ID: 1182718386

View in Genome Browser
Species Human (GRCh38)
Location 22:32377961-32377983
Sequence GTCTCTGAGAAAATCACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182718386_1182718388 22 Left 1182718386 22:32377961-32377983 CCATGGGTGATTTTCTCAGAGAC 0: 1
1: 0
2: 3
3: 14
4: 177
Right 1182718388 22:32378006-32378028 CTCCTCTCATACCTTACCATTGG 0: 1
1: 0
2: 1
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182718386 Original CRISPR GTCTCTGAGAAAATCACCCA TGG (reversed) Intronic
901890536 1:12259603-12259625 GCCTTTAAGAAAATCATCCAAGG - Intronic
902112774 1:14096900-14096922 GTTTCTCAGAAGCTCACCCAGGG + Intergenic
903887967 1:26551908-26551930 GTCTCTGAGAGTTTCTCCCAAGG + Intronic
904604496 1:31691374-31691396 GTCTCTGAGAAAAGCACAGCAGG + Intronic
905132879 1:35774569-35774591 GTCTGGGAAAAAATCAGCCATGG + Intergenic
905957099 1:42006807-42006829 GTCTCTGAGAAACCCATTCAGGG - Intronic
906550778 1:46664956-46664978 GTATCAGAGAAAATTTCCCATGG - Intronic
909192117 1:72566714-72566736 GTTTTTAAGAAAATCACACAAGG + Intergenic
913465646 1:119140234-119140256 GTCTCTGAAAACATCACACGCGG + Intronic
914417760 1:147499676-147499698 GTCTCTGACAAATTCTCCCTAGG + Intergenic
917668312 1:177247374-177247396 GTATGTGAGAAAATTTCCCATGG + Intronic
918742823 1:188157429-188157451 AGATCTGAGAAAATAACCCAAGG - Intergenic
920003963 1:202819121-202819143 GACTCGGATAAAATCACCCAGGG + Intergenic
920718607 1:208365812-208365834 GTCTCCTAGAGAATCAACCATGG + Intergenic
923793429 1:237130926-237130948 ATCTCTGAGACAGTCACACAGGG + Intronic
924950125 1:248874355-248874377 GACTCTGGGAACATCACCTATGG - Intergenic
1063548503 10:7005650-7005672 GTTTTTGAGAAAATCAGCCATGG - Intergenic
1065910511 10:30299702-30299724 GTCTCTGAGAAGATCAGGGAAGG - Intergenic
1066179191 10:32943391-32943413 ATCTCTGAGAATACCTCCCATGG + Intronic
1069089847 10:64186833-64186855 GACACTGAGTAAATCACTCAAGG - Intergenic
1075468907 10:122673244-122673266 GTGGCTGAGAAAATCAGACATGG + Intergenic
1075960971 10:126567529-126567551 CTCTCTGAGCAAATCTCCCGGGG - Intronic
1076027363 10:127126862-127126884 GGCTCTGAGAGAATGAGCCAGGG - Intronic
1078783322 11:14461157-14461179 GAATATGAGAAAATCTCCCAAGG + Intronic
1084450253 11:69232609-69232631 GGCTCTGAGAGAATCACCCCAGG - Intergenic
1085230394 11:74963279-74963301 TTCTTTGAGAAAATTACTCATGG - Intronic
1085893808 11:80612659-80612681 GACTCTTAGAAAATCAGACAGGG - Intergenic
1088126544 11:106432646-106432668 ACCTCTGAGATAATCACCAAAGG + Intergenic
1091012038 11:132010402-132010424 GTCTCTGGGAAGAGCAGCCAGGG - Intronic
1091335275 11:134761939-134761961 GTCTCTGAGAAACTGAGCCAGGG + Intergenic
1092260365 12:6950436-6950458 AGCCCTGAGAAAATCAGCCATGG + Intronic
1092950779 12:13500903-13500925 GTCTCAAATAAGATCACCCAGGG - Intergenic
1093527350 12:20117177-20117199 GTCTGTGAGCAAGTCACCAAAGG - Intergenic
