ID: 1182722437

View in Genome Browser
Species Human (GRCh38)
Location 22:32414349-32414371
Sequence CCTTCCCATACGTGGAAACT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182722428_1182722437 30 Left 1182722428 22:32414296-32414318 CCGGCAATCAAGGGGCTGACTTC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1182722437 22:32414349-32414371 CCTTCCCATACGTGGAAACTTGG 0: 1
1: 0
2: 0
3: 2
4: 108
1182722433_1182722437 5 Left 1182722433 22:32414321-32414343 CCTCCACTGTCTGCTTATCAGGT 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1182722437 22:32414349-32414371 CCTTCCCATACGTGGAAACTTGG 0: 1
1: 0
2: 0
3: 2
4: 108
1182722430_1182722437 7 Left 1182722430 22:32414319-32414341 CCCCTCCACTGTCTGCTTATCAG 0: 1
1: 0
2: 0
3: 20
4: 261
Right 1182722437 22:32414349-32414371 CCTTCCCATACGTGGAAACTTGG 0: 1
1: 0
2: 0
3: 2
4: 108
1182722434_1182722437 2 Left 1182722434 22:32414324-32414346 CCACTGTCTGCTTATCAGGTTCA 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1182722437 22:32414349-32414371 CCTTCCCATACGTGGAAACTTGG 0: 1
1: 0
2: 0
3: 2
4: 108
1182722431_1182722437 6 Left 1182722431 22:32414320-32414342 CCCTCCACTGTCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1182722437 22:32414349-32414371 CCTTCCCATACGTGGAAACTTGG 0: 1
1: 0
2: 0
3: 2
4: 108
1182722429_1182722437 8 Left 1182722429 22:32414318-32414340 CCCCCTCCACTGTCTGCTTATCA 0: 1
1: 0
2: 0
3: 29
4: 303
Right 1182722437 22:32414349-32414371 CCTTCCCATACGTGGAAACTTGG 0: 1
1: 0
2: 0
3: 2
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182722437 Original CRISPR CCTTCCCATACGTGGAAACT TGG Exonic
901454211 1:9354007-9354029 CCTTCCCATGCGGGAACACTTGG - Intronic
903069964 1:20722231-20722253 CCCTCCCATCCCTAGAAACTGGG + Intronic
906137058 1:43507072-43507094 CCTTCCCACACCTGGTAACCTGG + Intergenic
907905568 1:58781895-58781917 CCTTCCCACTCGTGCACACTGGG + Exonic
912450650 1:109765575-109765597 GCTTCCCATACCTGGGGACTTGG + Intronic
912777766 1:112516614-112516636 TCTTCACATAGGTGGAAAGTAGG + Intronic
915141187 1:153769628-153769650 CCTTCCCATTCCTTTAAACTGGG + Intronic
916016133 1:160751219-160751241 CCTTCCATTACAAGGAAACTCGG + Intronic
923508267 1:234625663-234625685 CCCTCCCAAAATTGGAAACTTGG - Intergenic
923760264 1:236835970-236835992 CCTTCACATACATGGAAAGTGGG - Intronic
1064740263 10:18425922-18425944 CCTACTCATATGTGGAAAATTGG - Intronic
1064851383 10:19712755-19712777 CCTTTCCAACTGTGGAAACTCGG + Intronic
1064895152 10:20227388-20227410 CCTGCCCATACTTCAAAACTTGG - Intronic
1066460821 10:35610775-35610797 CCCTTCCATACATGGAAACCAGG - Intergenic
1074569798 10:114614149-114614171 CCTTCCAACACTTGGAAAGTAGG + Intronic
1074792110 10:116899881-116899903 CCTTCTCATTCCTGGAAGCTAGG + Intronic
1080040071 11:27750693-27750715 CATTTCCAAATGTGGAAACTTGG - Intergenic
1086739201 11:90345803-90345825 ACTTCCCTTAGATGGAAACTAGG - Intergenic
1089875169 11:121714268-121714290 CCTTCCCTCACCTGGAATCTGGG + Intergenic
1091719116 12:2799738-2799760 CCTTCCCATCCCTTGAGACTTGG - Intronic
1093309413 12:17560809-17560831 CCTTCCCATGCCTTGAAAGTTGG + Intergenic
1096670068 12:53193288-53193310 CCTCCCCAGACCTGGAATCTGGG - Exonic
