ID: 1182727623

View in Genome Browser
Species Human (GRCh38)
Location 22:32460543-32460565
Sequence TGGATGGTGGGGTATAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 380}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182727623_1182727631 -5 Left 1182727623 22:32460543-32460565 CCCCCTCTATACCCCACCATCCA 0: 1
1: 1
2: 2
3: 32
4: 380
Right 1182727631 22:32460561-32460583 ATCCAGCCAAACTGAACTACTGG 0: 1
1: 0
2: 2
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182727623 Original CRISPR TGGATGGTGGGGTATAGAGG GGG (reversed) Intronic
900822573 1:4900558-4900580 TGGATGCTGAGGGATACAGGAGG - Intergenic
901855099 1:12039456-12039478 ACAATGGTGGGGGATAGAGGAGG - Intergenic
902655007 1:17860918-17860940 TGGATGGATGGGTGGAGAGGTGG - Intergenic
902779092 1:18693037-18693059 TGGAGGGTTGGGGATGGAGGAGG + Intronic
903341707 1:22658916-22658938 GGGATGGAGGGGTAGAGAGATGG + Intronic
903419694 1:23209781-23209803 TGGATGGTGGAGCATGGAGTCGG - Intergenic
904108373 1:28105448-28105470 GGGAGGGTGGGGTATAGGGGTGG - Intergenic
904468273 1:30720580-30720602 TAGAGAGTGGGGTATGGAGGAGG + Intronic
906231131 1:44165467-44165489 TGGATGGTGGGGGAAAAAGAGGG - Intergenic
906295004 1:44644297-44644319 TGGATAATGGGGCATAGGGGAGG + Intronic
906383411 1:45347132-45347154 TAGATGGTGGGGTGCAGGGGAGG - Intronic
908807292 1:67944746-67944768 TGGAAGTTGGGGGAGAGAGGTGG + Intergenic
910662202 1:89685885-89685907 TTGATGGTGGTGGATTGAGGAGG - Intronic
911096790 1:94061659-94061681 TGGCTGGTGGGGAAGTGAGGTGG - Intronic
912327082 1:108776590-108776612 TAGATGGTATGGTTTAGAGGGGG + Intronic
914992347 1:152509932-152509954 TGGATGGAGAGGTGAAGAGGAGG - Intergenic
915666769 1:157452065-157452087 TGTGTGGTGGGGGGTAGAGGGGG + Intergenic
916482394 1:165226316-165226338 TAGATGATGGGGAATAGAGGTGG - Intronic
916487541 1:165272788-165272810 TTGATGGTGTGGTTTAGTGGGGG + Intronic
916811230 1:168307379-168307401 TGGATGGTGGGGGAAAGAGGGGG + Intronic
917278434 1:173355760-173355782 TGCATGCTGGGGTACAGATGAGG + Intergenic
917591426 1:176480519-176480541 TAGGTGGTGGGGCATGGAGGCGG + Intronic
918427290 1:184423762-184423784 TGGATGGTTGGCTGGAGAGGAGG - Intronic
919139232 1:193549823-193549845 TGGAAGGTGGAGGATGGAGGAGG - Intergenic
920098243 1:203500231-203500253 TGGGTGGTGGTGTGTGGAGGTGG - Intronic
920098249 1:203500251-203500273 TGGGTGGTGGTGTGTGGAGGTGG - Intronic
920600558 1:207320513-207320535 TGGAGGGTGGGGGTTAGGGGAGG + Intergenic
922334733 1:224609460-224609482 TGGATGGGGGTGTTGAGAGGTGG + Intronic
922460489 1:225811326-225811348 TGGGAGGTGGGCTATGGAGGGGG - Intronic
922569340 1:226624593-226624615 TGGGTGGTGGGGGATGGGGGTGG + Intergenic
924083444 1:240423250-240423272 TGGAGGGTGGGGGAAGGAGGTGG + Intronic
924560282 1:245153281-245153303 GGGAAGGTGGGGTGTCGAGGGGG - Intergenic
1062905734 10:1178420-1178442 AGGATGGTGGGGAAGTGAGGAGG - Exonic
1063927467 10:10994728-10994750 TGGAGGGTGGGGTGTGGGGGTGG - Intergenic
1064133651 10:12731906-12731928 TGGACGATGGGGTAGGGAGGAGG + Intronic
1064860130 10:19817047-19817069 TGGCGGGTGGGGTAGGGAGGTGG + Exonic
1067342400 10:45416587-45416609 AGGATGGTGAGGTAGTGAGGTGG + Intronic
1069590417 10:69638204-69638226 TGGATGGATGGGGACAGAGGAGG - Intergenic
1069705934 10:70459037-70459059 CGGATGGCGGGGGATAAAGGTGG - Intergenic
1070163684 10:73881828-73881850 AGGATGTTGGTGGATAGAGGTGG + Intergenic
1075283575 10:121162728-121162750 TGGATGGTGGGGTGGGGATGAGG - Intergenic
