ID: 1182722040

View in Genome Browser
Species Human (GRCh38)
Location 22:32410988-32411010
Sequence AGGGAGAGCGCAGTGGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182722040_1182722044 6 Left 1182722040 22:32410988-32411010 CCATGAACCACTGCGCTCTCCCT 0: 1
1: 0
2: 1
3: 32
4: 307
Right 1182722044 22:32411017-32411039 GATTTTCTATTCCTTCCTTCAGG 0: 1
1: 1
2: 4
3: 32
4: 386
1182722040_1182722045 7 Left 1182722040 22:32410988-32411010 CCATGAACCACTGCGCTCTCCCT 0: 1
1: 0
2: 1
3: 32
4: 307
Right 1182722045 22:32411018-32411040 ATTTTCTATTCCTTCCTTCAGGG No data
1182722040_1182722046 13 Left 1182722040 22:32410988-32411010 CCATGAACCACTGCGCTCTCCCT 0: 1
1: 0
2: 1
3: 32
4: 307
Right 1182722046 22:32411024-32411046 TATTCCTTCCTTCAGGGTAACGG 0: 1
1: 0
2: 6
3: 94
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182722040 Original CRISPR AGGGAGAGCGCAGTGGTTCA TGG (reversed) Intronic
901772427 1:11537170-11537192 AGGAAGAGCACAGTGGATCCAGG + Exonic
902867382 1:19288417-19288439 AGGGAGAGCGGGGCGGTACACGG + Intronic
903202497 1:21753860-21753882 AGGGCTGGCGCAGTGGCTCAAGG + Intronic
904128815 1:28260498-28260520 AGGGAGAGCGCAGGGGCTCTGGG + Intronic
904410562 1:30322389-30322411 AGGGTGGGAGCAGTGGTTCTTGG - Intergenic
904419869 1:30384719-30384741 GGGGAGAGCCCTGTGGTTCCTGG + Intergenic
904671573 1:32170001-32170023 AGGGCAAGCGCAGTGGCTCAGGG + Exonic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
905394775 1:37660166-37660188 AGAGAGAGCTCAGTGGTGCCTGG - Intergenic
905595621 1:39204256-39204278 TGGCTGGGCGCAGTGGTTCATGG - Intronic
906124435 1:43418791-43418813 TTGGAGAGAGCAGAGGTTCAAGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908148132 1:61268946-61268968 AGGGAGGGAGCACGGGTTCAGGG - Intronic
909212758 1:72845359-72845381 AGGGAGACAGCAGAGGTGCAAGG + Intergenic
909347622 1:74610632-74610654 AGGAAGAATGTAGTGGTTCAAGG - Intronic
910844256 1:91590232-91590254 TGGGTGGGCGCGGTGGTTCACGG - Intergenic
911859106 1:102923926-102923948 AGGCCGGGCGCAGTGGCTCACGG + Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912899303 1:113630726-113630748 AGGGGGAGCACAGTGGCTGATGG - Intronic
914990528 1:152496129-152496151 AGGCAGGGCGCCGTGGCTCACGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916586210 1:166152588-166152610 AGGGAGAGGGCACAGGTTAAAGG - Intronic
916676262 1:167066499-167066521 AGGGTGAGAGCAGGGGTTCCTGG - Intronic
916690464 1:167185402-167185424 AGGCTGGGCGCAGTGGCTCATGG + Intergenic
917590890 1:176475768-176475790 TGGGAGAGGGAAGTGGTTTAGGG + Intronic
918472061 1:184884981-184885003 AGGCAGACCGCAGTGGGACAGGG - Intronic
920855138 1:209655845-209655867 AAGGAGAGAGAAGAGGTTCAGGG + Intergenic
920919635 1:210287843-210287865 AGCTTGAGCACAGTGGTTCAAGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922482116 1:225946325-225946347 AGGGAGACAGGAGTGGTCCAGGG - Intergenic
922876063 1:228940718-228940740 AGGGAGGGCGCTGAGGCTCAGGG - Intergenic
923104351 1:230843096-230843118 GGGGAAAGCGCAGTGGGCCACGG + Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063193503 10:3719092-3719114 AGGGAGAGCCCTGTGGGGCAGGG + Intergenic
