ID: 1182722431

View in Genome Browser
Species Human (GRCh38)
Location 22:32414320-32414342
Sequence CCTGATAAGCAGACAGTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182722431_1182722437 6 Left 1182722431 22:32414320-32414342 CCCTCCACTGTCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1182722437 22:32414349-32414371 CCTTCCCATACGTGGAAACTTGG 0: 1
1: 0
2: 0
3: 2
4: 108
1182722431_1182722440 20 Left 1182722431 22:32414320-32414342 CCCTCCACTGTCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1182722440 22:32414363-32414385 GAAACTTGGCTGCTGCTTTGAGG 0: 1
1: 0
2: 2
3: 24
4: 188
1182722431_1182722435 -2 Left 1182722431 22:32414320-32414342 CCCTCCACTGTCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1182722435 22:32414341-32414363 GGTTCAGACCTTCCCATACGTGG 0: 1
1: 0
2: 0
3: 4
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182722431 Original CRISPR CCTGATAAGCAGACAGTGGA GGG (reversed) Exonic
900247812 1:1646716-1646738 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900259039 1:1713870-1713892 CCTGAGAAGCAGAGACTGGTGGG - Intronic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
910492623 1:87789216-87789238 CCTGATAATCAAAGAGTGAAAGG - Intergenic
911646288 1:100340605-100340627 TCTCATAAGCAGTAAGTGGAGGG + Intergenic
913243625 1:116852250-116852272 CCTGAAAAGCAGACTCTGAAAGG + Intergenic
915732461 1:158063735-158063757 CCTGGTAAGCAGAGAGAGAAGGG - Intronic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
917086995 1:171313602-171313624 TCTTACAAGCACACAGTGGAAGG + Intergenic
919807954 1:201391890-201391912 CCTGATTTGCAGACAATGCAGGG - Intronic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
922358394 1:224798145-224798167 CCTGGTAAGCAGATAGTTGGAGG + Intergenic
922922012 1:229313410-229313432 CCAGACCAGCAGGCAGTGGAGGG + Intergenic
1062800339 10:374478-374500 CCTGTTTAGCAGACAGGGGCAGG + Intronic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1064016076 10:11773291-11773313 CCTGAACAGCAGACATTGGATGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067277145 10:44845970-44845992 CCTGGTAAGCAGACAGTGCCAGG - Intergenic
1068901857 10:62278530-62278552 CCTATGAAGCAGACAGAGGAAGG - Intergenic
1069878320 10:71576534-71576556 GCTGATAAACAGTGAGTGGAGGG + Intronic
1074438039 10:113451260-113451282 TCTGATCAGCAGGCAGTGCATGG + Intergenic
1075408995 10:122213601-122213623 CCTGATAAGCAGGCAGATGCTGG - Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1080841228 11:35985263-35985285 CCACAGAACCAGACAGTGGAAGG - Intronic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089002885 11:115067040-115067062 CCTCAGGAGCAGACAGTGTACGG - Intergenic
1089552071 11:119287220-119287242 CTTGAAAAGCAGTCAGTGGGTGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098877392 12:75880652-75880674 CCTAAAAAGCAGACAGTTCATGG + Intergenic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102444360 12:112990399-112990421 CCTGATTAGCAGTTAGTTGAAGG + Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG + Intergenic
1105662959 13:22519627-22519649 TCTGTTAAGCAGATAGTGTAAGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105804483 13:23944815-23944837 CCTCACAAGCAGACATTTGAAGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1110858355 13:80321251-80321273 CCTGTTCAGGAGACAGTGAATGG - Intergenic
1111269022 13:85855317-85855339 CCTGTTGAGGAGACAGTGCAGGG - Intergenic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117109063 14:52429802-52429824 CCTGAAAAGGATACAGAGGATGG + Intergenic
1118061095 14:62138555-62138577 ACTGATAAAAAGAAAGTGGAGGG - Intergenic