1075454843 10:122578450-122578472 TGGATGGTGGGGGATGGGGGTGG + Intronic
1075629656 10:123993353-123993375 TGGAGGGTGGGGTCTAGGGGAGG + Intergenic
1076464464 10:130669030-130669052 TGGGTAGTGGGGTTTAGATGGGG - Intergenic
1076867369 10:133174683-133174705 TGGATGGGTGGGTAGATAGGTGG + Intronic
1076931881 10:133536913-133536935 TGGATGGAGGGGTGTATAGATGG + Intronic
1078362842 11:10682842-10682864 AGGATTGTGGGGTATAAATGTGG - Intronic
1078663962 11:13309281-13309303 TGGATGGTAGGGTCTATCGGGGG + Intronic
1080519967 11:33060246-33060268 TGGAAGCTGGGGCATAGTGGAGG + Intronic
1081540589 11:44031830-44031852 TGGATGGTGGCGGATGCAGGTGG + Intergenic
1082078391 11:47992967-47992989 TGCCTGGTGGGGGATGGAGGTGG + Intronic
1082649307 11:55768889-55768911 TGCAGGGTGGGGTCTAGGGGAGG - Intergenic
1082934548 11:58642796-58642818 TGTATGTTGGGGTAGAGATGAGG - Intronic
1083288069 11:61673855-61673877 TGGATGGACGGGTTGAGAGGTGG + Intergenic
1084307974 11:68299071-68299093 TGGTTGGTGGAGTGTGGAGGGGG - Intergenic
1084980641 11:72826843-72826865 TGGCTGGTGGGGAGGAGAGGTGG - Intronic
1086533580 11:87815362-87815384 TGTGGGGTGGGGTATTGAGGGGG + Intergenic
1088519091 11:110675480-110675502 TGGATGGTGGGGAGTTGTGGAGG + Intronic
1090033253 11:123225742-123225764 TGGATGGTGGTGGCTGGAGGTGG + Intergenic
1090498963 11:127243079-127243101 TGGAGGGAGTGGTATAAAGGAGG + Intergenic
1091304797 11:134530369-134530391 AGGAGGGTGGGGAACAGAGGAGG - Intergenic
1091573958 12:1715073-1715095 TGGGTGGTGGAGATTAGAGGAGG + Intronic
1092064674 12:5579925-5579947 AGGGTGGTGGGGTCCAGAGGAGG - Intronic
1092183965 12:6464851-6464873 TTGCTGGTGGGGTGAAGAGGTGG - Intronic
1093947146 12:25122097-25122119 GTAATGGTGGGGTATAGGGGAGG + Intronic
1094392181 12:29963647-29963669 TGGATGGTGGGGTTGTGGGGAGG + Intergenic
1095609036 12:44105712-44105734 TGGGTGGAGGGGTCTAGAGTTGG + Intronic
1097153096 12:56994103-56994125 TGGATGTGGGGGTATAGGGGAGG - Intergenic
1098696724 12:73567694-73567716 TGGAAGGTGGGGTAGTAAGGGGG - Intergenic
1100120807 12:91367361-91367383 AGCATGGGTGGGTATAGAGGTGG - Intergenic
1100432203 12:94540931-94540953 TAGTTGGTGGGGTATAGATATGG - Intergenic
1100887329 12:99085859-99085881 TGGAGGGTGGAGGATGGAGGAGG + Intronic
1100980142 12:100157115-100157137 TGGAGGGTGGAGGGTAGAGGGGG - Intergenic
1101001772 12:100364101-100364123 TGGATGGTGTGGTATATGGTGGG + Intronic
1101062891 12:100989837-100989859 TGGATGGTTGGGTATACACATGG + Intronic
1103004401 12:117409523-117409545 TGGATGGAGGGGTGGAGGGGTGG + Intronic
1104092447 12:125527432-125527454 TGGATGGAAGGGTAAATAGGTGG - Intronic
1104254109 12:127124076-127124098 TAGAGGGTGGGGGATGGAGGGGG + Intergenic
1104254127 12:127124115-127124137 TAGAGGGTGGGGGATGGAGGGGG + Intergenic
1104254174 12:127124235-127124257 TAGAGGGTGGGGGATAGAGGGGG + Intergenic
1104254211 12:127124317-127124339 TAGAGGGTGGGGGATGGAGGGGG + Intergenic
1104254281 12:127124492-127124514 TAGAGGGTGGGGGATAGAGGGGG + Intergenic
1104254517 12:127125072-127125094 TAGAGGGTGGGGGATGGAGGGGG + Intergenic
1104254564 12:127125194-127125216 TAGAGGGTGGGGGATAGAGGGGG + Intergenic
1104773957 12:131381656-131381678 TGGATGGTGGAGTATAGGGAGGG - Intergenic
1106168476 13:27269717-27269739 TGCATGGTGGGGTCTAGGGTGGG - Intergenic
1106455097 13:29919871-29919893 TTGGGGGTGGGGGATAGAGGAGG + Intergenic
1106849951 13:33779561-33779583 TGGATCGTGGGGAGTAGGGGAGG + Intergenic
1107405190 13:40105809-40105831 TTGATGGGGTGGAATAGAGGAGG - Intergenic
1107800693 13:44105544-44105566 TTGATGGTGGGTTATGGAGAAGG - Intergenic