1064219967 10:13431916-13431938 ATGGAGAGGGCAGGGGGTCAGGG + Intergenic
1066263599 10:33753187-33753209 AGGGCATGTGCAGTGGTTCATGG - Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1068978549 10:63036612-63036634 AGGCAGGGTTCAGTGGTTCATGG + Intergenic
1069639003 10:69943126-69943148 AGGCTGGGCGCAGTGGCTCACGG - Intronic
1069915579 10:71784772-71784794 AGGGAGGGTGCAGTTGGTCATGG - Intronic
1070693275 10:78543276-78543298 AGGGAGAGGGTTCTGGTTCATGG - Intergenic
1073766075 10:106684396-106684418 AGGGAAAGCACAGTGTTTAATGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076124605 10:127963852-127963874 AGGGAGTCCGCAGTGGGCCAAGG + Intronic
1076633528 10:131867732-131867754 AGGGAGAGCGGAGTGGTTTGTGG + Intergenic
1077031428 11:469628-469650 AGTGTGTGCGCAGTGGTTAATGG + Intronic
1077067011 11:645970-645992 AGGCCGGGCGCAGTGGTTCACGG + Intronic
1077645866 11:3923326-3923348 GGGCCGAGCGCAGTGGCTCATGG + Intronic
1080987093 11:37481972-37481994 AGGCCGAGCGCGGTGGTTCACGG + Intergenic
1081259637 11:40943866-40943888 AGGGAGAGCTAAATGGGTCAGGG - Intronic
1081446921 11:43139694-43139716 AGGAAAACCGCAGTGGTTTAAGG - Intergenic
1081569134 11:44278756-44278778 AGGGAGAGCGGGGTAGTTGAGGG + Intronic
1083786311 11:64950047-64950069 AGGCTGGGCGCAGTGGCTCATGG + Intronic
1084213147 11:67633111-67633133 AGGGACAGAGCAGGGGTACAGGG + Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086663982 11:89457131-89457153 AGGGAGACTGTAGTGGGTCAAGG - Intronic
1088773431 11:113058500-113058522 AGGGAGAAGTCAGTGCTTCATGG - Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089769493 11:120793203-120793225 AGGCAGAGTGCAGTGGGTCGAGG + Intronic
1090381476 11:126330628-126330650 CAGCAGAGCGCAGTGGTTCCAGG - Intronic
1090779407 11:129993988-129994010 ATGAAGAGCACAGTGGCTCAAGG - Intronic
1091266032 11:134271752-134271774 GGGGAGAGCGCAGGTGATCAAGG + Intergenic
1091422239 12:351821-351843 TGGCTGGGCGCAGTGGTTCATGG + Intronic
1091893628 12:4083035-4083057 GGGGAGTGTGCAGTGGTTCATGG - Intergenic
1092194531 12:6541346-6541368 AGGGAGAGAGCTGTGGGTCTGGG + Intronic
1092916696 12:13195942-13195964 AGAGAGAGAGGAGTGGTGCAGGG + Intergenic
1093168840 12:15836456-15836478 AGGCCGGGCACAGTGGTTCATGG - Intronic
1094698991 12:32850264-32850286 AGGCTGGGCGCAGTGGCTCATGG + Intronic
1096355964 12:50941266-50941288 AGGCTGAGTGCAGTGGCTCATGG - Intergenic
1096369477 12:51057046-51057068 AGGCCGGGCACAGTGGTTCACGG - Intronic
1098068493 12:66646341-66646363 AGGGCGAGAGCGGTGGCTCACGG + Intronic
1098253281 12:68590644-68590666 ATGAAGAGCACAGTGGTACAAGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1103302721 12:119940365-119940387 CGGCCGAGCGCAGTGGCTCACGG - Intergenic
1103522455 12:121545611-121545633 AGGGAGAGCGGAGGGGCTGAGGG - Intronic
1104435062 12:128749048-128749070 TGGGAGGGCGGAGGGGTTCAGGG - Intergenic
1104623990 12:130338125-130338147 AGGGCGAGGGCAGCGGTCCAAGG + Exonic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110103675 13:71642738-71642760 AGGCCGGGCGCAGTGGCTCATGG + Intronic
1112368750 13:98776458-98776480 AGGCAGGGCGCGGTGGCTCAAGG + Intergenic
