ID: 1182722146

View in Genome Browser
Species Human (GRCh38)
Location 22:32411903-32411925
Sequence GGGCGGCCCCAGAACCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182722139_1182722146 6 Left 1182722139 22:32411874-32411896 CCTGGCGGGAGGTGGTGCCGGAA 0: 1
1: 0
2: 2
3: 13
4: 126
Right 1182722146 22:32411903-32411925 GGGCGGCCCCAGAACCGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 149
1182722131_1182722146 27 Left 1182722131 22:32411853-32411875 CCTCGTGGTTCGGGGACCTCTCC 0: 1
1: 0
2: 0
3: 9
4: 73
Right 1182722146 22:32411903-32411925 GGGCGGCCCCAGAACCGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 149
1182722137_1182722146 11 Left 1182722137 22:32411869-32411891 CCTCTCCTGGCGGGAGGTGGTGC 0: 1
1: 0
2: 0
3: 20
4: 319
Right 1182722146 22:32411903-32411925 GGGCGGCCCCAGAACCGTGAGGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182722146 Original CRISPR GGGCGGCCCCAGAACCGTGA GGG Intronic
900090410 1:917812-917834 GGGTGGCCCCAGAAGCGGGTGGG - Intergenic
900096158 1:940969-940991 GGGCGGCCACAGGGCCGAGACGG - Intronic
900663939 1:3800957-3800979 GGGAGGCCTCAGAATCATGACGG + Intergenic
903448351 1:23436754-23436776 GGGCGGGGCCTGAACCGGGAGGG - Intronic
904322539 1:29707116-29707138 GGGCGGCCCCAGGACGGTCGGGG + Intergenic
905173019 1:36120073-36120095 GAGAGAGCCCAGAACCGTGAGGG - Intronic
905790942 1:40789130-40789152 GGGCAGCCTCAGAACTGTGGAGG + Intronic
906020668 1:42626810-42626832 GGGAGGCCTCAGAATCATGACGG - Intronic
906372754 1:45268582-45268604 GGGAGGCCTCAGAATCATGATGG - Intronic
907689158 1:56645271-56645293 GGGCGGACCCCGAGCCGCGAGGG - Intronic
908355259 1:63321584-63321606 GGGCGGCTGAAGAAACGTGAGGG - Intergenic
908853235 1:68395114-68395136 GGGAGGCCTCAGAATCATGATGG + Intergenic
910132475 1:83925065-83925087 GGGCAGCGACAGAACCCTGAGGG - Intronic
912386742 1:109274582-109274604 GGCAGGCCTCAGAACGGTGAGGG + Exonic
912938104 1:114021255-114021277 GGGAGGCCTCAGAACCATGGTGG - Intergenic
915161183 1:153922243-153922265 GAGCGGCCCCCGCACCCTGAGGG + Intronic
916857163 1:168761832-168761854 GGGAGGCCTCACAACCATGATGG + Intergenic
918120053 1:181530240-181530262 GGGAGGCCTCAGAATCATGATGG - Intronic
922748846 1:228061484-228061506 GGGATGCCCCAGGGCCGTGATGG + Intergenic
923917584 1:238526468-238526490 GGGAGGCCTCAAAACCATGATGG - Intergenic
1064133729 10:12732493-12732515 GGGAGGCCTCAGAATCGTGGCGG + Intronic
1068299550 10:55120947-55120969 GGGCAGCCCCACCACTGTGATGG - Intronic
1071442688 10:85717365-85717387 GGGAGGCCTCAGAATCATGATGG + Intronic
1071521174 10:86332259-86332281 GGGCTGCCCCAGGACGGTGAAGG + Intronic
1077208082 11:1353603-1353625 GAGCGGCCCCAGCACCATGGAGG - Intergenic
1077575644 11:3381007-3381029 GGGAGGCCTCAGAATCATGACGG - Intergenic
1080338199 11:31224112-31224134 GGGAGGCCTCAGAATCATGAAGG - Intronic
1081701483 11:45155402-45155424 GGGCGGACTCAGCACCGTCATGG + Intronic
1081867559 11:46367849-46367871 GGGCCGCCCCAGGATGGTGAGGG + Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1091786857 12:3248207-3248229 GGGGGGCCACAGCACCTTGAAGG - Intronic
