ID: 1182718544

View in Genome Browser
Species Human (GRCh38)
Location 22:32378786-32378808
Sequence GGGCCACAGAACCCCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182718537_1182718544 10 Left 1182718537 22:32378753-32378775 CCAGGGTTAGTGGAAAGTTTCAA 0: 1
1: 0
2: 1
3: 9
4: 105
Right 1182718544 22:32378786-32378808 GGGCCACAGAACCCCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182718544 Original CRISPR GGGCCACAGAACCCCAGTGC AGG Intronic
No off target data available for this crispr