1112740521 13:102467847-102467869 AGGAAGAGAGCAGAGGTTGATGG + Intergenic
1113800174 13:113082400-113082422 AGGGAGAGCGCAGAGGTCGGCGG - Intronic
1113948794 13:114059797-114059819 AGAGAGAGCGCTGTGGTTTCTGG - Intronic
1114332256 14:21649153-21649175 CGGCCGGGCGCAGTGGTTCATGG - Intergenic
1115097652 14:29657584-29657606 AGGCCGGGCGCAGTGGCTCACGG + Intronic
1117213722 14:53528174-53528196 AGGCAGAGGGCAGGGGATCAGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117557959 14:56906099-56906121 AGGGACAGAGCAGTGGCTTAAGG + Intergenic
1117746946 14:58879142-58879164 AGGGAGAGTTCAGTGGTCCCTGG + Intergenic
1118749776 14:68797024-68797046 GGGGAGAGTAAAGTGGTTCAGGG + Intergenic
1119948797 14:78723096-78723118 TGGGAGAGCAAAGTGTTTCATGG - Intronic
1121090713 14:91180168-91180190 AGGCAGGGCGCAGTGGCTCACGG - Intronic
1121556058 14:94838400-94838422 AGGCTGGGCGCAGTGGCTCATGG - Intergenic
1121643899 14:95504698-95504720 AGGCCGGGCACAGTGGTTCATGG + Intergenic
1123910450 15:24960579-24960601 AGGCAGGGCGCAATGGTTCATGG - Intronic
1127416995 15:58767935-58767957 AGGCCGGGCGCAGTGGCTCACGG - Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1128757289 15:70191607-70191629 AGCAGGAGCGCAGTGGTTCAGGG + Intergenic
1129184512 15:73897761-73897783 AGGGAGAACTCTGTTGTTCATGG + Intergenic
1130761769 15:86828221-86828243 AGGCTGAGCACAGTGGCTCATGG - Intronic
1134271876 16:12740164-12740186 AGGCCGGGCGCAGTGGCTCATGG + Intronic
1135137382 16:19895136-19895158 AGGGATGGCGCAGTGAGTCAGGG + Intergenic
1139938761 16:70590152-70590174 CGGGAGAGGGCTGGGGTTCAGGG + Intronic
1140887473 16:79257524-79257546 TGGGTGAGGGCAGTGGGTCATGG + Intergenic
1141117179 16:81319033-81319055 AGGCTGGGCGCAGTGGCTCATGG + Intronic
1141651539 16:85395673-85395695 AGGGAGGGAGCATTTGTTCAGGG - Intergenic
1141729151 16:85810210-85810232 TGGGAGGCCGCAGGGGTTCATGG + Intergenic
1142405981 16:89890148-89890170 AGGCCGGGCGCAGTGGCTCAGGG - Intronic
1145104810 17:20106117-20106139 AGGGAAATCACAGTGGTTAAGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1147657522 17:42099084-42099106 AGGGAGGGGGCAGGGGCTCAGGG - Intergenic
1149326525 17:55535832-55535854 AGGCTGGGCGCAGTGGCTCATGG - Intergenic
1151717025 17:75836162-75836184 AGGGGGAGGGCAGGGGGTCACGG - Intronic
1151729067 17:75900280-75900302 AAGGAGCGCCCAGTGGTTCAAGG + Intronic
1151961518 17:77408292-77408314 AGGGAGTCCACAGTGGTTCTGGG + Intronic
1152393496 17:80017055-80017077 AGGGAGAGCTGAGTGGATGAGGG - Intronic
1154211463 18:12382607-12382629 AGGCAGGGCGCAGTGGCTCACGG + Intergenic
1154411732 18:14145469-14145491 AGGGAGGGCCCAGTGGTGCTTGG - Intergenic
1155439904 18:25851499-25851521 GGGGAGAACGCTGAGGTTCATGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157353526 18:46912963-46912985 AGGCTGGGCGCAGTGGCTCAAGG - Intronic
1157594896 18:48858534-48858556 AGGAAGGGCTCAGGGGTTCAAGG + Intronic
1158841552 18:61393496-61393518 AAGAAGACTGCAGTGGTTCAAGG + Intronic
1159041150 18:63323889-63323911 AGGCCGAGCGCAGTGGCTCACGG + Intergenic
1160044417 18:75373357-75373379 CGGGAGTGTGCAGTGGATCAGGG - Intergenic
1160517771 18:79487985-79488007 AGGGAGTGGGCAGTGGCTCCAGG - Intronic