1107990213 13:45813006-45813028 TGGATGGTAGGGAAGTGAGGGGG + Intronic
1107992610 13:45831685-45831707 TGGATAATGGGGTAAAGAGGAGG + Intronic
1108821682 13:54358306-54358328 AGGAGGGTGGGGCAGAGAGGAGG + Intergenic
1108845171 13:54669590-54669612 TGGATGGTGGGGTGTGGGGAGGG - Intergenic
1109094477 13:58095901-58095923 TGTATGGTGGGAGATAAAGGGGG - Intergenic
1109175990 13:59156284-59156306 TGGAGGGTGGAGGGTAGAGGAGG + Intergenic
1109208901 13:59512313-59512335 TTGAAGGTGGGGTAAAGGGGAGG - Intergenic
1109902258 13:68790110-68790132 TGGGGGGTGGGGTCTAGGGGAGG - Intergenic
1111011707 13:82323568-82323590 TGGAAGGTTGAGTATAGAAGGGG + Intergenic
1111409265 13:87853316-87853338 GGGGTGGGGGGGTCTAGAGGAGG + Intergenic
1112919878 13:104599187-104599209 AGAATGGTTGGGTATAGAAGAGG + Intergenic
1113297184 13:108972020-108972042 TGGGGGGTGGGGTAGAGATGGGG - Intronic
1113340285 13:109416284-109416306 TGGATGGGCGGGTGAAGAGGAGG - Intergenic
1114512779 14:23276304-23276326 TGGCTGGAGGGGTTTAGAGGCGG + Exonic
1117008645 14:51447786-51447808 TGGATGGTGGTGTTGAGGGGTGG - Intergenic
1118249796 14:64148521-64148543 TGGATGGTGGGGGCGAGGGGAGG - Intronic
1119286700 14:73460681-73460703 TGGAAGGTGAGGAAGAGAGGAGG - Intronic
1119388853 14:74276580-74276602 TGGAGTTTGGGGTATAGAAGTGG + Intergenic
1119760732 14:77149063-77149085 TGGATGGTGAGGGCTGGAGGTGG + Intronic
1121410592 14:93746030-93746052 TGGAGGGTGGGGGATATAGGAGG - Intronic
1122387780 14:101360844-101360866 TACATGGTGGGGGATGGAGGGGG - Intergenic
1124087375 15:26563467-26563489 TGGATGGTGGTGTGTTGTGGTGG + Intronic
1125611927 15:40977224-40977246 TAGATGGTGGGGTAGGGAGAAGG - Intergenic
1125845751 15:42851590-42851612 TGGAAGGTGGGTAATGGAGGGGG + Intronic
1126439220 15:48669751-48669773 TTGATGGTGGGATATGGAGTGGG + Intergenic
1127324330 15:57880766-57880788 TGAATGGTGGGAGACAGAGGTGG - Intergenic
1127398512 15:58562806-58562828 TGGATGGTGGGGTTGGGGGGGGG - Intronic
1127552743 15:60057306-60057328 GGGATGGTGGTGTCTAGCGGAGG - Intronic
1128616399 15:69113985-69114007 TGGATTGTGGGGTAGAGGTGAGG - Intergenic
1128784634 15:70385722-70385744 TGCATGGAGCGCTATAGAGGAGG + Intergenic
1129073971 15:72975779-72975801 TGCAAGGAGGGGTATAGAGATGG + Intergenic
1129711435 15:77822206-77822228 TGGATGGTGGGAAATGGATGGGG - Intergenic
1132351449 15:101142046-101142068 TGAATGGTGGGGTGGACAGGTGG - Intergenic
1133640946 16:7716825-7716847 TAGATGGTGGGGTATCAAGAGGG + Intergenic
1133832186 16:9333365-9333387 TGGATGGTGGTGATAAGAGGAGG + Intergenic
1134006938 16:10824273-10824295 TGGAAGGTTGGGCATAGCGGTGG + Intergenic
1135420500 16:22302757-22302779 TGGCTGATGGGGTATAGGGTTGG + Intronic
1135623869 16:23978673-23978695 TAGATGGTGGGGTATACTGTGGG + Intronic
1136683567 16:31981602-31981624 TTGATGCTGGTGTTTAGAGGGGG + Intergenic
1136784198 16:32925162-32925184 TTGATGCTGGTGTTTAGAGGGGG + Intergenic
1136885586 16:33928644-33928666 TTGATGCTGGTGTTTAGAGGGGG - Intergenic
1138121583 16:54404634-54404656 TGGTTGCTGGGATAGAGAGGAGG - Intergenic
1138142795 16:54582998-54583020 TGGATGGTGTGGCATCCAGGAGG - Intergenic
1138197042 16:55059456-55059478 TGGTTGGTGGGGAAGAGAAGGGG + Intergenic
1138717828 16:59044513-59044535 GGGAGGGTGGACTATAGAGGGGG + Intergenic
1139487720 16:67267911-67267933 TGGAGGGTGGGGCATAGGTGAGG - Intronic
1139995683 16:70978179-70978201 TGGATGACGGGGTAAGGAGGGGG - Intronic
1140778872 16:78275666-78275688 TGGATGGTGGAGAAGGGAGGAGG + Intronic