1093324875 12:17760996-17761018 GGGAGGCCTCAGAATCATGAAGG + Intergenic
1093978552 12:25450598-25450620 GGGAGGCCTCAGAATCATGACGG - Intronic
1104496529 12:129245691-129245713 GGCAGGCCCCAGCACCGTGGTGG + Intronic
1107541594 13:41394127-41394149 GGGAGGCCTCAGAATCATGATGG + Intergenic
1110683243 13:78341420-78341442 GGGAGGCCTCAGAATCGTGGCGG + Intergenic
1111474192 13:88724811-88724833 GGGAGGCCCCAGAATCGTGGCGG - Intergenic
1113541973 13:111115825-111115847 GGCCGGCGCCAGGACCGTGGCGG + Intronic
1118935803 14:70287012-70287034 GGGAGGCCTCAGAATCGTGGCGG - Intergenic
1119065208 14:71518862-71518884 GGGAGGCCTCAGAATCATGACGG + Intronic
1119175096 14:72562967-72562989 GGGTGGCCACAGAGACGTGAGGG - Intronic
1119947977 14:78714845-78714867 GGGCTGCCGGAGAACCGTGCTGG + Exonic
1120760425 14:88279978-88280000 GGGAGGCCCCAGAATCATGGTGG - Intronic
1121314111 14:92951010-92951032 GGGCTGCCCCAGAACCCAGATGG - Intronic
1121623074 14:95363588-95363610 GGACAGCCCCAGCACAGTGAAGG + Intergenic
1122238834 14:100348455-100348477 GGGCGGGCGCAGTACTGTGAAGG + Intronic
1131094092 15:89645271-89645293 TGGCTGGCCCAGAACCGTGGAGG + Intronic
1139158974 16:64479893-64479915 GGGCTGCCCCAGAAATTTGAAGG + Intergenic
1140487962 16:75309158-75309180 GGGAGGGCTCAGAACCCTGAGGG - Intronic
1142610724 17:1108241-1108263 GGGCGGCCCCGGAACCACGCCGG - Intronic
1142755762 17:2015536-2015558 GGGCAGCCGCAGAACCATGGAGG + Intronic
1148069915 17:44902691-44902713 GGGCAACCCCAGATCCGTGAAGG + Exonic
1148579911 17:48736349-48736371 TGGCTGGCCCAGAACCTTGAGGG - Intergenic
1151511591 17:74564240-74564262 GAGTGGCCCCAGCACCGTGATGG - Intergenic
1152010056 17:77707456-77707478 GGGAGGCCTCACAATCGTGATGG - Intergenic
1152290461 17:79437195-79437217 GGGCGGCCCCAGACCCCAGGGGG - Intronic
1152528553 17:80903413-80903435 GGGAGGCCACAGAACAGTGGCGG + Intronic
1153426722 18:4973924-4973946 GGGAGGCCTCAGAACCGTGGCGG + Intergenic
1154312997 18:13281964-13281986 GGGAGGCCTCAGAATCATGACGG + Intronic
1154316271 18:13306246-13306268 GGACGGCCCCTGAGCCTTGAAGG + Intronic
1158251888 18:55498524-55498546 GGTAGACCCCAGAACCCTGATGG - Intronic
1159306048 18:66643708-66643730 GGGAGGCCTCAGAATCATGACGG + Intergenic
1160019903 18:75172425-75172447 GCTCGGGCCCAGTACCGTGAGGG + Intergenic
1160682739 19:419254-419276 GCGTGGCCCCAGAACCCTGGGGG - Intronic
1160691880 19:464030-464052 GGGCCGCCCCAGCATGGTGAAGG + Exonic
1161932533 19:7350244-7350266 AGGTGGCCCCAGAACCAGGAGGG + Intronic
1162481422 19:10929007-10929029 GCGCGGGCCCAGGACCCTGAGGG - Exonic
1162564071 19:11435518-11435540 GGGCGGTGCCAGAGCCGAGACGG - Intronic
1165797860 19:38529088-38529110 GGGTGGCCCCAGGACCTTGGGGG - Intronic
1168451790 19:56472063-56472085 GGGAGGCCTCACAATCGTGATGG - Exonic
925805752 2:7646081-7646103 GGGAGGCCTCAGAATCGTGGTGG + Intergenic
927612750 2:24558396-24558418 GGGAGGCCCCAGAATCATGGCGG + Intronic
935481581 2:103595816-103595838 GGGAGGCCTCACAATCGTGATGG - Intergenic
939079342 2:137640312-137640334 GGGAGGCCTCAGAACCATGATGG - Intronic