1160693128 19:469266-469288 CTGGAGAGTGCAGTGGCTCATGG + Intronic
1161028751 19:2048448-2048470 AGTGAGAGCTCAGTGGTACAAGG - Intronic
1161437366 19:4271816-4271838 AGGCTGGGCGCAGTGGCTCATGG + Intergenic
1161497392 19:4594527-4594549 AGGCTGAGTGCAGTGGCTCACGG + Intergenic
1162969782 19:14173664-14173686 AGGCTGGGCGCAGTGGCTCATGG + Intronic
1163709369 19:18837030-18837052 AGGCTGGGCGCAGTGGCTCACGG - Intronic
1163774336 19:19209029-19209051 AGGGTGGGCGCGGTGGCTCAAGG - Intergenic
1164769345 19:30796073-30796095 AGGCTGAGCGCAGGGGCTCATGG + Intergenic
1166366128 19:42279401-42279423 AGGGACAACTCAGTGGTTCATGG + Intronic
1166390641 19:42407175-42407197 AAGGAGGGCGCAGTGCTTGATGG + Exonic
1167136368 19:47618611-47618633 AGGGAGAGTGCAGAGGGACAGGG - Intronic
1168544337 19:57238112-57238134 AGGCCGAGTGCAGTGGCTCACGG - Intergenic
926442239 2:12902069-12902091 CGGGAGAGCCCAGGAGTTCAAGG - Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927469501 2:23362454-23362476 GGGGAGAGAGCAGTGGTGCCAGG + Intergenic
928642952 2:33319619-33319641 TGGGAGAGCGCAGTTGTTCCTGG - Intronic
929077287 2:38088402-38088424 AGGCTGGGCGCAGTGGCTCATGG - Intronic
929493185 2:42415912-42415934 AGGCCGGGCGCAGTGGCTCATGG + Intronic
930056790 2:47258360-47258382 AGGGAGAGCACAATGTTTCAGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
931461961 2:62457269-62457291 AGCGAGAGCGCAGCGGGCCAGGG - Intergenic
931489471 2:62727879-62727901 AGGGAGACAGCAGAGGTGCAAGG + Intronic
931643992 2:64405109-64405131 AGGGAGAGAGTAGCCGTTCAGGG - Intergenic
935269371 2:101420259-101420281 AGGCTGGGCGCGGTGGTTCACGG + Intronic
935308055 2:101757011-101757033 ATGCAGAGCACAGTGGTACAGGG + Intronic
935690949 2:105732125-105732147 TGGGAGAGTGCACTGGTTCTGGG + Intergenic
935693390 2:105749882-105749904 AGGCCGGGCGCAGTGGCTCACGG + Intronic
938809865 2:134843213-134843235 AGGGTGAGAGCAGGGGTTGAGGG + Intronic
940278187 2:151961608-151961630 AGGCTGAGCGCAGTGGCTTATGG + Intronic
940285163 2:152026658-152026680 AGGCCGAGTGCAGTGGCTCATGG - Intronic
941722811 2:168829825-168829847 AGGGAAGGGGCAGTGGTTAAGGG + Intronic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
943082775 2:183276438-183276460 GGAGAGTGAGCAGTGGTTCATGG + Intergenic
943533127 2:189112135-189112157 AGGCCGGGCACAGTGGTTCACGG - Intronic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944736616 2:202572518-202572540 AGGCCGGGCGCAGTGGCTCACGG - Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946059319 2:216928085-216928107 AAGGAGAGTGGAGTGGTTAAGGG - Intergenic
946265553 2:218538288-218538310 ATGGAGAGAGAAGTGGGTCATGG + Intronic
946421060 2:219565118-219565140 AGGGAGAGTCCAGTGGCCCAGGG - Intronic
946709757 2:222493614-222493636 AGGCTGAGTGCAGTGGCTCATGG - Intronic
946907819 2:224433025-224433047 AGGTCGGGCGGAGTGGTTCACGG - Intergenic
947244087 2:228027685-228027707 AGGGCGGGCGCAGTGGCTTATGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948906933 2:240984057-240984079 AGGAAGAGCTCAGTGGTCAAGGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169463263 20:5815164-5815186 AGGCTGAGCACAGTGGTTCAAGG - Intronic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170523498 20:17212978-17213000 AGGCTGAGCGTAGTGGCTCATGG - Intergenic
