ID: 1182722049

View in Genome Browser
Species Human (GRCh38)
Location 22:32411044-32411066
Sequence CGGTTTCCACACAAAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182722047_1182722049 -7 Left 1182722047 22:32411028-32411050 CCTTCCTTCAGGGTAACGGTTTC 0: 1
1: 0
2: 0
3: 3
4: 107
Right 1182722049 22:32411044-32411066 CGGTTTCCACACAAAGAAAGTGG No data
1182722043_1182722049 13 Left 1182722043 22:32411008-32411030 CCTATGTTAGATTTTCTATTCCT 0: 1
1: 0
2: 1
3: 54
4: 480
Right 1182722049 22:32411044-32411066 CGGTTTCCACACAAAGAAAGTGG No data
1182722042_1182722049 14 Left 1182722042 22:32411007-32411029 CCCTATGTTAGATTTTCTATTCC 0: 1
1: 0
2: 2
3: 42
4: 374
Right 1182722049 22:32411044-32411066 CGGTTTCCACACAAAGAAAGTGG No data
1182722041_1182722049 26 Left 1182722041 22:32410995-32411017 CCACTGCGCTCTCCCTATGTTAG 0: 1
1: 0
2: 2
3: 8
4: 153
Right 1182722049 22:32411044-32411066 CGGTTTCCACACAAAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182722049 Original CRISPR CGGTTTCCACACAAAGAAAG TGG Intronic
No off target data available for this crispr