ID: 1182722440

View in Genome Browser
Species Human (GRCh38)
Location 22:32414363-32414385
Sequence GAAACTTGGCTGCTGCTTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182722436_1182722440 -9 Left 1182722436 22:32414349-32414371 CCTTCCCATACGTGGAAACTTGG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1182722440 22:32414363-32414385 GAAACTTGGCTGCTGCTTTGAGG 0: 1
1: 0
2: 2
3: 24
4: 188
1182722434_1182722440 16 Left 1182722434 22:32414324-32414346 CCACTGTCTGCTTATCAGGTTCA 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1182722440 22:32414363-32414385 GAAACTTGGCTGCTGCTTTGAGG 0: 1
1: 0
2: 2
3: 24
4: 188
1182722429_1182722440 22 Left 1182722429 22:32414318-32414340 CCCCCTCCACTGTCTGCTTATCA 0: 1
1: 0
2: 0
3: 29
4: 303
Right 1182722440 22:32414363-32414385 GAAACTTGGCTGCTGCTTTGAGG 0: 1
1: 0
2: 2
3: 24
4: 188
1182722430_1182722440 21 Left 1182722430 22:32414319-32414341 CCCCTCCACTGTCTGCTTATCAG 0: 1
1: 0
2: 0
3: 20
4: 261
Right 1182722440 22:32414363-32414385 GAAACTTGGCTGCTGCTTTGAGG 0: 1
1: 0
2: 2
3: 24
4: 188
1182722431_1182722440 20 Left 1182722431 22:32414320-32414342 CCCTCCACTGTCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1182722440 22:32414363-32414385 GAAACTTGGCTGCTGCTTTGAGG 0: 1
1: 0
2: 2
3: 24
4: 188
1182722433_1182722440 19 Left 1182722433 22:32414321-32414343 CCTCCACTGTCTGCTTATCAGGT 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1182722440 22:32414363-32414385 GAAACTTGGCTGCTGCTTTGAGG 0: 1
1: 0
2: 2
3: 24
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182722440 Original CRISPR GAAACTTGGCTGCTGCTTTG AGG Exonic
900797307 1:4716122-4716144 GAAACGTGGCTGGTGATTTGGGG + Intronic
900904785 1:5548214-5548236 GGAACTTGTCTGCTGCTTCTTGG - Intergenic
901857486 1:12053606-12053628 CAAGGTGGGCTGCTGCTTTGGGG + Intergenic
901884889 1:12215895-12215917 GGGACTTGGATGCTGCTGTGGGG + Intergenic
904965631 1:34370267-34370289 GAAGCTGGGCTCCTGCTCTGAGG + Intergenic
906523582 1:46481089-46481111 AAGACTGGGCTGCTGCTTTGGGG + Intergenic
908815892 1:68033611-68033633 GAAACTTGTCTGCTGCCTCTTGG + Intergenic
909116875 1:71548309-71548331 GTAACATTTCTGCTGCTTTGGGG + Intronic
909311048 1:74149884-74149906 GAAATTTGGCTACTGTTTTAAGG - Intronic
911945100 1:104097131-104097153 GGAACTTGGCTTTTTCTTTGAGG - Intergenic
912497767 1:110102430-110102452 GAAACTTAGCTGGGGCCTTGGGG + Intergenic
913410271 1:118543049-118543071 GAAACATGGCTGCAACTGTGAGG + Intergenic
913445881 1:118950252-118950274 GAGACTTCTCTGCTGCTTTGAGG + Intronic
913501434 1:119476017-119476039 GAGACTTTGCTGCCGCTGTGTGG - Intergenic
915389590 1:155529755-155529777 AAATTTTGGCTTCTGCTTTGAGG - Intronic
915633063 1:157166966-157166988 GGAGCTTGGCTGCAGCTTGGGGG + Intergenic
917333135 1:173903004-173903026 GAAACTTTGGTGGTGTTTTGTGG + Exonic