1140873446 16:79128076-79128098 TGGGTGGTGGGGGATGGAGAAGG - Intronic
1141226481 16:82120969-82120991 TGTGTGGTGGGGTGTTGAGGGGG + Intergenic
1141577593 16:84974412-84974434 TGGATGGTGGTGTTTTCAGGGGG - Intronic
1141852880 16:86659447-86659469 TGGATGGATGGGTATATAGATGG - Intergenic
1141940702 16:87274175-87274197 TGGATGGTGGGGAACGGGGGTGG - Intronic
1142248621 16:88980944-88980966 TGGATGGATGGGTAGAGGGGTGG + Intergenic
1203086853 16_KI270728v1_random:1189168-1189190 TTGATGTTGGTGTTTAGAGGGGG + Intergenic
1143306257 17:5949350-5949372 TGAGGGGTGGGGTATAGAGTAGG - Intronic
1143890763 17:10100639-10100661 TGGATGGGGGGGTTGGGAGGTGG - Intronic
1144702029 17:17346413-17346435 AGGATGGTGGGGCACAGAGAGGG + Intronic
1145871198 17:28274904-28274926 TGGTGGGTGGGGGATAGTGGGGG - Intergenic
1146528546 17:33588038-33588060 TGGCTGGTGGGGAATAGAATTGG - Intronic
1147144482 17:38477309-38477331 TTGATGCTGGTGTTTAGAGGGGG + Intronic
1148027512 17:44598878-44598900 TGGTTGTTGGGGTAGAGATGGGG + Intergenic
1148344163 17:46892280-46892302 TGGATGGTGGGGAAGAGCTGAGG - Intergenic
1148345962 17:46903917-46903939 TGGGTGGTCGGGTAGATAGGTGG + Intergenic
1149218715 17:54389513-54389535 TGGATGCTGGGGTATACCAGAGG + Intergenic
1149427561 17:56569811-56569833 TGTGTGTTGGGGGATAGAGGTGG + Intergenic
1149526156 17:57357373-57357395 TGGGTGGTGTGGTGTAGAAGGGG + Intronic
1150119377 17:62587096-62587118 TGGGATGTGGGGTAGAGAGGGGG + Intronic
1151267175 17:72965909-72965931 TGGATGGTTTGGTATAGAGCAGG - Intronic
1151322117 17:73358605-73358627 TGGATGGTGGGGAATAGAGGTGG + Intronic
1152170779 17:78746370-78746392 TACATGGTGAGGAATAGAGGAGG - Intronic
1152473523 17:80503380-80503402 TGGGTGGAGGGGTAGAGGGGTGG + Intergenic
1152473543 17:80503448-80503470 TGGGTGGAGGGGTAGAGGGGTGG + Intergenic
1152473627 17:80503750-80503772 TGGATGGAGGGGTGGAGGGGTGG + Intergenic
1153073583 18:1134983-1135005 TGGATGGAGAGGTAAAGAAGTGG - Intergenic
1153433901 18:5048396-5048418 TGGAAGGTGGGGTTTGCAGGAGG + Intergenic
1155615585 18:27717348-27717370 TGGATGGAGGGGTATACGTGGGG + Intergenic
1159232343 18:65625598-65625620 TGGAAGGTGAGGTATGGATGTGG - Intergenic
1159633479 18:70777851-70777873 TGGATGCTGGGGTAAAGAAATGG - Intergenic
1161498777 19:4601726-4601748 TGGATGGATGGGTAGAAAGGTGG + Intergenic
1161648934 19:5472305-5472327 GGGGTAGTGGGGTATAGATGTGG - Intergenic
1161679793 19:5674055-5674077 TGGATGATGGGGTAGATGGGTGG - Intergenic
1161776950 19:6268881-6268903 TGGAAGGTGGGGTAGTGAGTGGG - Intronic
1164738622 19:30560372-30560394 TGGATGGTGGTTTACAGGGGAGG - Intronic
1165149678 19:33753496-33753518 GGGATGGTGGAGGATGGAGGGGG - Intronic
1165149705 19:33753578-33753600 GGGATGGTGGGAGATGGAGGGGG - Intronic
1165149735 19:33753648-33753670 TGGTTGGTGGGGGATGGAGGGGG - Intronic
1165149761 19:33753708-33753730 GGGATGGTGGGGGATGGAGAGGG - Intronic
1165498979 19:36172446-36172468 AGGTGGGTGGGGTATAGATGAGG - Intergenic
1167230439 19:48279572-48279594 TGGGTGGGTGGGTGTAGAGGGGG + Intronic
1167257944 19:48442476-48442498 TGGATAGTGGGGAAGAGAGCGGG + Intronic
1168141715 19:54392472-54392494 TGGGTGGTGGGGGGTGGAGGCGG + Intergenic
925943786 2:8842475-8842497 TGAGAGGTGGGGTAGAGAGGTGG - Intergenic
926323966 2:11768391-11768413 TGGAAGGTGGAGTATAGGGGAGG - Intronic
926599979 2:14832118-14832140 TGGAGGGTGGGGGAAAGAGGAGG - Intergenic
926880260 2:17537953-17537975 GGGGTGGGGGGGTATAGAGGAGG - Intergenic
927179921 2:20437918-20437940 TGGATGGTGGGATAAAGAAAAGG + Intergenic