1094761344 12:33536906-33536928 GTCTCTGGGGAAATCGTCCAGGG - Intergenic
1095390906 12:41705201-41705223 GTGACTGAGAAAATCAGACAAGG - Intergenic
1102877765 12:116461009-116461031 GTCTCTAAGAAAATCAGCTAGGG + Intergenic
1103378451 12:120475132-120475154 GTCTCTGAAAAAAACACCAGAGG - Intronic
1104162816 12:126196915-126196937 ATCTCTGTGACAAACACCCAGGG - Intergenic
1106968692 13:35107402-35107424 GTGTCTGACAAAATTACCAATGG - Intronic
1107367879 13:39704861-39704883 ATATCTGAGAAAAACATCCAGGG - Intronic
1108835909 13:54547763-54547785 AACTATGAGAAAATAACCCAAGG + Intergenic
1110747109 13:79067109-79067131 GTTTCTGACAAAATCGCCGAGGG + Intergenic
1111148076 13:84211051-84211073 ATCTCTCATAAAGTCACCCAGGG + Intergenic
1112284066 13:98088443-98088465 GTATCTGAAAACATCACCTAGGG - Intergenic
1113370929 13:109724804-109724826 TGATTTGAGAAAATCACCCATGG + Intergenic
1113785570 13:113000569-113000591 GCCTCTGGGAACATCAGCCATGG - Intronic
1116944156 14:50820397-50820419 GACTCTAAGAAAACCACTCAAGG + Intronic
1117116548 14:52519471-52519493 GTCTCTGAGAACATCAACCAGGG + Intronic
1119613919 14:76085935-76085957 GTCTCTGACAAAATCTCCCCTGG + Intergenic
1119794609 14:77384693-77384715 TCCTCTGATAAAATCAACCAGGG - Intronic
1121449759 14:93999644-93999666 GTCCTTGAGAAAATCCCCGAGGG + Intergenic
1122743106 14:103883032-103883054 GTCTCTGAGACAAGCTCCCTGGG - Intergenic
1123878483 15:24650376-24650398 GAATCTCAGAGAATCACCCAGGG - Intergenic
1124892518 15:33746205-33746227 TCCTCTGATAAAATCACTCAAGG - Intronic
1126095653 15:45088044-45088066 GACTCAGAGTACATCACCCACGG - Intergenic
1126727823 15:51650922-51650944 TTCACTGAGAAAATGACCTACGG + Intergenic
1126886883 15:53160203-53160225 GTTTCTTAGAAAATCAGCCTGGG + Intergenic
1127319082 15:57825396-57825418 TTCTCTGATAAAGTCACTCATGG + Intergenic
1128695181 15:69756447-69756469 GTCTCTGAGAAAGTCACTCAAGG + Intergenic
1129608464 15:77036131-77036153 AGCTCTGAGAACAGCACCCAGGG + Intronic
1130032103 15:80325328-80325350 GACTGTGAGAAAATAACCCTTGG + Intergenic
1130398726 15:83529533-83529555 GTGCCTGAGTACATCACCCAGGG - Intronic
1131057261 15:89382915-89382937 GTATCTAAGAAAAGCACACAAGG - Intergenic
1131838431 15:96412827-96412849 GGGTCTGAGAAAAGCAACCAGGG - Intergenic
1131875295 15:96799249-96799271 ATCCCAGATAAAATCACCCATGG - Intergenic
1132674650 16:1116707-1116729 GACGCAGAGAAAATCAGCCACGG + Intergenic
1133394730 16:5437405-5437427 GACTCTGAGAAATTCTCACAAGG + Intergenic
1133737241 16:8625518-8625540 GTCTCTGAGATCTTCTCCCAGGG + Exonic
1135938850 16:26803571-26803593 GTGCCTGTAAAAATCACCCATGG - Intergenic
1137604974 16:49781199-49781221 GCCCCTGAGAAAATCTCCAAAGG + Intronic
1137792964 16:51190394-51190416 GTCCCTGGGACAATTACCCAGGG + Intergenic
1138054724 16:53820800-53820822 TTCTATAAGAAAATGACCCAGGG + Intronic
1143342145 17:6219938-6219960 TCCTCTGACAAAATCAGCCAAGG + Intergenic