945251545 2:207769442-207769464 GGGCGCCCCCAGAACAGGGGCGG + Exonic
945528013 2:210912875-210912897 GGGAGGCCTCAGAATCATGATGG - Intergenic
946422102 2:219570918-219570940 CGGCGGCTCCAGCACGGTGACGG + Exonic
946825307 2:223671802-223671824 GGGAGGCCCCAGAATCATGGTGG - Intergenic
948973577 2:241448226-241448248 GGGTGGCCCCAGGACCAGGAGGG - Intronic
1168851109 20:977800-977822 GGGAGGACCCAGAACCATGCAGG + Intronic
1169610311 20:7372410-7372432 GGTCGGCCTCAGAACCATGCAGG - Intergenic
1170097099 20:12657758-12657780 GGGAGGCCTCAGAATCGTGGCGG - Intergenic
1172090672 20:32429894-32429916 TGGCAGCCCGAGAACCCTGAAGG - Exonic
1176005548 20:62860868-62860890 GGGCGGCCCCAGACCCGGTGAGG + Intronic
1178291300 21:31370927-31370949 GGGAGGCCCCAGAAATGTGTGGG - Intronic
1178468867 21:32874214-32874236 GGGAGGCCTCAGAATCATGACGG + Intergenic
1178745945 21:35250472-35250494 GGGAGGCCTCACAATCGTGATGG - Intronic
1179060541 21:37975009-37975031 GGGAGGCCTCACAACCGTGGTGG - Intronic
1179439820 21:41385522-41385544 GGGAGGCCTCAGAAGCATGATGG - Intronic
1180073150 21:45448780-45448802 GGGCAGTCCCAGAGCCGTCAGGG + Intronic
1181756659 22:25029091-25029113 GGGCAGCCCCAGAGCCCTGGTGG + Exonic
1182722146 22:32411903-32411925 GGGCGGCCCCAGAACCGTGAGGG + Intronic
1183516612 22:38270564-38270586 GGGCTGCCCCAGCACAGTGCAGG + Intronic
1184610668 22:45601273-45601295 GCCCCGCCCCAGAACCTTGAGGG - Intergenic
950008182 3:9704630-9704652 AGGCGGCTCCAGGACCGGGAGGG + Intronic
951932300 3:27981959-27981981 GGGAGGCCTCAGAACCATGGCGG - Intergenic
953827679 3:46268101-46268123 GGGAGGCCTCAGAACCATGCAGG + Intergenic
954176869 3:48851704-48851726 AGGAGGCCCCAGAACCCTGAGGG + Intergenic
954281831 3:49585606-49585628 GGGCGGCTGAAGAAACGTGAGGG - Intronic
956412252 3:68991837-68991859 GGGAGGCCTCAGAACCATGGCGG + Intronic
960009484 3:112817889-112817911 GGGAGGCCCCAGAATCATGGGGG + Intronic
962052244 3:131829011-131829033 GGGAGGCCGCACAATCGTGATGG + Intronic
964654433 3:159051175-159051197 GGGAGGCCTCAGAATCGTGGCGG - Intronic
970218183 4:13780708-13780730 GGGAGGCCTCAGAATCATGATGG + Intergenic
974388545 4:61234228-61234250 GGGCGGCCTCAGAATCATGGCGG + Intronic
975706506 4:77117380-77117402 GGGAGGCCTCAGAATCATGACGG + Intergenic
976003481 4:80400588-80400610 GGGAGGCCTCAGAATCATGATGG - Intronic
977536432 4:98260905-98260927 GGGCCGCCGCAGAGCCGGGAGGG - Intergenic
980025201 4:127757967-127757989 GGGAGGCCTCAGAATCGTGGTGG + Intronic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
985494288 5:195997-196019 TGTAGCCCCCAGAACCGTGAGGG + Intergenic
985699292 5:1360958-1360980 GGGTGTCCCCAGGACCATGAGGG - Intergenic
987895527 5:23942128-23942150 GGGCGGCCTCAGAATCATGGTGG + Intergenic
993098093 5:83504872-83504894 GGGAGGCCTCAGAATCGTGGCGG + Intronic
995724405 5:115169226-115169248 GGGCGGCCCCGCAAGCGCGAGGG + Intronic
996282733 5:121750977-121750999 GGGAGGCCTCAGAATCATGACGG + Intergenic
997091982 5:130869066-130869088 GGGAGGCCTCAGAACCATGGTGG + Intergenic