927576910 2:24207984-24208006 TGGAGTGGGGGGGATAGAGGTGG + Intronic
928167305 2:28980538-28980560 TGGATGGTGAGGGCTAGAAGGGG + Intronic
928621497 2:33092837-33092859 GGGAGGGTGGGGAAGAGAGGTGG - Intronic
928816546 2:35302291-35302313 TTGAAGGTGGGGTCTAGTGGTGG + Intergenic
929531814 2:42757337-42757359 TGGGTGCTGGGGTATTCAGGTGG + Intergenic
929860420 2:45672298-45672320 TGGATGGATGGATATAGAGATGG - Intronic
930520142 2:52455416-52455438 AGGAGGGTGGGATGTAGAGGAGG + Intergenic
931229892 2:60365356-60365378 TGGATGGAGAGGGATGGAGGAGG + Intergenic
932745636 2:74331207-74331229 TGGGTGGTGAGGTATAGGTGAGG + Intronic
933487690 2:82944402-82944424 TGGAGGGTGAGGTAAAGGGGAGG - Intergenic
934840338 2:97620366-97620388 TGGATGGATGGGTAATGAGGAGG - Intergenic
934840346 2:97620414-97620436 TGGATGGATGGGTAGATAGGTGG - Intergenic
935464130 2:103375212-103375234 TGGTTGTTGGGGTAGAGGGGAGG - Intergenic
936982883 2:118280013-118280035 TGGGTGGGGGGGTATAGGGAGGG + Intergenic
938770797 2:134499053-134499075 TGGCTGGTGGGGTAAAAACGGGG + Intronic
939488022 2:142841501-142841523 TGTATAGAGGGGTTTAGAGGAGG - Intergenic
940524170 2:154791033-154791055 TAGAGGGTGGGGTTTGGAGGAGG + Intronic
940884280 2:158975283-158975305 TGGAGGGTTGGGTGTGGAGGGGG + Intronic
941090123 2:161165627-161165649 AGTATGGTGAGGTGTAGAGGAGG - Intronic
942198483 2:173546626-173546648 TTGATGGTGGGGGATAGGGAGGG + Intergenic
945386434 2:209207336-209207358 TGGGGGGTGGGGTAAAGGGGAGG + Intergenic
945852358 2:215024172-215024194 TGGATTGTAAGGGATAGAGGTGG - Intronic
946450534 2:219775229-219775251 GGGAGGGTGGGGGATAGAGCTGG - Intergenic
947502329 2:230680419-230680441 TGGCTGGTGGGGTGTAGATAGGG + Intergenic
947610548 2:231522600-231522622 GGGAGGGTGGGGGATAGGGGAGG - Intergenic
948458567 2:238118488-238118510 TGGATGGTGGGAGATGGAGGAGG + Intronic
1169211707 20:3769367-3769389 TGGAAGGTGGGATAATGAGGGGG - Intergenic
1170160112 20:13302257-13302279 TGGAAGGTGGGGTAAATTGGAGG + Intergenic
1170362515 20:15562172-15562194 TGGCTGGTGGGGGATGGGGGTGG - Intronic
1170967216 20:21084207-21084229 AGGGTGGTGGGGCAGAGAGGAGG + Intergenic
1173106900 20:40145259-40145281 AGTATGGAGGGGTATAGAGGGGG - Intergenic
1173561823 20:44011580-44011602 TGGATGGCAGGGGATAGAGCTGG - Intronic
1173840519 20:46153728-46153750 TGGATGCTGGGGTAACGAGGTGG + Intergenic
1174575072 20:51531510-51531532 TGCTTGGTGGGGCAAAGAGGAGG - Intronic
1175789592 20:61732990-61733012 TGGGAGCTGGGGTCTAGAGGGGG - Intronic
1176043886 20:63082597-63082619 TGGGGGGTGGGGTGCAGAGGAGG + Intergenic
1176129967 20:63492603-63492625 TGGATGGAGGGATAGAGAGAAGG + Intronic
1177726177 21:24971260-24971282 TGGAGGGTGGGGTGAAGAAGGGG - Intergenic
1178584296 21:33859733-33859755 TGGATGGAGGGATGGAGAGGAGG + Intronic
1178780761 21:35601467-35601489 GGGATCGTGGGCTATAGAAGTGG + Intronic
1179583813 21:42362110-42362132 GGGATGGTGGGGTGTACAGTAGG - Intergenic
1181002625 22:19994909-19994931 TGGATGGGGGGGGATGGTGGAGG + Intronic
1181011501 22:20043542-20043564 GTGATGGCGGGGTGTAGAGGTGG + Intronic
1181645750 22:24231195-24231217 AGGATGGTGGGTTTTAGAGCTGG - Intronic
1182661026 22:31925298-31925320 TGGATGGATGGGTATATAGACGG - Intergenic
1182727623 22:32460543-32460565 TGGATGGTGGGGTATAGAGGGGG - Intronic
1183313688 22:37125491-37125513 TGGAGGGAGGGGGATAGAGGGGG + Intergenic
1183502462 22:38189032-38189054 GGGATGGTGGGGGATGGTGGGGG + Intronic
1183502465 22:38189042-38189064 GGGATGGTGGGGGATGGAGAGGG + Intronic