1102802053 12:115743910-115743932 CCTTCCCATCAGAGGACACTTGG - Intergenic
1104076236 12:125392435-125392457 ACTTTCCAGACATGGAAACTGGG + Intronic
1104092195 12:125526413-125526435 CCTTCCCATTGGTTAAAACTGGG + Intronic
1106589479 13:31087170-31087192 CCTTCCCAGCTGTGTAAACTTGG + Intergenic
1108573042 13:51769063-51769085 CCTTCCCCTCCGTGAAACCTGGG - Intronic
1110390732 13:74970729-74970751 CCTTCTCATACATGAGAACTTGG + Intergenic
1110940600 13:81343793-81343815 TCTTGTGATACGTGGAAACTGGG - Intergenic
1120307776 14:82792189-82792211 CATTCCCATATGTGAAAACAGGG + Intergenic
1126343915 15:47673457-47673479 CATTCCCAGACGTGGATTCTGGG - Intronic
1127360922 15:58244522-58244544 CCCTCCAATAACTGGAAACTTGG + Intronic
1132331463 15:101015022-101015044 CCTTCCAATAGGTGGAAAGCCGG + Intronic
1135374342 16:21932711-21932733 CCTTCCCATACCTGATAAATAGG - Intergenic
1137572700 16:49577180-49577202 CTTTCCCATTCTTGGAGACTTGG - Intronic
1139256303 16:65546252-65546274 CCTTCCCATTTGAGGAAATTAGG - Intergenic
1139256763 16:65550013-65550035 CCTTCCCATTTGAGGAAATTAGG + Intergenic
1140980614 16:80105369-80105391 CTTTGCCATTCGTGGTAACTTGG + Intergenic
1141720858 16:85754488-85754510 CCTTCTCAGACCTGGAGACTCGG + Intergenic
1143913205 17:10269173-10269195 ACTTCCCAGATGAGGAAACTAGG + Intergenic
1144039864 17:11401146-11401168 TCTTCCTATACCTGGACACTTGG + Intronic
1144070390 17:11666378-11666400 CCTTCCCACAAGTGGACACATGG - Intronic
1150913746 17:69414756-69414778 CCTTCCCTAACGTTGCAACTGGG + Exonic
1152184091 17:78843302-78843324 CCCTCCCAAACCTGGGAACTCGG - Intergenic
1153054890 18:936060-936082 CCTTTCCAGCTGTGGAAACTTGG + Intergenic
1156837811 18:41576056-41576078 CCTCCCCATACCTGGGAGCTAGG - Intergenic
1156838117 18:41579736-41579758 CCTCCCCAAAAGTGAAAACTTGG - Intergenic
1161653882 19:5501328-5501350 CTTTCACAGATGTGGAAACTAGG + Intergenic
1161786677 19:6330857-6330879 GCTTCCCATACCTGGGAAGTGGG - Intronic
1165721977 19:38085653-38085675 CCTTCGTATACCTGGCAACTTGG + Intronic
1166279850 19:41784615-41784637 CCTTCCCATCAGTGGCAATTAGG - Intergenic
1166348583 19:42182583-42182605 CCTTCCCATAGGAGGCCACTGGG - Intronic
1167912013 19:52711441-52711463 ACTTACCGTACGTGCAAACTGGG - Intronic
1167919681 19:52772702-52772724 ACTTACCGTACGTGCAAACTGGG - Intronic
925725566 2:6867400-6867422 CCTTCCCAGAAGAGGAAATTTGG - Intronic
934078340 2:88447103-88447125 ACTTCCCTTACATGGAAAATGGG + Exonic
934674595 2:96240735-96240757 CCTTCCCATAGTGGTAAACTGGG - Intergenic
935296377 2:101653244-101653266 CCTTCCCATGCCTGGACCCTGGG - Intergenic
938948402 2:136235157-136235179 TCTTCCCATATGTGGAAATGTGG + Intergenic
939784393 2:146492156-146492178 TCTGCCCAAAAGTGGAAACTAGG - Intergenic
940454214 2:153874648-153874670 CCTTAGCATACCTGGTAACTTGG - Intronic
940649796 2:156430911-156430933 CCTTCCCAAACTTGGAGAGTAGG - Intergenic
948509398 2:238453411-238453433 CCTTCCATTGCGTTGAAACTAGG - Intergenic
1169014450 20:2280201-2280223 GCATCCCATACGTGGGAAATAGG - Intergenic
1169571324 20:6909235-6909257 CTTCCCCATAAGGGGAAACTTGG - Intergenic
1172973262 20:38888651-38888673 CCTTCCCAGGCTTGGCAACTGGG - Intronic