997261206 5:132466687-132466709 AGGCGGCCCCAGGACCTTCAAGG - Intronic
998405031 5:141869409-141869431 GGGAGGCCCCAGAATCAGGAGGG + Exonic
1000078718 5:157822432-157822454 GGGAGGCCCCAGAATCATGGCGG - Intronic
1002892873 6:1352114-1352136 GGGAGGCCTCAGAATCATGATGG + Intergenic
1008363743 6:50651111-50651133 GGGAGGCCTCAGAATCATGATGG - Intergenic
1010611739 6:77962131-77962153 GGGAGGCCTCAGAATCATGACGG - Intergenic
1014471366 6:121819071-121819093 GGGAGGCCTCAGAATCATGATGG - Intergenic
1014863090 6:126495660-126495682 GGGAGGCCTCAGAATCATGATGG + Intergenic
1015195545 6:130521530-130521552 GGGAGGCCTCACAACCATGATGG + Intergenic
1015670855 6:135688266-135688288 GGGAGGCCTCAGAATCATGATGG + Intergenic
1021985015 7:26089751-26089773 GGGAGGCCTCAGAATCGTGGTGG - Intergenic
1022097328 7:27148942-27148964 GGGCGGCCCCAGGACAGTGCCGG - Intronic
1022678262 7:32521051-32521073 GGGAGGCCTCAGAATCATGATGG - Intronic
1024180981 7:46894618-46894640 GGGAGGCCTCACAACCATGATGG - Intergenic
1024604127 7:51010970-51010992 GTGCGGCACCAGAACAGGGAAGG - Intergenic
1026843285 7:73682961-73682983 GGGAGGCCCGAGAACCGTCGTGG + Exonic
1028745435 7:94321437-94321459 GGGAGGCCTCAGAATCGTGGTGG + Intergenic
1029859716 7:103556720-103556742 GGGAGGCCTCAGAATCGTGGCGG - Intronic
1030807307 7:113933533-113933555 GGGAGGCCCCACAATCATGATGG + Intronic
1033654406 7:143362903-143362925 CGGCGGCCCCAGATCCCCGAGGG - Intergenic
1034560522 7:151876858-151876880 GGGAGACACCAGAACCGGGACGG - Exonic
1035361885 7:158318677-158318699 GGCCGGCCCCAGAGCAGTGACGG + Intronic
1037805902 8:22057758-22057780 GGGGAGCCCCAGAACCCTGTGGG - Intronic
1040643664 8:49371757-49371779 GGGAGGCCTCAGAATCATGACGG + Intergenic
1042412672 8:68482235-68482257 GGGAGGCCCCAGAATCATGGTGG - Intronic
1047743646 8:127827521-127827543 GGGAGGCTCCTGGACCGTGAAGG - Intergenic
1048270958 8:133027522-133027544 GGGCGGCCCCTGGGCAGTGATGG + Intronic
1049766756 8:144358588-144358610 GGGCGGGCCCGGAACCGCCACGG + Exonic
1051493444 9:17692822-17692844 GGGAGGCCCCAGAATCATGGTGG + Intronic
1052192716 9:25677847-25677869 GGGCAGCCCCAGGGCCCTGAGGG - Exonic
1056470940 9:86903915-86903937 GGGTGGGCCCTGAACCCTGAAGG - Intergenic
1056571549 9:87820945-87820967 GGGCCTCCCCAGAGCCGTGCTGG - Intergenic
1056924507 9:90821384-90821406 GGGAGGCCCCAGAATCATGGAGG + Intronic
1062682136 9:137787799-137787821 GGGTGGCCCCTGAAACCTGAGGG - Intronic
1189283203 X:39833691-39833713 GGTCGGCTCCAGAACCTTCAAGG + Intergenic
1189371447 X:40432492-40432514 GGGAGGCCTCAGAATCATGACGG - Intergenic
1189423609 X:40879279-40879301 GGGGGGCCTCACAATCGTGACGG + Intergenic
1192917135 X:75664911-75664933 GGGAGGCCTCAGAATCATGATGG + Intergenic
1194828808 X:98596082-98596104 GGGAGGCCTCAGAATCATGATGG + Intergenic
1198727410 X:139692046-139692068 GGCCTGCCCCAGAACCCAGATGG - Intronic
1199113404 X:143960410-143960432 GGGAGGCCTCAGAATCATGATGG + Intergenic
1199203703 X:145123574-145123596 GGGAGGCCTCACAACCGTGGTGG + Intergenic
1200060530 X:153481834-153481856 GGGCAGCCCCAGGAACGTGTGGG - Intronic