ID: 1182724663

View in Genome Browser
Species Human (GRCh38)
Location 22:32434626-32434648
Sequence CTCAGTAATCCCTAAAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182724663_1182724665 -6 Left 1182724663 22:32434626-32434648 CCTCACTTTTAGGGATTACTGAG 0: 1
1: 0
2: 1
3: 7
4: 89
Right 1182724665 22:32434643-32434665 ACTGAGATACTGGATGCTTAAGG 0: 1
1: 0
2: 1
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182724663 Original CRISPR CTCAGTAATCCCTAAAAGTG AGG (reversed) Intronic
908826411 1:68136823-68136845 CTGAGTACTTCCTAAAGGTGAGG + Intronic
909429303 1:75568526-75568548 CTGAGAAATCTCTCAAAGTGGGG - Intronic
912402140 1:109403222-109403244 CTCAGTATTGCCCAAAACTGTGG - Intronic
916175651 1:162036077-162036099 CTCAGTAATCCCCAAACTTTAGG - Intergenic
924633642 1:245764982-245765004 CTCAGTATTCTCTAAGAGTAGGG - Intronic
1064957676 10:20929442-20929464 CTCAGCAATCCCTAACTTTGAGG + Intronic
1064958015 10:20932825-20932847 CTCAGCAATCCCTAACTTTGGGG + Intronic
1066533488 10:36365596-36365618 CTAAGAAATGCCTAAAAATGTGG + Intergenic
1068583516 10:58770427-58770449 CTTAATACTCCTTAAAAGTGAGG + Intronic
1069970487 10:72163783-72163805 CTCATGAATCCCTAAAATTGAGG + Intronic
1075936027 10:126342097-126342119 CACAGTCATCCCTGCAAGTGGGG - Intronic
1079409505 11:20174183-20174205 CACAGTACTCCCTAAAATAGAGG - Intergenic
1079504216 11:21135088-21135110 CACAGTATTGCTTAAAAGTGGGG + Intronic
1080591110 11:33723732-33723754 CTCAGAAACCCCTGAAAATGGGG - Intronic
1081351759 11:42062400-42062422 CTCAGTAATCACAAAAATTCTGG + Intergenic
1082208305 11:49466195-49466217 AGCAGTGATTCCTAAAAGTGTGG - Intergenic
1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG + Intronic
1086641225 11:89158463-89158485 AGCAGTGATTCCTAAAAGTGTGG + Intergenic
1098505867 12:71249875-71249897 CTGGGTAATCCTTAAAAGTATGG - Intronic
1101249539 12:102918202-102918224 CTCAGTCTTCTCTAAAAGTGTGG - Intronic
1102715301 12:114966022-114966044 TTGAGTAATACCTGAAAGTGGGG + Intergenic
1105904366 13:24791318-24791340 CTCAGTAATGCTTGAACGTGAGG + Intronic
1108868284 13:54948588-54948610 CACAGTAATCCCTAATTGTATGG + Intergenic
1109601175 13:64630418-64630440 CTCAATGATCACTGAAAGTGAGG + Intergenic
1112150359 13:96753792-96753814 CAATGTAATCCCTAAAAGTAAGG - Intronic
1112283138 13:98080264-98080286 CTAAATAATTCCTAATAGTGAGG - Intergenic
1117388383 14:55239298-55239320 CTCAGTAAGACCTAAAGGGGTGG - Intergenic
1119201822 14:72758729-72758751 CTAAGTATTCCCTATTAGTGAGG - Intronic
1119438926 14:74615386-74615408 CACAGTAATCCCATCAAGTGGGG + Intergenic
1122546198 14:102524194-102524216 CTCAGGGAGCCCTGAAAGTGAGG - Intergenic
1122765683 14:104067945-104067967 CACAGTAATCCCTAATGTTGGGG - Intergenic
1124919104 15:34007627-34007649 CTAACCAATACCTAAAAGTGTGG - Intronic
1125167955 15:36731762-36731784 CTAAATGATCCCTAAAAATGGGG + Intronic
1131711800 15:95063598-95063620 CTAAGTATTCCATAAAACTGGGG + Intergenic
1156965938 18:43092244-43092266 CTCTGTAATCTCCAAAAGAGAGG + Intronic
1163283762 19:16333256-16333278 CTCATGAATCAATAAAAGTGTGG + Intergenic
933678944 2:85081600-85081622 CTAACTAACACCTAAAAGTGTGG - Intergenic
945016159 2:205519204-205519226 ATCAGTTATCCCTGAAAGGGAGG - Intronic
946218961 2:218210112-218210134 AACAGTAATCCCTGAAACTGGGG - Intergenic
946579202 2:221108032-221108054 CTCAGTAACCACTAAAAGATAGG + Intergenic
1169033717 20:2432833-2432855 CTCAGTAATCCTTAAACTTTTGG + Intergenic
1169983630 20:11416343-11416365 CTAAGTATTCCATAAAAATGTGG + Intergenic
1172134737 20:32679349-32679371 CTCAGTGATACCTAAGAGGGAGG - Intergenic
1174245032 20:49172822-49172844 CTCAGTGATTGCTACAAGTGAGG - Intronic
