ID: 1182722435

View in Genome Browser
Species Human (GRCh38)
Location 22:32414341-32414363
Sequence GGTTCAGACCTTCCCATACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 37}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182722429_1182722435 0 Left 1182722429 22:32414318-32414340 CCCCCTCCACTGTCTGCTTATCA 0: 1
1: 0
2: 0
3: 29
4: 303
Right 1182722435 22:32414341-32414363 GGTTCAGACCTTCCCATACGTGG 0: 1
1: 0
2: 0
3: 4
4: 37
1182722430_1182722435 -1 Left 1182722430 22:32414319-32414341 CCCCTCCACTGTCTGCTTATCAG 0: 1
1: 0
2: 0
3: 20
4: 261
Right 1182722435 22:32414341-32414363 GGTTCAGACCTTCCCATACGTGG 0: 1
1: 0
2: 0
3: 4
4: 37
1182722428_1182722435 22 Left 1182722428 22:32414296-32414318 CCGGCAATCAAGGGGCTGACTTC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1182722435 22:32414341-32414363 GGTTCAGACCTTCCCATACGTGG 0: 1
1: 0
2: 0
3: 4
4: 37
1182722433_1182722435 -3 Left 1182722433 22:32414321-32414343 CCTCCACTGTCTGCTTATCAGGT 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1182722435 22:32414341-32414363 GGTTCAGACCTTCCCATACGTGG 0: 1
1: 0
2: 0
3: 4
4: 37
1182722434_1182722435 -6 Left 1182722434 22:32414324-32414346 CCACTGTCTGCTTATCAGGTTCA 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1182722435 22:32414341-32414363 GGTTCAGACCTTCCCATACGTGG 0: 1
1: 0
2: 0
3: 4
4: 37
1182722431_1182722435 -2 Left 1182722431 22:32414320-32414342 CCCTCCACTGTCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1182722435 22:32414341-32414363 GGTTCAGACCTTCCCATACGTGG 0: 1
1: 0
2: 0
3: 4
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182722435 Original CRISPR GGTTCAGACCTTCCCATACG TGG Exonic
1068381099 10:56254887-56254909 GGGTGAGACCTTCCCAAAAGAGG - Intergenic
1073205377 10:101766557-101766579 GGGTAAGACATTCCCATACCTGG - Intergenic
1077487888 11:2847409-2847431 GGTGCAGACCCTGCCATGCGGGG + Intronic
1079339297 11:19598775-19598797 GGTCAAGTCCTTCCCATAAGAGG - Intronic
1080667809 11:34351145-34351167 GTTTCAGAACTTCCCATTCTTGG + Intronic
1087014495 11:93542855-93542877 GTTTCCCACCTTCCCATACGGGG + Intronic
1087912181 11:103766996-103767018 GGTTCAGACCCACCCATTCCTGG - Intergenic
1091134966 11:133180254-133180276 CGTTCAGACCTGCCCAGACCTGG + Intronic
1109111565 13:58327257-58327279 GCTTCAGACCTTCTCATTTGTGG + Intergenic
1125498521 15:40221285-40221307 GGGTCTGACCTTCCAATAAGTGG + Intergenic
1135175134 16:20221296-20221318 GGTTCACAACTTCCCACACAAGG + Intergenic
1141472432 16:84248243-84248265 GGTTCTGAACTTCCCATACATGG - Intergenic
1141987165 16:87587646-87587668 GCTTCAGACCTTCCCATGTGTGG + Intergenic
1160130606 18:76221935-76221957 GGTTAAGACCTTCCCTTGGGAGG - Intergenic
1160228780 18:77030862-77030884 GTTTCAGACCTTCTCTTATGGGG + Intronic
926200271 2:10790718-10790740 GGTTCTGGCCTCCCGATACGGGG - Exonic
935950629 2:108325482-108325504 GCTTCAGATCATCCCATAGGAGG - Intergenic
939004245 2:136766678-136766700 AGCTCAGAGCTTCCCATAAGAGG + Intronic
1174978510 20:55363116-55363138 GTTTCAGACATTCCCATACAAGG - Intergenic
1178378253 21:32086195-32086217 GGTTCATACCTGCCCAAATGAGG + Intergenic
1178498802 21:33109357-33109379 GGTTCACAGCTTCCCAAACTTGG - Intergenic
1180021401 21:45129976-45129998 GATTTTGACCTTCCCATACTTGG - Intronic
1182722435 22:32414341-32414363 GGTTCAGACCTTCCCATACGTGG + Exonic
1183842292 22:40509239-40509261 GGTTCACACCTTCCCCTATTAGG + Intronic
1184747017 22:46462018-46462040 GGTTCAGGCCTGCTCATACCTGG + Intronic
953393143 3:42545469-42545491 GGTCAAGACTTTCCCATATGAGG - Intergenic
954539940 3:51386709-51386731 GGGTAAGACCATCCCATACAGGG + Intronic
956168842 3:66416969-66416991 GGTTCAGACCTTCCCTGAGCAGG - Intronic
956838907 3:73118751-73118773 GGTGGAGACTTTTCCATACGAGG + Intergenic
966862161 3:184236548-184236570 GGTTCTGCCCATCCCATACCTGG - Exonic
967433271 3:189414149-189414171 GGTTCAGAACATACCATACAAGG + Intergenic
973169633 4:47124351-47124373 GGTACAGACCTTCTCATGCTGGG - Intronic
991270110 5:64769175-64769197 GGCTCTCACCTTCCCATTCGTGG - Exonic
994089225 5:95794086-95794108 GGTCCAGACCTCCCCAAAGGCGG - Exonic
1006602393 6:35234735-35234757 GGATCAGACCTTCACATCCCTGG - Intronic
1011531082 6:88321641-88321663 GGCTCAGACCATCTCATAGGAGG - Intergenic
1027138876 7:75642827-75642849 GGCTCAGACCCTCCCATCCTAGG - Intronic
1027181956 7:75947122-75947144 TGTTCAGACCTAACTATACGTGG + Intronic
1032762222 7:134954172-134954194 GGTACAGACTTTCCCAAACAAGG - Intronic
1037814113 8:22102912-22102934 GGCTCAGACCTGCCCTTCCGGGG - Exonic
1055724972 9:79217633-79217655 GGTTCAGAGCTTCACAAATGGGG + Intergenic
1056803936 9:89713400-89713422 GGTCCTGACCTTCCCAGACTAGG - Intergenic