ID: 1182719719

View in Genome Browser
Species Human (GRCh38)
Location 22:32387292-32387314
Sequence GTGAACAAAATGGAGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182719719_1182719731 26 Left 1182719719 22:32387292-32387314 CCACCTACCTCCATTTTGTTCAC No data
Right 1182719731 22:32387341-32387363 CCGTGTATTTAGAATAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182719719 Original CRISPR GTGAACAAAATGGAGGTAGG TGG (reversed) Intergenic
No off target data available for this crispr