1143532232 17:7512212-7512234 GTCTCTGAGAATATCATGCTGGG + Exonic
1143985234 17:10907417-10907439 GTCTGTGAGAAAACCTCACATGG - Intergenic
1152818890 17:82425575-82425597 GTCTCTGTGAAAATCAATAACGG + Intronic
1153130145 18:1846515-1846537 CTCTCTGAGAAATGCAGCCACGG - Intergenic
1153767853 18:8391439-8391461 GTCTGTGTGAGAATCACCCACGG - Intronic
1155104933 18:22654451-22654473 GCCTATGAGGAAATCACTCAAGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160229065 18:77032727-77032749 GTCACTGTGAAATTCACCAAAGG - Intronic
1160433508 18:78828966-78828988 GGCTCTCAGAAAACCACACAAGG - Intergenic
1161572241 19:5036841-5036863 GGCTCTGGGAAAATCCCGCAGGG - Intronic
1162699384 19:12502217-12502239 GTCTCTGAGAAAAGCAGGCCAGG - Intronic
1164878739 19:31712993-31713015 GTCTCTGAAAATATCACTTAAGG - Intergenic
1166994363 19:46712884-46712906 GTGTCTTAGAAAATCACCTGGGG + Intronic
1168532183 19:57138555-57138577 GTCACTGTGAACTTCACCCAGGG - Exonic
925751437 2:7093529-7093551 GGCTCTGGGAGCATCACCCAAGG + Intergenic
926799596 2:16648169-16648191 ATCTCAGAGAAACTCAGCCAGGG + Intronic
928404132 2:31001420-31001442 GTCACTGAGAAAATAAACCGTGG + Intronic
929364201 2:41132393-41132415 GTATCTGATTAAATCAACCAAGG - Intergenic
932568242 2:72923009-72923031 GGCCCTGACAAAATCACCCATGG - Intronic
933255756 2:80078959-80078981 ATCAATGAGGAAATCACCCATGG - Intronic
934157770 2:89219132-89219154 GTGTCTGAGAAGAGCCCCCAGGG - Intergenic
934209494 2:89963294-89963316 GTGTCTGAGAAGAGCCCCCAGGG + Intergenic
935454886 2:103256031-103256053 AGCTCTCAGAAATTCACCCAAGG - Intergenic
935495964 2:103782315-103782337 CTCTCTGATAAGATGACCCATGG + Intergenic
936913307 2:117614759-117614781 GTCTCAGAGACAAGAACCCATGG + Intergenic
937369242 2:121286166-121286188 ATCTCTGTGAACATCACCTAGGG + Intergenic
939987760 2:148848759-148848781 GTCTCTGAAAAAATAACTGATGG - Intergenic
944924949 2:204455052-204455074 GTCTCTGAAGAACTCAACCAGGG + Intergenic
947450091 2:230199720-230199742 CTCTCTGGGAAAATCTCCCAGGG - Intronic
1169803464 20:9535153-9535175 GTCTCTCAGAAGGTCACCAATGG + Intergenic
1169910516 20:10644263-10644285 GTGTGTGTGAGAATCACCCAGGG - Intronic
1170524406 20:17224050-17224072 GTTTTTTAAAAAATCACCCAAGG + Intergenic
1170726097 20:18928136-18928158 TTCTTGGAGTAAATCACCCAAGG - Intergenic
1171234040 20:23510034-23510056 CTCTCTGAGAAAGACAACCACGG + Intergenic
1171277517 20:23870568-23870590 GACTCTGTGAACACCACCCACGG - Intergenic
1173445443 20:43113587-43113609 GTCTTTGAAAAAATCTCCAATGG + Intronic
1176305895 21:5122979-5123001 CCCTCTGAGACAGTCACCCATGG - Intronic
1177835205 21:26179907-26179929 GTTTGTGAAAAAATCACACAAGG + Intergenic
1178233334 21:30812820-30812842 GTCCCAGAGAACATCAGCCAGGG + Exonic
1179572899 21:42288350-42288372 GAGTCTGAGAAAATGACCCACGG - Intronic
1179851162 21:44139052-44139074 CCCTCTGAGACAGTCACCCATGG + Intronic