917524327 1:175773868-175773890 GAAACCCAGCTGTTGCTTTGGGG - Intergenic
918313205 1:183301495-183301517 GTAATTTGGCTCCTTCTTTGGGG - Intronic
919314731 1:195956643-195956665 GGAACTTGCCTGCTGCTTCTTGG + Intergenic
919538232 1:198814966-198814988 GAAACTTGTCTGCTGCCTCCTGG - Intergenic
920774748 1:208925049-208925071 TAAACTTGGATGCAGCTCTGGGG + Intergenic
922030109 1:221789591-221789613 GTACCTTCACTGCTGCTTTGTGG + Intergenic
923073909 1:230592201-230592223 GTGACTTGGTTGCTGCTGTGAGG - Intergenic
923651541 1:235878544-235878566 AAATCTTGGCTGGTGCTTTTAGG - Intronic
1065460114 10:25952242-25952264 GAATTTTGACTGCTGCTTTTTGG - Exonic
1066414929 10:35213111-35213133 GAAAATTGGGAGCTGGTTTGCGG + Intergenic
1067771551 10:49130273-49130295 CAAACATGGATGCTGCTCTGTGG - Intergenic
1067827469 10:49588235-49588257 GAACCCAGGCTGTTGCTTTGCGG + Intergenic
1067938262 10:50629892-50629914 GAAACTTTGCTGCAGCTCTGAGG - Intergenic
1070292586 10:75128762-75128784 GATACTGGGCTGGTGCCTTGGGG + Intronic
1070562041 10:77575469-77575491 GAATCTTGGCTGCACCTTTCTGG + Intronic
1071445393 10:85741639-85741661 GAAACCTGGCAGCTGGATTGAGG - Intronic
1071523766 10:86346658-86346680 GAAGCTGGGCTGCTGCTGGGAGG - Intronic
1072280585 10:93862096-93862118 CAAATCAGGCTGCTGCTTTGAGG + Intergenic
1072520660 10:96227307-96227329 CAAACCTGGCTGCTGCTTGAGGG - Intronic
1074190993 10:111137243-111137265 GAAAGTTGACTCCTGCTTTTGGG - Intergenic
1075263714 10:120983744-120983766 GAAACTTGTTTGCTGTTTGGGGG - Intergenic
1075663444 10:124214196-124214218 TAAACTTGCCTGCTGCTTCCTGG - Intergenic
1077132720 11:981561-981583 GAAGCGTGGCTGGTGCTTCGTGG + Intronic
1079291606 11:19193178-19193200 GAAACTTGCTTTCTGCTTTCAGG + Intronic
1081899802 11:46617959-46617981 GCCCCTTGGCTGCTGCTTCGTGG + Intronic
1081906423 11:46673251-46673273 GAATCCGGGCTGCTGCTTTGAGG + Intronic
1082233974 11:49800176-49800198 GGAACTTGTCTGCTGCTTCTTGG - Intergenic
1083591491 11:63897946-63897968 AAAACCTGCCTGCTGTTTTGGGG + Intronic
1084228172 11:67730546-67730568 GCCACTTAGCTGCTGCTTGGCGG + Intergenic
1084545534 11:69813351-69813373 GCACCTGGGCTGCTGCTCTGTGG + Intronic
1084671888 11:70611894-70611916 GAAACTGGGCTGCTGCTGAAAGG + Intronic
1086617618 11:88841264-88841286 GGAACTTGTCTGCTGCTTCTTGG + Intronic
1086916731 11:92538353-92538375 GAAACTTGGCTATTGCCTTATGG - Intronic
1089543590 11:119206045-119206067 GAAACCTGGCCGCGGCTTTCCGG + Exonic
1090022903 11:123143171-123143193 GAAACGTGGCTCCTGCTCTCAGG - Intronic
1090363402 11:126188247-126188269 GTAACTTGTCTGCTGCTTGGAGG + Intergenic
1092575972 12:9782997-9783019 GAAACTTGGCTGCTTATAGGAGG + Intergenic
1093285485 12:17254884-17254906 GATACTTGACTGCAACTTTGTGG - Intergenic
1093985879 12:25532500-25532522 CAAAATTGGCAGCTGTTTTGAGG + Intronic