1183502478 22:38189072-38189094 GGGATGGTGGGGGATGGTGGGGG + Intronic
1183502483 22:38189082-38189104 GGGATGGTGGGGGATGGTGGGGG + Intronic
1183502486 22:38189092-38189114 GGGATGGTGGGGGATGGAGAGGG + Intronic
1183502503 22:38189142-38189164 GGGATGGTGGGGGATGGAGAGGG + Intronic
1183502520 22:38189192-38189214 GGGATGGTGGGGGATGGAGAGGG + Intronic
1183952355 22:41358776-41358798 TGGAAGGTAGGGTGGAGAGGAGG - Exonic
1184731159 22:46371893-46371915 TGGATGGAGGGATGGAGAGGTGG - Intronic
1185146326 22:49138788-49138810 TGGATGGATGGGTATAGGGATGG - Intergenic
950212061 3:11131010-11131032 GGGATGGTGGGGGAGAGAGAGGG - Intergenic
950474233 3:13205642-13205664 TGGATGGAGGGGTGAAGAGATGG - Intergenic
951350913 3:21605870-21605892 TGGATAGTGTGGATTAGAGGTGG - Intronic
951750852 3:26034772-26034794 TGGATGGTGGAGGGTGGAGGAGG + Intergenic
951989500 3:28660905-28660927 TGGGTGGTGGGGGATAAAGAAGG + Intergenic
952377397 3:32779281-32779303 TGGACAGTGGGGAATGGAGGGGG + Intergenic
952756981 3:36878295-36878317 CAGATGGTGGGGTATAGTTGGGG - Intronic
953454490 3:43030823-43030845 TGGATTGTGGGGGATAGAGGTGG + Intronic
953896474 3:46807100-46807122 TGGCAGTTGGGGGATAGAGGTGG - Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
956908877 3:73796119-73796141 GGGATGGTGGGGTTTGGGGGTGG + Intergenic
957039739 3:75327897-75327919 TGGATGGTGGGGAGAGGAGGGGG - Intergenic
958011782 3:87888317-87888339 TGTAGGGTGGGGTCTGGAGGAGG + Intergenic
960708617 3:120505510-120505532 TGGAAGGGGGGGTGTAGTGGGGG - Intergenic
961044489 3:123699331-123699353 TGGATGGTGGGGAGAGGAGGGGG - Intronic
961475950 3:127146420-127146442 TGGATGGAGGGGTAGATAGATGG + Intergenic
962462283 3:135625520-135625542 TGGGTGGAGGGGAAAAGAGGGGG - Intergenic
963741517 3:149086392-149086414 TGGAAGGAGGCGTATCGAGGCGG - Exonic
964664677 3:159159170-159159192 TGGACTCTGGGCTATAGAGGTGG + Intronic
964888531 3:161512568-161512590 TGGAAGGTGGGGTCTGGGGGAGG - Intergenic
964979847 3:162665549-162665571 TTGCTGGTGGGGTAGAGAAGGGG - Intergenic
965115752 3:164485404-164485426 TGGATGATGGGATAAAGAAGAGG + Intergenic
965542977 3:169889100-169889122 TGTAAGGTGGGGTCCAGAGGAGG - Intergenic
965827781 3:172747922-172747944 TGGATGGTGGGGGGGAGGGGCGG + Intergenic
967319979 3:188185500-188185522 TGAACTGTGGGGTATATAGGGGG - Intronic
967598347 3:191354753-191354775 TGTGGGGTGGGGTGTAGAGGTGG + Intronic
968511606 4:998113-998135 TGGATGGAGGGGAGGAGAGGTGG + Intronic
968979017 4:3836794-3836816 TGGGAGGTGGGGTTAAGAGGTGG - Intergenic
969296545 4:6273478-6273500 TGGATGCTGGGGTCTGGGGGAGG + Intronic
969701282 4:8769181-8769203 TGGATGGGGGCGAAGAGAGGTGG + Intergenic
971025134 4:22582220-22582242 TGGAAGGTGGGGGATGGAGTGGG - Intergenic
971770098 4:30884775-30884797 TGTGGGGTGGGGTATTGAGGGGG + Intronic
971789711 4:31153843-31153865 TGGATGTTTGGGTACAGTGGTGG + Intergenic
971938988 4:33189457-33189479 AGGGTGGTGGGCTACAGAGGTGG + Intergenic
972508261 4:39742141-39742163 TGTATGATGGGTTATAGAGATGG + Intronic
972794477 4:42401311-42401333 TGGCTGGTGGTGTATGGCGGGGG - Exonic
972943017 4:44220192-44220214 TGGAAGATGGGATATAGAGTGGG + Intronic
975187987 4:71425691-71425713 TGGATGGTGGGGCAGGGAGATGG + Intronic
975376031 4:73646480-73646502 TTGTTGCTGGGGAATAGAGGAGG + Intergenic
976872189 4:89808666-89808688 TGGATGGTTGGGAGCAGAGGGGG + Intronic
978322003 4:107507026-107507048 TGGGGGGTGGGGGATAGGGGAGG + Intergenic
979545846 4:121939162-121939184 TGGGTGGTGCAGTATAGAGTTGG + Intronic
980302285 4:131010643-131010665 GGGATATTGGCGTATAGAGGTGG - Intergenic
