182716209_1182716215 1 Left 1182716209 22:32357816-32357838 CCCTAGGAGGTGGTGAAATGACC 0: 1
1: 2
2: 0
3: 12
4: 95
Right 1182716215 22:32357840-32357862 CAGCTCGCTGTTCCTCACATGGG 0: 3
1: 0
2: 1
3: 9
4: 101
1182716208_1182716215 2 Left 1182716208 22:32357815-32357837 CCCCTAGGAGGTGGTGAAATGAC 0: 1
1: 2
2: 0
3: 4
4: 105
Right 1182716215 22:32357840-32357862 CAGCTCGCTGTTCCTCACATGGG 0: 3
1: 0
2: 1
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902282168 1:15382676-15382698 CAGCTCTCTGTTCCACACTAAGG - Intronic
902862418 1:19255997-19256019 CAGCTTGCTGTTCCTCATGTTGG - Exonic
903047531 1:20575742-20575764 CAGATCGCTGTTCCTCACCCTGG + Intergenic
903228425 1:21906967-21906989 CAGCCCGCTTTTCCTTCCATGGG - Intronic
903358232 1:22761194-22761216 CAGCTGGCTGTGCATCACAATGG - Intronic
904414990 1:30355245-30355267 CTTCTCACTGTTCCTCACGTAGG - Intergenic
915327099 1:155086182-155086204 CAGCACGTTGATCTTCACATTGG - Exonic
916315463 1:163443507-163443529 AGGCTCCCTGTTCGTCACATAGG - Intergenic
920044644 1:203125509-203125531 CTGCTCTCTGTGCCTCACAGGGG + Intronic
921710314 1:218367020-218367042 CTGCTCACTGTTCATCACAGAGG + Intronic
922880379 1:228975887-228975909 CAGCTCTCCTTTCCCCACATGGG - Intergenic
924262154 1:242243119-242243141 CAGCTTGCTGTGCCACAAATGGG + Intronic
924847655 1:247789490-247789512 CAGATTGCTGGTCCTCACACTGG + Intergenic
1063462885 10:6225583-6225605 CATCACGCTGTCCCTCTCATGGG + Intronic
1063581239 10:7309553-7309575 AAGCTGTCTGTCCCTCACATTGG + Intronic
1066028700 10:31394463-31394485 CATCTAGGTGTTCATCACATAGG - Intronic
1067897460 10:50199734-50199756 CTGCCGGCTGATCCTCACATGGG - Intronic
1067951513 10:50742305-50742327 CTGCCGGCTGATCCTCACATGGG + Intronic
1068934429 10:62622217-62622239 CACCTCCCAGTTCCTCCCATTGG - Intronic
1069241151 10:66140728-66140750 CAACTGGCACTTCCTCACATAGG - Intronic
1070330043 10:75409841-75409863 CGGCTCCCTTTTCCTCACCTGGG + Intergenic
1072311185 10:94156893-94156915 CTGCTCCCAGTTCCTGACATAGG - Intronic
1073997955 10:109337958-109337980 CAGCTCGCTGTTTGTCTGATGGG + Intergenic
1076202531 10:128569754-128569776 CATCTCGCTGTCCCTCAGGTAGG + Intergenic
1077662503 11:4082430-4082452 CCTCTCCCTGTTCCTCCCATTGG + Intronic
1078143272 11:8706886-8706908 CAGCCCTCTGTTCCTCCCAGGGG - Intronic
1079849900 11:25518734-25518756 CAGCTCTCTGTTTCTCATAAGGG - Intergenic
1080855539 11:36108695-36108717 CATCACGCTGTTTCTCACCTTGG - Intronic
1082129757 11:48473621-48473643 CAGCTCATTGTTCCTCACCCTGG - Intergenic
1082563280 11:54644519-54644541 CAGCTCATTGTTCCTCACCCTGG - Intergenic
1084959509 11:72709105-72709127 CAGCTCCCTGTTCTTCCCAGAGG - Intronic
1088803814 11:113332622-113332644 CAGCTCTCTTCTCCTCTCATGGG + Intronic
1090258575 11:125302917-125302939 TAGCTCGCTGCTCCACACAGTGG + Intronic
1091789298 12:3262519-3262541 CAGCTCACTATTTATCACATAGG + Intronic