1096260037 12:50084806-50084828 GAATCTTGGCTTCGGCTTTATGG + Intergenic
1096425125 12:51494976-51494998 GAAATCTGGCTGGTGCTTTGCGG - Exonic
1096916418 12:55038233-55038255 GAAACTTGGCTAATGCAATGAGG + Intergenic
1098737553 12:74126120-74126142 GAATTTTGGCTGTTGCTCTGAGG - Intergenic
1099048962 12:77760352-77760374 CAAACTTGCATGCTGCTCTGTGG - Intergenic
1100150621 12:91732829-91732851 GAAAATTAGTTGCTGTTTTGAGG + Intergenic
1100268777 12:93003702-93003724 GAACCTTGGCTGATGATTTATGG - Intergenic
1100712056 12:97268321-97268343 GATATTTGGCTGCTGCCTTAGGG + Intergenic
1102921619 12:116795853-116795875 TAACCTTGGCTGCTCTTTTGAGG + Intronic
1102977702 12:117218418-117218440 GAAACACCGCTGCTGCTTGGTGG + Intronic
1103163982 12:118754433-118754455 GCAGCGGGGCTGCTGCTTTGTGG + Intergenic
1103973386 12:124686487-124686509 GTATCTTGGCTGCTGCTTCCTGG + Intergenic
1105977191 13:25482471-25482493 GAAACTTGGGTGGGGCTTGGTGG + Intronic
1106090869 13:26592008-26592030 AAAACTCGCCTGCTCCTTTGAGG - Intronic
1106785168 13:33100119-33100141 CAAACTTTCCTGCTGATTTGGGG + Intergenic
1107027027 13:35812332-35812354 AAAACTTAGCTGCTTCCTTGAGG - Intronic
1107311977 13:39088859-39088881 TAAACTTGTCTTCTGCCTTGTGG - Intergenic
1107443978 13:40453556-40453578 GAAGCTTGGCTTTTGCTTAGTGG - Intergenic
1108980113 13:56500172-56500194 GACACTGGGCTGCTTCATTGGGG - Intergenic
1109540614 13:63774466-63774488 GAATCTTTCCTGCTCCTTTGTGG + Intergenic
1110385228 13:74903313-74903335 GAAACCTGATTGCTACTTTGAGG - Intergenic
1116301139 14:43184810-43184832 GAAAAGTGGCTGCTTCTGTGAGG - Intergenic
1119019177 14:71092514-71092536 GGAACTTGTCTGCTGCCTTTTGG - Intronic
1119483482 14:74974167-74974189 GAAACCTGGGTGCTCCTGTGGGG - Intergenic
1120847006 14:89134916-89134938 GAAACTGGGGTGCTGATTTCTGG + Intronic
1122236861 14:100335756-100335778 TTTACTTTGCTGCTGCTTTGTGG - Intronic
1123063459 14:105604914-105604936 GAAGCTTGGTTGATGCTGTGAGG + Intergenic
1123087520 14:105723700-105723722 GAAGCTTGGTTGATGCTGTGAGG + Intergenic
1123701339 15:22916789-22916811 GCCACGTTGCTGCTGCTTTGGGG + Intronic
1123828645 15:24109168-24109190 GAAACTTCGCTGTTGTTATGTGG + Intergenic
1128344589 15:66845455-66845477 GAAACATGCCTGGTGTTTTGGGG + Intergenic
1129776971 15:78243343-78243365 GAAACTGGGCTTCTGCGATGTGG - Intronic
1131344868 15:91637110-91637132 AAATCTTTGCTCCTGCTTTGTGG + Intergenic
1133922055 16:10162199-10162221 GACACTAGGCTCCTGCTTTGAGG - Intronic
1134377331 16:13689417-13689439 GAAGCTTGGCTTCTCCCTTGGGG - Intergenic
1134878644 16:17725044-17725066 CAAACTTGGCTGCTGATTCTGGG + Intergenic
1135672463 16:24387071-24387093 TATACTTGGATGCTGCTGTGGGG - Intergenic
1137365553 16:47856383-47856405 GATGACTGGCTGCTGCTTTGGGG - Intergenic
1137717675 16:50608638-50608660 GAAACTCTGCTGCTCCTCTGGGG + Intronic