1181545416 22:23599565-23599587 GTCTCTGAGATGATCCCTCAGGG + Intergenic
1182718386 22:32377961-32377983 GTCTCTGAGAAAATCACCCATGG - Intronic
949120332 3:376257-376279 GTCACACAGAAAATCACACACGG - Intronic
953583293 3:44176574-44176596 CTCTCTGAGAAATTCAGCAATGG - Intergenic
954804024 3:53204931-53204953 GCATCTGAGGAAACCACCCAAGG + Intergenic
955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG + Intronic
958657371 3:97019334-97019356 ATGTGTGAGAAAATTACCCAAGG - Intronic
964573444 3:158137961-158137983 GTCTATGAAAAAATCATCTAGGG - Intronic
965401244 3:168215335-168215357 CTCTCATAGAAAATAACCCAGGG + Intergenic
967632007 3:191755451-191755473 GTCGCTGAGAAAATAAGCCTCGG - Intergenic
974407758 4:61497412-61497434 GTCTCAGAGAAAAGATCCCAAGG - Intronic
975896083 4:79092703-79092725 ATCTCTCAGAAAATCAACCCAGG + Intergenic
978011650 4:103692854-103692876 TTCTATGAGTAAATCACCAATGG + Intronic
981268670 4:142818373-142818395 GCCTCTGAGAGAAAAACCCATGG - Intronic
981699030 4:147587894-147587916 GTTTTTGAGAAAATCAAGCAAGG - Intergenic
982250220 4:153398606-153398628 CTCTCTTTGAAAATCACCCTGGG - Intronic
985617213 5:930395-930417 CTCTATGAGAACATCAGCCAAGG - Intergenic
986247637 5:6025273-6025295 GTGGCTGAGAAAACTACCCAAGG + Intergenic
989039603 5:37213834-37213856 TTTTCTGAGATAAGCACCCATGG + Intronic
989380895 5:40808485-40808507 GTTTCTTAGAACATCCCCCAGGG - Intergenic
989769338 5:45124780-45124802 TTTTCTGAGAAAAGCACCAAAGG + Intergenic
990631912 5:57679702-57679724 GTCTCTGAGCAGAGGACCCAGGG + Intergenic
991949930 5:71937839-71937861 TTCTCTGATAAAAGGACCCAAGG - Intergenic
993188017 5:84645458-84645480 GTATGTCAGAAAATCACCCCAGG - Intergenic
997966427 5:138360463-138360485 GTGTCTGAAAAACTCAACCATGG - Intronic
998135121 5:139670375-139670397 GCCTCTGAGAAACCAACCCAGGG - Intronic
998781614 5:145663142-145663164 CTCTTTGAGAAAATGATCCATGG - Intronic
999746434 5:154595895-154595917 GTCTCCGTATAAATCACCCAGGG + Intergenic
1001072272 5:168597252-168597274 GAGGCTGAGAAAACCACCCAGGG - Intergenic
1001434301 5:171687282-171687304 GTCCCTGAGATAGTCTCCCACGG - Intergenic
1001680410 5:173552963-173552985 GTCTCTGACAGAAGCACACAGGG + Intergenic
1003009667 6:2414758-2414780 GTCCCTGAGACAAGCACCCTCGG + Intergenic
1003735778 6:8876350-8876372 GTCTCTGAATAATCCACCCAAGG + Intergenic
1003765946 6:9236661-9236683 GTCTCTGTGACACTCACCCTAGG + Intergenic
1003893976 6:10589601-10589623 TTCTCTGAGAACATGAACCAAGG - Intronic
1003989542 6:11472098-11472120 GTCTCTGATACATTCACCCAGGG - Intergenic
1004246130 6:13977732-13977754 GTGTCTAAGAAAGTCACCCTTGG + Exonic
1006287929 6:33112363-33112385 GACTCTGAGAAAAGAACCAATGG - Intergenic
1007261643 6:40568211-40568233 CTCTCTGGGAAAATAACCCCAGG + Intronic
1008766397 6:54921425-54921447 GTCTCCGAGAACCTGACCCAAGG - Intronic
1011805279 6:91065181-91065203 GTGTGTGAGAAAACTACCCAAGG - Intergenic