1178757965 21:35370861-35370883 CCTTTCCATACCTGTAAAATGGG - Intronic
1180991762 22:19941495-19941517 CCTTCCCAGGTGGGGAAACTGGG - Intronic
1182722437 22:32414349-32414371 CCTTCCCATACGTGGAAACTTGG + Exonic
1183262936 22:36807663-36807685 CATTCCCACACCTGGAAAGTGGG - Intronic
950628760 3:14267461-14267483 TCTTCCCAGAGGAGGAAACTGGG + Intergenic
951288036 3:20839342-20839364 CCTTCCCATAGATGGAGAGTAGG + Intergenic
953263075 3:41358967-41358989 TCTTCACATACGTTGAAAGTAGG + Intronic
959990648 3:112627705-112627727 CTTTCCCATAAGGGTAAACTGGG + Intronic
961893389 3:130148452-130148474 CGTTCCCATACATAGACACTTGG - Intergenic
962455015 3:135557033-135557055 ACTTTCCATACTAGGAAACTGGG - Intergenic
964777254 3:160292065-160292087 CCTACACATAGCTGGAAACTTGG + Intronic
965364340 3:167779839-167779861 CCTTCCCATACCTCTTAACTTGG - Intronic
966836291 3:184051702-184051724 TCTTCCCTGACTTGGAAACTTGG - Intergenic
968607079 4:1540585-1540607 CCTTTACAGACGAGGAAACTCGG + Intergenic
969080638 4:4615257-4615279 CCTTTCCAGATGGGGAAACTGGG + Intergenic
972623717 4:40775170-40775192 TCTTCCCATTCATGGAATCTGGG - Intronic
976497396 4:85746217-85746239 CCTATCCATTCCTGGAAACTGGG - Intronic
978476423 4:109136464-109136486 CCTACCCAAATGTGGAAAATTGG + Intronic
981200065 4:141970121-141970143 CCTTCCCATCCGTTGTAAGTTGG - Intergenic
999605450 5:153309193-153309215 CCTTCCTATAAGTGGAGGCTAGG + Intergenic
1000214686 5:159143958-159143980 CCTTCACATACCTTGTAACTTGG - Intergenic
1003362811 6:5444855-5444877 ACTGCCCATCCTTGGAAACTGGG - Intronic
1003553373 6:7119042-7119064 CTTTCCCATACCAGTAAACTTGG - Intronic
1006851568 6:37102494-37102516 CCTTCCCCGAGGTGGAGACTGGG + Intergenic
1007670003 6:43544495-43544517 CCAACCCAGACGTGGAAACAGGG - Intronic
1009919240 6:70036829-70036851 CCTTCCCATAGGTAGAACATAGG + Intronic
1010766045 6:79778217-79778239 CCTTCCCGACCGTGGAAAGTCGG + Intergenic
1012409716 6:98943150-98943172 TGTTACCATAGGTGGAAACTGGG + Intronic
1012772679 6:103459807-103459829 CCTTCACATCCCTTGAAACTTGG + Intergenic
1013211969 6:107995099-107995121 CCATCCAATAAATGGAAACTAGG - Intergenic
1018500541 6:164406121-164406143 CCATTCCATAAGTAGAAACTGGG + Intergenic
1023546371 7:41322035-41322057 CCTCCCAATATATGGAAACTTGG + Intergenic
1024676900 7:51645548-51645570 CATTCCCACATGAGGAAACTCGG + Intergenic
1026639408 7:72110956-72110978 CTTTCCCATCCTTGGGAACTAGG + Intronic
1029465456 7:100721850-100721872 CCAAACCATACCTGGAAACTAGG + Intronic
1029946911 7:104542553-104542575 CCTTCCCCAAAGTGGAATCTTGG + Intronic
1031202092 7:118701072-118701094 CTTTACCATAAGTGGAAACAGGG + Intergenic
1035143248 7:156785718-156785740 TCTTCCCAGAGGTGGAAACAAGG + Intronic
1036421425 8:8599560-8599582 CCTGTCCTAACGTGGAAACTAGG + Intergenic
1044582254 8:93834577-93834599 ACTTCCCATTCGGGGCAACTGGG + Intergenic
1056956031 9:91082077-91082099 CCTACCCATTGGAGGAAACTAGG + Intergenic
1185582751 X:1223681-1223703 CCTTCACATACCTGGAAGCTGGG + Intergenic
1186545980 X:10449888-10449910 CCCTCCCAAACATGGAAAGTGGG + Intronic
1195343213 X:103924934-103924956 CCTTCCCATTCGTGGAAGAAAGG + Intronic
1198461564 X:136867943-136867965 CTTTCCCATTCATGGAAACCTGG - Intronic