1138902936 16:61296529-61296551 CACACTTGGATGCTGCTCTGGGG - Intergenic
1139518342 16:67465022-67465044 TAGGCTAGGCTGCTGCTTTGTGG - Intronic
1139921131 16:70461313-70461335 GAAATGGGGGTGCTGCTTTGTGG + Intronic
1140256370 16:73339989-73340011 CAAATGTGGCTGCTGCTTTCTGG - Intergenic
1144150605 17:12439725-12439747 GAAACGTGGCTGCTTATATGCGG + Intergenic
1147583500 17:41639484-41639506 GAGACATGGCTGCTACCTTGAGG - Intergenic
1151171451 17:72249652-72249674 GAAACTTGGCAGCTGGCCTGGGG + Intergenic
1151808644 17:76422656-76422678 GAAACTTGGGTGCAGCTATCTGG - Intronic
1157175078 18:45444258-45444280 GAAGCTCTGCTCCTGCTTTGTGG + Intronic
1161813131 19:6481999-6482021 GAATCTTGGCTGCTGCGGAGCGG - Intronic
1166940329 19:46359460-46359482 GAAACCCAGCTTCTGCTTTGGGG + Intronic
1167284380 19:48590756-48590778 GAAACGTGGCTGCTGGTGTGAGG - Intronic
925260941 2:2528086-2528108 GAAAAATGGCTGCTTCTCTGTGG + Intergenic
926680586 2:15660863-15660885 CAGACATGGCTGCTGCTTTTTGG - Intergenic
927580743 2:24244192-24244214 GAAACTATGCTGCTTCTTTTTGG + Intronic
927894278 2:26771407-26771429 GAAACTTGGCTCCTGGCCTGGGG + Intronic
927903904 2:26843769-26843791 TAAATTTGGCTCCTGCTTTGTGG + Intergenic
928689215 2:33781847-33781869 CAACCTTGGCTCCTGCTTTAGGG + Intergenic
932118320 2:69074647-69074669 GAAATTTCCCTGCTGCTTTTAGG - Intronic
936254490 2:110900013-110900035 GAAAATTGGCTGGTGTTTTGGGG + Intronic
938899701 2:135789643-135789665 AGAACTTCGCTGATGCTTTGGGG + Exonic
939553322 2:143642840-143642862 GAGACCAGGCTGCTGTTTTGTGG + Intronic
939727506 2:145741108-145741130 AAATCTTGGCTTCTGGTTTGAGG + Intergenic
940965517 2:159832996-159833018 TAAGCTTAGCTGCTGCCTTGTGG + Intronic
942214776 2:173707944-173707966 GAATCTTGGCTGCTCCTTTGTGG + Intergenic
942249097 2:174032713-174032735 GAAACCTCGCTGCTGCTTATGGG - Intergenic
944210633 2:197202911-197202933 GAAATTTGGCTGATGTTTTTTGG + Intronic
948803782 2:240444349-240444371 GAAACTTGGCTGGGGCTTCCGGG + Intronic
1168876622 20:1176363-1176385 GAAACTTGATTGTTGCTGTGAGG + Intronic
1169269237 20:4186753-4186775 GTGACCAGGCTGCTGCTTTGTGG - Intronic
1171964054 20:31515907-31515929 CAAAAGTGGCAGCTGCTTTGTGG - Intronic
1172111432 20:32547653-32547675 GCAACTTGGGTGCTTCCTTGGGG - Intronic
1172308926 20:33901996-33902018 GAAACTTGGTTGGAGGTTTGGGG - Intergenic
1173134893 20:40431030-40431052 GTAACTTGGCTCCAGCTTTTGGG + Intergenic
1173799982 20:45889048-45889070 TAAACAGGGCTGCAGCTTTGTGG - Intronic
1175584593 20:60127895-60127917 GAAACGTGGCTGCTGCCCTAGGG - Intergenic
1176170998 20:63696370-63696392 GCAGCTTGGCTGCGGCTGTGAGG - Intronic
1178957769 21:37039079-37039101 GACACTTGTCTGCTGCTTTCTGG + Intergenic
1180648375 22:17358594-17358616 GAAAGGAGGCTGCTGCTTTCTGG - Intergenic
1182722440 22:32414363-32414385 GAAACTTGGCTGCTGCTTTGAGG + Exonic