1178200092 21:30393802-30393824 CAAAGTAATTACTAAAAGTGAGG + Intronic
1178590569 21:33906028-33906050 ATCAGTTATCCCTAACAGTGTGG - Intronic
1179242423 21:39603886-39603908 CTAAGTCAGCCCAAAAAGTGGGG + Intronic
1180188239 21:46150897-46150919 CTCAGTCACCCCGACAAGTGCGG - Intronic
1181994589 22:26866164-26866186 CTCAGTAGACCATAAATGTGTGG + Intergenic
1182054140 22:27336560-27336582 ATCAGAAATCCCTAACCGTGCGG + Intergenic
1182724663 22:32434626-32434648 CTCAGTAATCCCTAAAAGTGAGG - Intronic
1183717697 22:39543499-39543521 CTCAGTAATTCCCAAGAGGGAGG - Intergenic
950801268 3:15553516-15553538 CTCAGTAACTCCTAATAGGGAGG + Intergenic
953760609 3:45683975-45683997 TTCAGGAATCCCTGAAAGTGGGG + Exonic
955792772 3:62605767-62605789 CTCAATAAATCCTAAAAGTGTGG + Intronic
956661946 3:71607709-71607731 CTCATTAATTGCTAGAAGTGGGG + Intergenic
958983376 3:100751831-100751853 ATCACTAATCCCTGAAAGGGAGG - Intronic
963771201 3:149388144-149388166 CTGAGTAATCCCTGAATGTCAGG + Intergenic
972140089 4:35947510-35947532 ATAATTAATCTCTAAAAGTGTGG + Intergenic
980594911 4:134941771-134941793 GTCAGCAAGCACTAAAAGTGGGG + Intergenic
981775411 4:148361741-148361763 CTCAGTAACCATTAAAAGTAAGG - Intronic
984369764 4:178847792-178847814 CTGATTAATCCCTAAAACTTTGG + Intergenic
985583585 5:713847-713869 ATCAGTAATCTCTTAAAGTAAGG - Intronic
985597098 5:798144-798166 ATCAGTAATCTCTTAAAGTAAGG - Intronic
989194799 5:38706387-38706409 CTCAGGAGTCACTAAAAGAGAGG + Intergenic
991004669 5:61815984-61816006 CTAGGTAATCCCTAAAAGAATGG + Intergenic
993034343 5:82740558-82740580 CTCTGTAAGCCCTTAAAGAGTGG - Intergenic
996771382 5:127089601-127089623 CTCAGTAATCAGTGAAAGAGTGG + Intergenic
999109306 5:149104159-149104181 CTCGCTTCTCCCTAAAAGTGGGG + Intergenic
999487728 5:152015868-152015890 CTGAGGGATCCCTGAAAGTGTGG - Intergenic
1001169873 5:169409125-169409147 CTCAATAAAATCTAAAAGTGTGG - Intergenic
1003286871 6:4742108-4742130 CTGAGTAATCCCAAAATGTTGGG - Intronic
1003935680 6:10972976-10972998 CACAGCACTCCCCAAAAGTGGGG + Intronic
1009297423 6:61970531-61970553 CTCAGTAATCTCTAAATGCTAGG - Intronic
1011732398 6:90278677-90278699 AGCAGTAATCTCTAAAAGTAGGG + Intronic
1011765900 6:90619346-90619368 CTTAGTAATACCAGAAAGTGGGG - Intergenic
1016475781 6:144426050-144426072 CACAGTAATGTATAAAAGTGAGG + Intronic
1017058512 6:150459353-150459375 CTCAGGAAGCCGTAAAAGTGAGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1023355533 7:39363607-39363629 CTCAGAAATCCTTAAAGTTGGGG - Intronic
1028413793 7:90558568-90558590 CTCAGACATCCCAAGAAGTGAGG + Intronic
1033831094 7:145254248-145254270 CTTAGTCATCCCTTAATGTGTGG + Intergenic
1042117626 8:65449434-65449456 CTCATTAATCCCCCCAAGTGGGG - Intergenic
1042336829 8:67638698-67638720 TTCAGTAATGCCTCAAATTGAGG - Intronic
1042488259 8:69370421-69370443 CTCAGAAACACCTAAAAGGGTGG - Intergenic
1045069582 8:98487786-98487808 CTCAGTAATCACTATAGTTGGGG + Intronic
1046092771 8:109522802-109522824 CTGAGTGATCACTAAGAGTGAGG - Exonic
1047839394 8:128733995-128734017 CTCAATAAGCCCTAAAAGAATGG - Intergenic
1048805839 8:138240552-138240574 CTCAGTGCTCAATAAAAGTGTGG - Intronic
1049494773 8:142924528-142924550 CACAGGAGTCCCTGAAAGTGGGG - Intergenic
1050214850 9:3311511-3311533 CTCTATAATCACTAAAATTGCGG + Intronic
1052811667 9:33066380-33066402 CTCAGTACTCCCACAAAATGAGG + Intronic
1058999519 9:110334131-110334153 CCCAGTAATTCTTAAAAGTTTGG - Intronic
1193332746 X:80253863-80253885 CTCATTATTCCCTACAAGTGAGG - Intergenic
1196424513 X:115556237-115556259 CTCAGTAATTTTTACAAGTGAGG - Intergenic
1199822321 X:151461781-151461803 CTCAGTACTCACCAACAGTGTGG + Intergenic
1201351834 Y:13052486-13052508 TTCAGTAATCCCTAAAAGTTCGG - Intergenic