1101785641 12:107881002-107881024 CAGCTCGTTGCTCCTCACATGGG + Intergenic
1102693440 12:114779660-114779682 CAGTTCCCTGTTCCACAAATGGG + Intergenic
1103715516 12:122943153-122943175 CAGCTCCCTGGCCCTCAGATGGG + Intronic
1105698159 13:22910904-22910926 CACCACGCTCGTCCTCACATGGG + Intergenic
1106778586 13:33032690-33032712 AACCTGGCTGTTCCTCCCATTGG - Intronic
1113515152 13:110888859-110888881 CAGCTCGGTCTTAATCACATAGG - Intronic
1115648279 14:35385085-35385107 CCGCTGGCCGTTCCTCACAGCGG + Intergenic
1118599215 14:67459706-67459728 ACACACGCTGTTCCTCACATAGG + Intronic
1124193103 15:27597630-27597652 GAGCTCTCTGTTCCTGACATAGG + Intergenic
1125993654 15:44134901-44134923 CTTCTTGCTGTTTCTCACATAGG - Intronic
1126405335 15:48317342-48317364 CTACTCACTGTTCTTCACATGGG - Intergenic
1139191801 16:64872769-64872791 AAGCCCGCTGTTTCTCACATAGG + Intergenic
1141162333 16:81637897-81637919 CTTCTCGCTGTGTCTCACATGGG + Intronic
1146620445 17:34393151-34393173 CAGCCCACTGTTCCTCTTATGGG + Intergenic
1147587384 17:41660244-41660266 CAGCTCTCTGGTGCTCACTTTGG - Intergenic
1148584037 17:48764299-48764321 CAGGGCGCCATTCCTCACATGGG + Intronic
1149601914 17:57898803-57898825 CAGCTCCCTGCTCCTCCCTTGGG - Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1153457856 18:5298426-5298448 GAGCACGTTGTTCCTCACTTGGG + Intergenic
1156471367 18:37379025-37379047 CTGCTGGCTCTTCCTCACCTGGG + Intronic
1157586044 18:48801901-48801923 CAGCTCCCAGTTCCTCCCACAGG + Intronic
925788366 2:7455117-7455139 CAGGTGTCTGTTACTCACATGGG + Intergenic
933525351 2:83431274-83431296 CTGCTTGCAGTTCCTCACTTTGG + Intergenic
934030432 2:88040668-88040690 CACATAGCTGTTCCACACATTGG + Intronic
934573940 2:95388990-95389012 CAGCCTGCTGGTCCTCACACGGG - Intergenic
936348060 2:111690262-111690284 CAGCTTTCTTTTCCTCACTTAGG - Intergenic
937150599 2:119683213-119683235 CAGCTCACGGGTCCTCACACTGG + Intronic
1170938981 20:20833136-20833158 CAGCTCCCTGCTCCTCAGATGGG + Intergenic
1171171190 20:23016992-23017014 CAGCTCCCTGATCCTCAGCTGGG + Intergenic
1174332473 20:49831126-49831148 TAACTCCCTCTTCCTCACATGGG + Intronic
1175270520 20:57730781-57730803 CCGCTCACTGTTCCTCTCCTTGG + Intergenic
1176145706 20:63564522-63564544 CATCTCCCTGTTCCTCACCATGG - Exonic
1182314816 22:29438556-29438578 CAGCTCGCTGTTCCTCACATGGG + Intergenic
1182695133 22:32193484-32193506 CAGCTCGCTGTTCCTCACATGGG - Intronic
1182716215 22:32357840-32357862 CAGCTCGCTGTTCCTCACATGGG + Intronic
951149290 3:19268454-19268476 CAGATAGCTGTTTATCACATAGG + Intronic
953296193 3:41719811-41719833 CATCTCATTGTTCTTCACATAGG + Intronic
953413932 3:42704764-42704786 CAGCTTCCTGTCCCTCACGTGGG - Intronic
961617042 3:128190900-128190922 CAGCTCACTGTGCCTCGCCTGGG + Intronic
961645823 3:128392339-128392361 CAGCTGGTTGTTCCTCACCGGGG + Intronic