1172205603 20:33160847-33160869 AGGGAGAGGCCAGCGGTCCATGG + Intergenic
1172303108 20:33863469-33863491 AAGTAGAGGGCAGTGGTTTAGGG - Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1175469799 20:59219401-59219423 AGGGAGAGCCCAGTGTGGCAAGG + Intronic
1177846695 21:26297250-26297272 AGGGAGAGAGGAGTGGGGCAAGG + Intergenic
1179644649 21:42767926-42767948 AGGCACAGGGCAGTGCTTCAGGG + Intronic
1180945116 22:19688480-19688502 AGGGAGAGGGCAGTGGGCCTGGG - Intergenic
1181008775 22:20028077-20028099 AGGTAGGGTGCAGTGGCTCATGG - Intronic
1182614154 22:31575124-31575146 TGGCAGAGAGCAGGGGTTCAAGG - Intronic
1182722040 22:32410988-32411010 AGGGAGAGCGCAGTGGTTCATGG - Intronic
1183253408 22:36745691-36745713 AGGGAGAGCCACGTGGGTCAGGG - Intergenic
1184320316 22:43736934-43736956 GGGGAGGGCCCAGTGGGTCAAGG - Intronic
1184529587 22:45046429-45046451 AGGCTGGGCGCAGTGGCTCATGG + Intergenic
949567924 3:5262293-5262315 AGGCAGAGCCCAGGCGTTCAAGG - Intergenic
952032137 3:29156112-29156134 AGGGGGAGGGCAATGTTTCATGG - Intergenic
954604236 3:51896299-51896321 GGGGAGAGGGCAGTGTTTCCAGG - Intronic
956640682 3:71412696-71412718 AGGGTGAGCCCAGTGTTTCTTGG - Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
958494824 3:94830943-94830965 GGGGAGAGCACAGTAGTTAAGGG + Intergenic
959960576 3:112293752-112293774 GGGGAAAGCTCACTGGTTCAGGG - Intronic
960150038 3:114239956-114239978 AAGGGGAGGGCAGTGGATCAGGG - Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962542046 3:136392484-136392506 AGGCTGGGCGCAGTGGCTCATGG + Intronic
962586056 3:136843650-136843672 AGGCTGGGCGCAGTGGCTCAAGG + Intronic
962823214 3:139073235-139073257 AATGAGAAGGCAGTGGTTCATGG + Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
967497613 3:190159395-190159417 AGGGAAAGAGCAATAGTTCAAGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968361215 3:198148167-198148189 AGGGAGGGCGCAGGGGTCCCAGG + Intergenic
968709061 4:2099396-2099418 AGGAAGAGCACAGAGGTGCAGGG - Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
977202557 4:94133536-94133558 AGGCAGGGCGCAGTGGCTCATGG - Intergenic
978609106 4:110517218-110517240 GGGCAGGGCACAGTGGTTCATGG - Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979675328 4:123403068-123403090 AAGGAGAGGGCAGTGGTTAAAGG - Exonic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
982158229 4:152541249-152541271 TGGGTGATCGCAGTGATTCAGGG + Intergenic
982341539 4:154304331-154304353 ATGTGGAGAGCAGTGGTTCAAGG + Intronic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983055907 4:163098674-163098696 AGGGAGAGAGAGGTGGTACATGG + Intergenic
983118914 4:163855999-163856021 AGAAAGATCCCAGTGGTTCATGG - Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984100980 4:175485407-175485429 AGGCCGGGCGCAGTGGCTCACGG + Intergenic
984825952 4:183924653-183924675 AGGGAGATCGCCCTGGCTCAGGG + Intronic
984937492 4:184901787-184901809 TGGGACAGAGCAGTGGTTTAGGG + Intergenic