1118328493 14:64797659-64797681 CCCGATAAGGACACAGTGAATGG - Intronic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1123460238 15:20463769-20463791 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1123657824 15:22536648-22536670 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1124219373 15:27835883-27835905 CCTGAAAAGTATACAGTGGAGGG + Intronic
1124266459 15:28239498-28239520 CCTGCTAACCAGACAGCAGAGGG + Intronic
1124311733 15:28631846-28631868 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1125686917 15:41568875-41568897 CAGGATGAGCTGACAGTGGAGGG + Exonic
1127077655 15:55343715-55343737 CCTTCTAAGTAGACAGAGGATGG - Intronic
1128982171 15:72196203-72196225 CCTGATCAGAAGACTATGGAGGG + Intronic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1133317015 16:4891179-4891201 CCTCATGACCAGACAGTGGCAGG - Intronic
1134211974 16:12285195-12285217 CCTGCTAAACAGTGAGTGGAAGG - Intronic
1136704653 16:32176944-32176966 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1136763260 16:32752462-32752484 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1136804840 16:33117924-33117946 CCTGCTAACCAGACAGCAGAGGG + Intergenic
1138481432 16:57305815-57305837 CCTGATAGGCAGGGAGTAGAGGG + Intergenic
1141642451 16:85349167-85349189 CCTGATAAGCAGACAACTAAAGG - Intergenic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1203065411 16_KI270728v1_random:1012784-1012806 CCTGCTAACCAGACAGCAGAGGG - Intergenic
1143685615 17:8513208-8513230 CCTCATAAACAGACATAGGAAGG + Intronic
1143880673 17:10027324-10027346 CCAAATAAGCAGACAGGGAATGG + Intronic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1146828744 17:36047856-36047878 ACTGAGAAGCAGGCAATGGAGGG + Intergenic
1149604727 17:57916595-57916617 CCTGACAGGAAGACAGCGGAAGG + Intronic
1155475170 18:26230508-26230530 TCTGAAAATCAAACAGTGGATGG - Intronic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1157304044 18:46503746-46503768 CCAGAAAAGCATGCAGTGGAAGG - Intronic
1157991034 18:52496649-52496671 TCTGTTAAGGAGACAGTGGAGGG + Intronic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1168242731 19:55095509-55095531 CCTGAAAGGCGGACAGCGGAGGG - Exonic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG + Intronic
927607757 2:24503364-24503386 ACTGTTAAGAAGACAGAGGAAGG - Intronic
927644420 2:24867873-24867895 ACTAATAAGCAGAAAGTGGGGGG + Intronic
927881773 2:26694159-26694181 CCTGAGACCCAGACAGGGGAAGG - Intronic
933081522 2:77993742-77993764 CCTGGTAAGCAGCCAGTTTATGG - Intergenic
933989230 2:87621760-87621782 CCTGATGAGCATCCAGTGGAAGG - Intergenic
936304613 2:111329066-111329088 CCTGATGAGCATCCAGTGGAAGG + Intergenic
941435747 2:165469247-165469269 TTTGATATGCAGACAGAGGAGGG - Intergenic
946961776 2:224993061-224993083 ACTGAAAATCAGGCAGTGGAAGG + Intronic
947746257 2:232508762-232508784 CCAGAAAAGCTGACCGTGGATGG - Intergenic
947969197 2:234307836-234307858 CCTGAGAAGCAGGCAATGAAAGG - Intergenic
948171768 2:235909556-235909578 TCTGATGAGCAGACATGGGAAGG - Intronic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948945389 2:241216666-241216688 CCTGGTAAGGTGACAGTGGTAGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1173125800 20:40335005-40335027 CCTGTTAAGTACACAGAGGAGGG - Intergenic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1175415896 20:58800736-58800758 GCGAATGAGCAGACAGTGGACGG - Intergenic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1179917023 21:44484412-44484434 CCTGAAAAGGAAACAGTGGGGGG - Intergenic
1180299266 22:11023789-11023811 CTAGATAGGCAGATAGTGGAGGG - Intergenic
1180840558 22:18957037-18957059 CCTGATGCGCAGGCAGTGGCTGG + Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183832977 22:40428827-40428849 CCTGATGAGAAGGCACTGGAAGG - Intronic