1184685043 22:46092642-46092664 GCAACTTTGCTGCTGCTTTTGGG + Intronic
950499560 3:13354990-13355012 GACACTTGGCCTCTGCTTTATGG - Intronic
950774510 3:15337941-15337963 TTGACTTGGCTGCTGCTTTGGGG - Intronic
951197133 3:19836656-19836678 GGAACATGGCTGCAACTTTGAGG + Intergenic
951449744 3:22823702-22823724 AAAACTAGGCTCCTGCTTTGAGG + Intergenic
952625193 3:35394442-35394464 TAAACCTTGCTCCTGCTTTGTGG - Intergenic
953143976 3:40256082-40256104 GAAATGTGGCTACTGCATTGAGG + Intronic
954510669 3:51122042-51122064 GAAACTTGCCTGTTGTTTTTTGG - Intronic
955011850 3:55025296-55025318 GAAACTGTGCTGGTGCTTTGGGG + Intronic
956280561 3:67551635-67551657 GAAGCTTGGCTGGCGTTTTGTGG + Intronic
957167940 3:76699204-76699226 GCACCATGGCTGCTGCTTAGAGG - Intronic
961622884 3:128238773-128238795 GAATTGTGGCTGCTGCTTTTGGG + Intronic
962437757 3:135382407-135382429 AACCCTTGGATGCTGCTTTGTGG - Intergenic
962575633 3:136752558-136752580 GAAACGTGGCCGCTGCGTGGCGG + Intergenic
966413938 3:179670062-179670084 AAGGCTTGGCTACTGCTTTGAGG - Intronic
969270068 4:6093779-6093801 CAAACCTGGCTCCTTCTTTGAGG - Intronic
971042139 4:22765444-22765466 GAAACATGGTAGCTCCTTTGGGG + Intergenic
972444718 4:39132234-39132256 GAATCTGGGCTGCAGCTTTCCGG - Intergenic
974373422 4:61045856-61045878 GAAATATGGCTGCTTCTTTGTGG + Intergenic
975213857 4:71731354-71731376 CACACTTGGATGCTGCTGTGGGG + Intergenic
975881200 4:78909801-78909823 GAAACATGGTTTCTGCTTTCAGG - Intronic
976285546 4:83367339-83367361 GAACCTTGACTGATGCTTTGCGG + Intergenic
979889852 4:126077508-126077530 GGAACATGGCTGCTCCTTGGGGG + Intergenic
984535069 4:180964031-180964053 GAAACCTCTCTGCTGCTTCGTGG + Intergenic
984652998 4:182289500-182289522 CAAACTGGGCTGCTACGTTGGGG - Intronic
986603478 5:9497861-9497883 GACTCTTGGCTACTGCTTAGAGG + Intronic
987504931 5:18755637-18755659 CAAGCTTTGCTGCTGCTTTTTGG - Intergenic
987598390 5:20032023-20032045 GAAACATGGCTTCTGCTGTGTGG - Intronic
990417531 5:55600426-55600448 GAGGCTTGGATGCTGCTTTATGG - Intergenic
992228586 5:74641529-74641551 GCGGCGTGGCTGCTGCTTTGAGG - Intronic
997102390 5:130982940-130982962 AAAAATAAGCTGCTGCTTTGTGG + Intergenic
1000752085 5:165109120-165109142 GAATCTTGAATGCTGCTTTTTGG + Intergenic
1000987719 5:167879156-167879178 GAAGCTTTGTTGTTGCTTTGAGG - Intronic
1003508345 6:6758712-6758734 GGAACTTGGCTGCTGCTTGCAGG - Intergenic
1003551550 6:7106627-7106649 GAAACATGTCAGCTGCTTTATGG + Intergenic
1009618861 6:66045841-66045863 AAAGCTTGGCTGCATCTTTGTGG + Intergenic
1010743219 6:79531606-79531628 GAAACTTGGCTGATGGATTTGGG - Intronic
1013090512 6:106896314-106896336 GAAACTTGGTTGGGGATTTGGGG + Intergenic
1013338145 6:109186332-109186354 GAATCCTGGCTGCAGCCTTGTGG - Intergenic
1015031084 6:128596743-128596765 GTAACTTGGGTGGTGCTTTTGGG - Intergenic