984986934 4:185340480-185340502 AGGCAGAGAGCAGTGGATCAGGG + Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986271580 5:6235766-6235788 AGGGAGAGCTCAGTAGCCCAGGG + Intergenic
986543687 5:8872954-8872976 AGGGAAAGGGCAATGGCTCAGGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987772732 5:22327751-22327773 AGAGAGAGGGAAGTGGTCCAGGG - Intronic
988183611 5:27831304-27831326 AGGGAGCGGGCAATGGGTCAAGG + Intergenic
989249477 5:39293013-39293035 AGGGAGAGTGCTGGAGTTCAGGG + Intronic
989839322 5:46041759-46041781 TGGGAGAGCGCTGAGGTCCATGG + Intergenic
991933996 5:71783907-71783929 AGGCAGTGCTCAGTGGTTCCAGG + Intergenic
991980723 5:72227779-72227801 AGGAAAAGTGGAGTGGTTCATGG - Intronic
992972731 5:82079340-82079362 AGAGAGAGAGCACTTGTTCAGGG + Intronic
995110399 5:108422276-108422298 AGGGTGGGCACAGTGGCTCATGG - Intergenic
995884371 5:116877476-116877498 AGGCCGGGCGCAGTGGCTCATGG + Intergenic
1002619898 5:180480661-180480683 AGGCCGAGCGCAGTGGCTCACGG + Intergenic
1003583893 6:7368302-7368324 AGGGTGAGGGCAGAGGTTCTTGG - Intronic
1003883281 6:10497695-10497717 AGGCCGGGCACAGTGGTTCACGG + Intronic
1005871195 6:29975345-29975367 AGGGAGAGGACAGGGCTTCAGGG + Intergenic
1007050405 6:38822488-38822510 AGGAATAGCGCAGTGGTTCAAGG - Intronic
1007394810 6:41571340-41571362 AGTTTGAGAGCAGTGGTTCAGGG + Intronic
1007719757 6:43878110-43878132 AGGGAGAGAAAAGTGGGTCATGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009885879 6:69623242-69623264 AGGGAGACAGCAGAGGTACAAGG - Intergenic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010212591 6:73373867-73373889 TGGCAAAGCGCAGTGGCTCAAGG - Intronic
1012410378 6:98948840-98948862 AGGGCGGGCGCGGTGGCTCACGG - Intergenic
1015907173 6:138129277-138129299 AGGGAGAGCGCAGTAGTTTTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018986053 6:168638020-168638042 AGGGAGTGCGCAGATGTGCAGGG - Intronic
1019381342 7:725953-725975 AGGGAGAGGGCAGTGCTTATTGG - Intronic
1019506477 7:1393918-1393940 AGGCAGAGGGCAGGGGTGCAGGG + Intergenic
1019993409 7:4707961-4707983 AGGCTGAGCGCAGTGGCTCATGG - Intronic
1021096767 7:16543844-16543866 AGGCAGAGCCCAGAGATTCATGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022224676 7:28350712-28350734 AGGGAGAGCCCTGAGCTTCAAGG + Intronic
1022300118 7:29095103-29095125 ATGGAGAGCGTTGTGGTCCAGGG + Exonic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022974743 7:35546836-35546858 AGGGAGAGTGCAGAGGGGCAGGG - Intergenic
1023059732 7:36315863-36315885 AAGGAGACGGCAGAGGTTCAGGG + Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1025173787 7:56785738-56785760 AGGCCGTGCTCAGTGGTTCACGG + Intergenic
1025698313 7:63792429-63792451 AGGCCGGGCTCAGTGGTTCACGG - Intergenic
1026907519 7:74071076-74071098 GGGGTGAGCGGCGTGGTTCAAGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028242488 7:88438160-88438182 AAGGAGTGGGCAGTGGTTGAGGG - Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030045493 7:105491774-105491796 AGGCTGGGCGCAGTGGCTCATGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1032309815 7:130774547-130774569 TGGCTGAGCACAGTGGTTCACGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034019783 7:147629119-147629141 AGGCCGACCGCTGTGGTTCATGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034489885 7:151387488-151387510 AGGGAGAGCGGGGTGGCCCAGGG + Intronic