1184285436 22:43468466-43468488 CCTGATGAGTAGACAGTTTAGGG - Intronic
949216046 3:1568358-1568380 CCTAATAATCTGACAGTGAAGGG + Intergenic
950453686 3:13079996-13080018 CTTGTTAGGCAGACAGTGCATGG + Intergenic
952656478 3:35792509-35792531 CCTGATAAGAAGACATTGTTGGG - Exonic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953842059 3:46397036-46397058 CCTGAAAAGCAGACATTAGGAGG + Intergenic
958892670 3:99797732-99797754 CCTTAGAAGCGGACTGTGGAAGG + Exonic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962269182 3:133965720-133965742 CCTGAGAAGAAGACAGAGGGAGG - Intronic
964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG + Intergenic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
974084227 4:57242315-57242337 CATGATAAGGAGTCATTGGAGGG + Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981595808 4:146420522-146420544 CCTGAGAGGAAGAAAGTGGATGG + Intronic
982083213 4:151810028-151810050 CCAGATTAGCAGACAATGCAAGG - Intergenic
989240864 5:39201990-39202012 CCTTCTAAGCTGACAGTGGGGGG - Exonic
992769416 5:80033622-80033644 GCTGACAAGCATGCAGTGGAAGG + Intronic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994395510 5:99223216-99223238 CCTAATAAGCAGGGAGGGGAAGG - Intergenic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
999119289 5:149196652-149196674 CCTGATTAGCAATCAGAGGAAGG - Intronic
1001106337 5:168857850-168857872 CCTGATAGGCACACCGTTGAGGG - Intronic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1004254948 6:14054871-14054893 AGTGATATGCAGACAGTGGTGGG - Intergenic
1004310518 6:14540975-14540997 CCTAATAAGCAAGCAGGGGAGGG + Intergenic
1009463167 6:63938250-63938272 CCTGATAATTAGACTGTGGTTGG - Intronic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1014786114 6:125621416-125621438 CCTGATAAACTGTAAGTGGAAGG - Intergenic
1017620548 6:156292177-156292199 CCTTGTGAGCAGACAGAGGAAGG + Intergenic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1024507593 7:50175389-50175411 CCAGATAAGCAGACTCTGGCTGG - Intergenic
1026914409 7:74111488-74111510 CCTTAGAAGCAGACAGTTGTGGG + Intronic
1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG + Intergenic
1035293183 7:157853076-157853098 CCAGATCAGCAGGCAGTGGATGG + Intronic
1037205011 8:16306532-16306554 CATGAGCAGCAGACAGTGCAAGG - Intronic
1037287274 8:17314798-17314820 CCTGATATGCAGTCGGTGAAGGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1044323683 8:90835409-90835431 CCTCATAGACAGATAGTGGAGGG - Intronic
1046854444 8:119015305-119015327 CCTAATGGGCAGACAGTGGGAGG - Intronic
1048280217 8:133100231-133100253 TCTGATAAGCAGACCCTGAAGGG - Intronic
1048715332 8:137262308-137262330 CCTGATAACCTGACGGTGGGGGG + Intergenic
1049033774 8:140058626-140058648 CCTGCAAGACAGACAGTGGAAGG + Intronic
1049353049 8:142174502-142174524 CCTGAGAAGCAGGCAGCAGAGGG - Intergenic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1052268735 9:26604466-26604488 CCTCAGAAACAGACAGTGCAAGG + Intergenic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1055819846 9:80248498-80248520 CCTGGAAAGGACACAGTGGATGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057896299 9:98911874-98911896 GCTGATAAGGAGTCAGTGGCTGG + Intergenic
1058995143 9:110292244-110292266 CCTGGGGAGCAGGCAGTGGATGG - Intergenic
1059370032 9:113822763-113822785 CCTGAAAACCAGAGAGTGAATGG - Intergenic
1191653112 X:63563584-63563606 ACTGATAACCAGATAGTCGAGGG + Intergenic
1194716474 X:97291873-97291895 CCTGACAACCAGATAGTTGAAGG - Intronic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1199419426 X:147627018-147627040 GCTGAGAAGTAGACAGTGAATGG - Intergenic