965531638 3:169776179-169776201 CACCTGGCTGTTCTTCACATTGG - Intronic
967537443 3:190623114-190623136 CTGCTCCCAGTTCCTGACATGGG - Intronic
969899339 4:10334185-10334207 CAGCTTTCTGTGCCTCACACAGG + Intergenic
970477069 4:16434657-16434679 CAGGTGGCTCTTCCTCAAATTGG - Intergenic
976505937 4:85847661-85847683 CACCTTGCAGTTCCTCAAATAGG - Intronic
981045162 4:140258028-140258050 CTGACTGCTGTTCCTCACATAGG + Intronic
985880086 5:2632833-2632855 CTGTTCTCTGATCCTCACATGGG - Intergenic
986143587 5:5055064-5055086 CAGCTCGGTGTTCCTCTGCTGGG + Intergenic
995935311 5:117504164-117504186 CTGCTCTCTGTTTATCACATCGG + Intergenic
996693909 5:126371550-126371572 CAGCTCGGTGTTCCTCAGGTGGG + Intronic
1005807037 6:29483796-29483818 CAGTTCTCTGTTCTTCTCATTGG + Intergenic
1012414485 6:98998306-98998328 CAGCTCACTGTTCCACATAGAGG + Intergenic
1015747579 6:136526624-136526646 CAGCTCCCTCTTCCTCTCAGCGG + Intronic
1017159718 6:151353374-151353396 CACCTCCCTCTTCCTCAGATGGG - Exonic
1018464978 6:164035604-164035626 CAGCTGGATGTTCTTTACATAGG + Intergenic
1019547303 7:1584682-1584704 CAGCTCGGTGTTTCTCACCTGGG + Intergenic
1024085354 7:45888041-45888063 CATCTCGCCTTTCCTCACCTGGG + Intergenic
1025716374 7:63960812-63960834 CAGTTAGCTGTTTCTCTCATTGG - Intergenic
1026461570 7:70619466-70619488 CAGCTCTCTCTTCCTCTCCTGGG - Intronic
1027056120 7:75050698-75050720 CGACTCTCTGTTCCTCACACCGG + Intronic
1027532682 7:79354729-79354751 CACCTCGGTGTGCCTCACAATGG + Intronic
1029263487 7:99320516-99320538 TAGCTCCCAGTTCCTCACGTAGG + Intergenic
1029263549 7:99320952-99320974 TAGCTCCCAGTTCCTCACACAGG + Intergenic
1034415162 7:150960825-150960847 CAGCTCCCTGTTGAGCACATGGG + Intronic
1036695224 8:10969902-10969924 CATTTGCCTGTTCCTCACATGGG - Intronic
1037389736 8:18380833-18380855 CTGGTGGCTGCTCCTCACATAGG - Intergenic
1039148287 8:34474741-34474763 CTCCTTGCTGTTCCTCACACAGG - Intergenic
1039886026 8:41654261-41654283 CAGCTGGCAGTTCCTCGCCTCGG - Intronic
1047027780 8:120843255-120843277 CAGCTCTGTCTTCCTCACTTTGG + Intergenic
1048589079 8:135804371-135804393 CAACTCAGTGTTCCTCAAATTGG - Intergenic
1051503956 9:17807765-17807787 GAGCAAGCTGTTTCTCACATGGG + Intergenic
1052104424 9:24494979-24495001 CCTCTCGCTGTTTCTCATATCGG + Intergenic
1058846736 9:108967984-108968006 CAGCTAGCTGTTCCTCCCTCTGG + Intronic
1185850493 X:3481362-3481384 CAGCCCTCTGTTCCACAAATAGG + Intergenic
1188809282 X:34632841-34632863 AAGCTCCCTTTTCCTCACAAAGG - Intronic
1195070561 X:101275127-101275149 TTGCTGGCTGTTCCTCTCATAGG - Intronic
1197968018 X:132085597-132085619 CACCTGGCTGTTGCTCACATGGG - Exonic
1198219843 X:134589115-134589137 CAGTTCCCTGTCACTCACATTGG - Intronic
1199818245 X:151419244-151419266 CATCTCATTGTTCCTCACCTGGG - Intergenic
1200811820 Y:7493864-7493886 TAGCCCTCTGTTCCTCAAATAGG - Intergenic