1035817934 8:2561463-2561485 AGGGAGGGTGCAGAGGCTCAGGG - Intergenic
1037066237 8:14581392-14581414 AGGCCGGGCGCAGTGGCTCATGG - Intronic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039700079 8:39953046-39953068 AGGCCAGGCGCAGTGGTTCATGG - Intronic
1041255520 8:55976902-55976924 AGGCCGAGCACAGTGGCTCATGG + Intronic
1041768412 8:61445332-61445354 AGGCAGAGCCTAGTGGGTCATGG + Intronic
1042926610 8:73973708-73973730 AGGCCGCGCGCAGTGGCTCACGG - Intronic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044654556 8:94534005-94534027 AGGCTGAGAGCAGTGGCTCATGG - Intronic
1044745477 8:95366683-95366705 AGGGTGAGGGCAGAGGTTCAGGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048578440 8:135711008-135711030 AGGCCGAGCACAGTGGTTCACGG - Intergenic
1049370018 8:142259923-142259945 AGGAACAGGGCAGTGGTTCAGGG + Intronic
1049455210 8:142683163-142683185 AGGGAAGGCGCTGGGGTTCAGGG - Intergenic
1049503934 8:142984871-142984893 AGGCCGGGCGCGGTGGTTCACGG + Intergenic
1049695812 8:143983820-143983842 AGGGAGAGGCCATTGGGTCAGGG + Intronic
1049822954 8:144647245-144647267 AGGCCGGGCGCAGTGGCTCACGG - Intergenic
1049825103 8:144662863-144662885 GGGGAGTGGGGAGTGGTTCAAGG - Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050810029 9:9733260-9733282 ATGCAGACCCCAGTGGTTCATGG + Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052935400 9:34088827-34088849 AGGTGGGGCGCAGTGGTTCATGG + Intronic
1056556968 9:87697670-87697692 AGGCCGGGTGCAGTGGTTCACGG + Intronic
1056975121 9:91245845-91245867 AGGGACAGCGCAGGGGTCAAAGG - Intronic
1057403283 9:94743666-94743688 AGGGAGATGGCAGTGTTCCATGG + Intronic
1058058139 9:100469797-100469819 ACGGAGATGGCAGTGGTACAAGG - Intronic
1058616238 9:106831014-106831036 AGGGAGAACTCAGTGATTCAGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060395683 9:123314685-123314707 AGGGAGTGGGCAATGGTTGAGGG + Intergenic
1062221637 9:135419251-135419273 AGGGAGAGGGCAGTGGTGGGTGG - Intergenic
1062252044 9:135603188-135603210 AGGGGGAGCACAGTGGTTAGGGG - Intergenic
1062594370 9:137291860-137291882 AGGCCGGGCGCAGTGGCTCATGG - Intergenic
1062676042 9:137744596-137744618 AGGGCGGGCGCCGTGGCTCATGG - Intronic
1185504197 X:619645-619667 CGGGTGAGCGCAGGGGTTCTGGG - Intergenic
1186425139 X:9458384-9458406 GGGCCGAGCGCAGTGGCTCACGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193088096 X:77465523-77465545 AGGCTGGGCGCAGTGGCTCACGG + Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196726764 X:118902705-118902727 AGGCTGAGCATAGTGGTTCACGG + Intergenic
1196826479 X:119744209-119744231 AGGCCGGGCGCAGTGGCTCATGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1198870873 X:141176487-141176509 AGGGGGAGAGCAGTGGCTCCTGG + Exonic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199620591 X:149697174-149697196 AGGGAGAGGGCACAGGGTCAAGG - Intronic
1200725585 Y:6665184-6665206 AGGGAGAAAGCAGTGCATCAAGG - Intergenic
1201152158 Y:11100299-11100321 AGGCCAAGCGCAGTGGTTGATGG + Intergenic