1012289503 6:97435252-97435274 ATCTCTGAGAAAATGCCCAATGG - Intergenic
1013373647 6:109492569-109492591 GGCTCAGAGAAATTTACCCAAGG + Intergenic
1014622782 6:123690196-123690218 GTCACTGAGAAAATCGCCCAAGG - Intergenic
1015733928 6:136377425-136377447 GTCTCTGAGCAGATAATCCAAGG - Intronic
1016203894 6:141449787-141449809 TTCACTGAGAAAGTCAACCATGG + Intergenic
1017210507 6:151850614-151850636 GTCACTGAGAAAATCAGGCTGGG - Intronic
1018504954 6:164456134-164456156 GCCTCTGACACCATCACCCATGG + Intergenic
1021746374 7:23745235-23745257 GTGTCTGAGCACACCACCCAAGG - Intronic
1022034985 7:26525780-26525802 GTCTCTGCAAACATAACCCAGGG + Intergenic
1023522202 7:41059912-41059934 GTATCTGAGAAAAGCACCTATGG + Intergenic
1024039757 7:45542954-45542976 GTCTCAGAGAAAAGTCCCCATGG + Intergenic
1026912051 7:74096728-74096750 TGCTCTGAGCAAATCACCAAGGG + Exonic
1028062337 7:86338557-86338579 GTGTGTGAGAAAATTACCCAAGG - Intergenic
1030145472 7:106349666-106349688 GTATCTGAGCAAATTAGCCAAGG + Intergenic
1030708690 7:112723371-112723393 TTCTCTGGGATAAACACCCAAGG - Intergenic
1031458194 7:122010841-122010863 ATCTCTGAGAACATATCCCAAGG + Exonic
1032502092 7:132407321-132407343 CTCTCTGTGAAAATCACCAGAGG - Intronic
1032855010 7:135826699-135826721 GTCCCTAGGAAAATCACCTAGGG + Intergenic
1034176310 7:149102613-149102635 GTCTCTGAGGAAAATACCAAAGG - Intergenic
1034885590 7:154795973-154795995 TTCTCAGAGTAAATCACACAGGG + Intronic
1035151913 7:156881380-156881402 CTCTCAGAGAAAAACACCGAAGG + Intronic
1036111967 8:5913100-5913122 GTCCCTGATAATAACACCCATGG + Intergenic
1036237035 8:7047918-7047940 GTCACTGATAAAATGACACAAGG - Intergenic
1038938197 8:32275708-32275730 GTGTCTGCGCAAATCCCCCAGGG + Intronic
1039976253 8:42367885-42367907 ATTTCACAGAAAATCACCCAAGG - Intronic
1041111755 8:54489460-54489482 GACTCTGGGTAAATCACCCTGGG + Intergenic
1045760250 8:105597453-105597475 GTTCATGAGAAAATCACACAGGG - Intronic
1047284285 8:123473181-123473203 GTGTCTGGGAAAATCTTCCAAGG + Intergenic
1051356018 9:16240255-16240277 GGCCCTGAGAAACTCACCCAGGG + Intronic
1052705192 9:31986707-31986729 GTCTTTGAGATATTCACCAAGGG + Intergenic
1054707139 9:68474066-68474088 CTGCCTGTGAAAATCACCCAAGG + Intronic
1060213573 9:121725000-121725022 GTCTCTGAGGAGAGCACCCCCGG + Intronic
1187170376 X:16845859-16845881 GACACTGAGCAAATGACCCAAGG + Exonic
1188608825 X:32070338-32070360 GCCTCTGTGGAAACCACCCATGG + Intronic
1188779803 X:34267950-34267972 GTCTGTGACTAAATAACCCAAGG + Intergenic
1190104769 X:47551775-47551797 TACTTTGAGAAAAGCACCCAAGG + Intergenic
1195798968 X:108685381-108685403 GTCTAAGAGAAATTCAACCATGG - Intronic
1202250149 Y:22862292-22862314 ATCTCTGAGAAAATTATACAAGG + Intergenic
1202403138 Y:24496040-24496062 ATCTCTGAGAAAATTATACAAGG + Intergenic
1202467643 Y:25174041-25174063 ATCTCTGAGAAAATTATACAAGG - Intergenic