1018713626 6:166515014-166515036 CACCCTTGGCTGCTGCTGTGGGG - Intronic
1022838791 7:34142888-34142910 GAAACTTGGTTCCTCCATTGTGG + Intronic
1024864696 7:53891881-53891903 AGAACCAGGCTGCTGCTTTGTGG + Intergenic
1026584675 7:71646724-71646746 GAAACTTGGATGCCCCTTTTGGG - Intronic
1028970531 7:96853649-96853671 TAAACTGGCTTGCTGCTTTGTGG + Intergenic
1029280900 7:99434915-99434937 GGAACTGGGCTGCGGATTTGCGG + Exonic
1029302917 7:99598778-99598800 GAAAGTCGGCAGCTGCTCTGGGG - Intronic
1030646157 7:112064138-112064160 GAGACATGGCAGCAGCTTTGTGG + Intronic
1034692775 7:153027320-153027342 GACACTTGGCAGCTGCTGAGTGG - Intergenic
1036920599 8:12850823-12850845 GATACTTTGCTGCTGCTGTGTGG - Intergenic
1037560935 8:20073743-20073765 GAAAATTTGCTGTTGCATTGTGG + Intergenic
1038686883 8:29727104-29727126 GACAGGTGGCTGCTGCTCTGGGG + Intergenic
1040736477 8:50514290-50514312 AAAATTTGGTTGCTGATTTGAGG + Intronic
1042076769 8:65004499-65004521 GAAACTTGTCTGCTGCTTCTTGG + Intergenic
1043942952 8:86216425-86216447 AAGACTTGGCTCCTGCTTTTAGG - Intronic
1045187448 8:99853526-99853548 GAAGCTCAGCTGATGCTTTGTGG - Exonic
1045218738 8:100176142-100176164 GAAACTTGTCTGCTGCCTTTTGG + Intronic
1045573787 8:103396979-103397001 GAGACATGGCTACTGCTTAGGGG - Intergenic
1046031169 8:108785465-108785487 GAAACTTGCCTTCTCGTTTGAGG - Intronic
1048289802 8:133172068-133172090 GTCACTTGGCTGCTAGTTTGAGG - Intergenic
1048328715 8:133457899-133457921 AAAAGGTCGCTGCTGCTTTGAGG - Exonic
1048398520 8:134039489-134039511 GAAACATGGCTGCAACTATGAGG - Intergenic
1048952353 8:139506857-139506879 GAAACTTGGCTGCTACTCTAGGG - Intergenic
1053512317 9:38698857-38698879 GACACTTTGCTGCTCCTTTTTGG + Intergenic
1056100643 9:83297782-83297804 GAAAATTTGTTCCTGCTTTGGGG - Intronic
1056139989 9:83666957-83666979 GCAAGTTGGTTGCTGTTTTGCGG - Intronic
1056544723 9:87604151-87604173 GACAGTTGGCAGCGGCTTTGAGG + Intronic
1057954233 9:99395192-99395214 GCAACTTGGCTGCTGAATTAGGG - Intergenic
1061689708 9:132316633-132316655 GAAACTGGCCTGCTTCATTGGGG - Intronic
1186071387 X:5825272-5825294 GAAACTTGCCTGCTGTGTTATGG - Intergenic
1186299622 X:8185641-8185663 AAAACTTGGTTTCTGCTGTGTGG - Intergenic
1186846357 X:13534663-13534685 GAGCCTTGGCAGCTGGTTTGAGG - Intergenic
1187556252 X:20354962-20354984 GAACCTAGGCTGCTGATCTGAGG - Intergenic
1188247426 X:27853290-27853312 AAAACTGGGATGCTGTTTTGTGG + Intergenic
1188590214 X:31824168-31824190 GAAAGTTTGTTGCTGCATTGTGG + Intronic
1192696548 X:73422222-73422244 GAAACATGGCTGCAACTGTGAGG - Intergenic
1193919432 X:87407152-87407174 GACACCTGGCTGCTGCTGTTGGG + Intergenic
1197752409 X:129974534-129974556 GGAAGTTGGCTGCTCCTCTGGGG - Intergenic
1199943255 X:152645189-152645211 GAATCTTGGCTCCTGCTTTGGGG + Intronic
1201452245 Y:14129143-14129165 TAACCTTGGCAGCTGCCTTGTGG + Intergenic