981449915 4:144885134-144885156 GGGTTGGTGGGGTGGAGAGGAGG - Intergenic
981546487 4:145899296-145899318 TGGAAGGTGGGGGAGGGAGGGGG + Intronic
981856419 4:149298831-149298853 TGGATTTTGGTGTATACAGGCGG - Intergenic
982295677 4:153826403-153826425 TGGAGGGTGGGGGCTAGAGGAGG - Intergenic
983767498 4:171503479-171503501 TGGAGTGTGAGGTAGAGAGGAGG + Intergenic
984599784 4:181712899-181712921 AAGATGTTGGGATATAGAGGGGG + Intergenic
985533035 5:444747-444769 TGAGTGGTGGGATATAGCGGGGG + Intronic
986704895 5:10446717-10446739 TGGCGGGTGGGGGAAAGAGGAGG + Intronic
987068089 5:14308985-14309007 TGGATGGTTGGGTGATGAGGTGG - Intronic
988271335 5:29021438-29021460 TGGTTGGTTGTGTAGAGAGGAGG + Intergenic
990939268 5:61185591-61185613 TCCATGGTGGGGTATAGAGTTGG + Intergenic
991360822 5:65818377-65818399 TGTATGGGGGGGTAGAGAAGTGG - Intronic
991540259 5:67720029-67720051 AGGATGGTGGGGTATAAAGATGG + Intergenic
992073920 5:73173778-73173800 TAGATGGTGTAGTATTGAGGAGG - Exonic
992310538 5:75494370-75494392 TGGAAGTTGGGGAATAGTGGTGG + Intronic
993902258 5:93592648-93592670 TGGGTGGTGGGGAGTTGAGGGGG - Intronic
994551020 5:101235412-101235434 TGGAGGGTGGGGGCTAGGGGAGG - Intergenic
994735399 5:103547740-103547762 AGGATGGTAGGGTATAGTGTAGG + Intergenic
994890602 5:105629593-105629615 TGATTGTTTGGGTATAGAGGTGG + Intergenic
996755110 5:126927105-126927127 TGTGTGTTGGGGTTTAGAGGAGG - Intronic
997713523 5:136025916-136025938 TGGGTGGTGGGGCATGGATGTGG + Intergenic
997886596 5:137635887-137635909 TGGTTGATGGGGGTTAGAGGAGG - Intronic
997961254 5:138323480-138323502 TGGGGGGTGGGGTAGAGATGTGG + Intronic
998424926 5:142018499-142018521 AGGATGTTGGAGTATAGGGGTGG - Intergenic
999393677 5:151212904-151212926 TGGAGGGTGGGGAATCGTGGTGG + Intronic
999621961 5:153482752-153482774 TGCAAGGTGAGGCATAGAGGAGG + Intergenic
1000962667 5:167618765-167618787 CAGATGGTGGGGGATAGAGATGG - Intronic
1001210564 5:169806847-169806869 GGGATGGTGGGGGGTGGAGGTGG - Intronic
1001481052 5:172089443-172089465 TGGATGGTTAGGTAGATAGGTGG + Intronic
1001665961 5:173433959-173433981 TTGATGGTGGTGGTTAGAGGTGG + Intergenic
1001965063 5:175904212-175904234 TGAGTGGTAGGGTAGAGAGGAGG + Intergenic
1002251892 5:177934976-177934998 TGAGTGGTAGGGTAGAGAGGAGG - Intergenic
1004512277 6:16292552-16292574 TGCATGGTTGGGTAAGGAGGAGG + Intronic
1004531288 6:16457795-16457817 TGGATGGAGGAGATTAGAGGAGG - Intronic
1005636224 6:27756030-27756052 TGGATGGTAGTATAGAGAGGAGG + Intergenic
1006417839 6:33915374-33915396 TGGAAGCTGGGGTATAGAGCTGG + Intergenic
1006460578 6:34155285-34155307 AGGAAGGTGGGGTACAGGGGTGG + Intronic
1006921248 6:37628985-37629007 TGGAGGGTGGCGTATATAGATGG + Intergenic
1010370458 6:75101121-75101143 TTGATGGTGGGGTAGACAGCTGG - Intronic
1010726850 6:79344988-79345010 TGGAAGGTGGGGTTTGGTGGGGG - Intergenic
1011196213 6:84782225-84782247 TGGATGTGGGGGTGTGGAGGGGG - Intergenic
1012328893 6:97959527-97959549 TGGATGGCAGAGTATACAGGAGG + Intergenic
1012545198 6:100411650-100411672 TGGATGCTGGGGAATGGAGGGGG + Intronic
1013701794 6:112779912-112779934 TGGGAGGTGGGGTAGGGAGGAGG - Intergenic
1014259872 6:119203993-119204015 TAGAGGGTGGGGTGTTGAGGAGG + Intronic
1016792881 6:148084528-148084550 CAGATGGTGGGATGTAGAGGAGG - Intergenic
1016828165 6:148406982-148407004 TGGCAGGAGTGGTATAGAGGAGG + Intronic
1017821654 6:158053610-158053632 TGGATGGGTGGGTAGATAGGTGG - Intronic
1017905849 6:158757129-158757151 TGGAAGGTGGGGTCCAGAGATGG + Intronic
1017957667 6:159192207-159192229 TGGATGGTAGATTTTAGAGGTGG - Intronic
1018871888 6:167790151-167790173 TGGATGGTGGGGAGCAGGGGTGG - Intronic
1018871965 6:167790380-167790402 AGGATGGTGGGGGGTAGGGGAGG - Intronic
1019103581 6:169650788-169650810 TGGATGGTGGGGTGGAGGGATGG - Intronic
1021228672 7:18059105-18059127 TGGATAGTGAGGTGTAGAGCAGG + Intergenic
1021350666 7:19590119-19590141 TGGAGGGTGGGGTTGAGATGAGG - Intergenic
1021424718 7:20486810-20486832 TGGATGTTGGGGGATGGAAGTGG - Intergenic
1026805664 7:73428703-73428725 TGGATTCTGGGGGAGAGAGGTGG - Intergenic
1027133680 7:75609457-75609479 TGGAGGGTGGGGTGGAGAGGTGG - Intronic
1030674977 7:112375076-112375098 TGTGGGGTGGGGTATTGAGGGGG - Intergenic
1031928376 7:127660111-127660133 TGAATGGTGGGGTGGAGAGAGGG + Intronic
1032193066 7:129775401-129775423 TGGCAGGTTGGGTAGAGAGGAGG - Intergenic
1032413658 7:131719545-131719567 TGGATGGTGGTGTTGAGAGTGGG + Intergenic
1033153516 7:138936905-138936927 TGGATTGGAGGGGATAGAGGAGG - Intronic
1033672671 7:143508035-143508057 TGGAGACTGGGGAATAGAGGTGG - Intergenic
1034275045 7:149820318-149820340 AGGATGGGTGGGGATAGAGGAGG - Intergenic
1035330252 7:158092013-158092035 TAGATGGTTGGGTAGAGAGATGG + Intronic
1035330313 7:158092363-158092385 TGGATGGATGGGTAGAGAGGTGG + Intronic
1036602486 8:10274665-10274687 TGGATGGATGGGTAGAGAGATGG - Intronic
1037463286 8:19134890-19134912 TGGAGGCTGGGGAAGAGAGGAGG - Intergenic
1037761935 8:21747289-21747311 TGGATGCTGGGATAAAGGGGAGG - Intronic
1037938448 8:22930932-22930954 TGAATGGTGGTGTCTGGAGGTGG - Intronic
1038530934 8:28317490-28317512 TGGATGGTGGGGAACGGGGGAGG + Intronic
1038891650 8:31732405-31732427 TAGATGGTGGGGTGTGGGGGCGG - Intronic
1040377217 8:46837908-46837930 TGTGGGGTGGGGTATTGAGGGGG + Intergenic
1043864804 8:85362467-85362489 TGGTGGCTGGGGTATTGAGGAGG + Intronic
1043917048 8:85935183-85935205 GAGTTGGTGGGTTATAGAGGTGG - Intergenic
1044479271 8:92666378-92666400 TGGATGTTGGGGTCTAGGGAAGG - Intergenic
1044753000 8:95434145-95434167 AGGATGTTGGGGGAAAGAGGTGG - Intergenic
1045265867 8:100618190-100618212 TGTTTTGTGGGGTATAGTGGAGG + Intronic
1045340900 8:101253597-101253619 TGGAGGGTGGGGGAGAGAGGAGG - Intergenic
1046977431 8:120297139-120297161 TGGGAGGTGTGCTATAGAGGAGG + Intronic
1048308639 8:133301132-133301154 TGGATGCTGGAGGAGAGAGGGGG - Intronic
1048821840 8:138387440-138387462 AGGAAGGTGGGGTGGAGAGGTGG - Intronic
1049554259 8:143274349-143274371 AGGATGCTGGGGCATGGAGGAGG + Intronic
1050175440 9:2865235-2865257 TGGATGGTGAGGCAGAAAGGAGG - Intergenic
1051337111 9:16076067-16076089 TGGATGAGTGGGTGTAGAGGAGG + Intergenic
1052508649 9:29385403-29385425 GGGGTGGTGGGCTATGGAGGGGG + Intergenic
1053153136 9:35755525-35755547 TGGATGGAGGGGGATAGCAGCGG + Exonic
1054805786 9:69394879-69394901 TTGATGGTGAGGTTTGGAGGAGG + Intergenic
1055120394 9:72653767-72653789 TGGGTGGTGGGGTGTAGAGAAGG - Intronic
1057007133 9:91570153-91570175 TGGGTGTTGTGGGATAGAGGTGG + Intronic
1057808798 9:98241713-98241735 AGCATGCTGGGGTAGAGAGGGGG - Intronic
1058261327 9:102836327-102836349 TGGATGGTGAGGTTAGGAGGAGG - Intergenic
1058453300 9:105116687-105116709 TGCATGGTGAGGTGTAAAGGAGG + Intergenic
1058944233 9:109841700-109841722 AGGATGGAGGGGTAGAGGGGAGG + Intronic
1058976385 9:110128717-110128739 AGGATGGTGGGGCAGAGGGGAGG + Intronic
1059480564 9:114586266-114586288 AGGATAGTGGGGGATGGAGGCGG - Intergenic
1059779429 9:117510543-117510565 TAGATGGTGGGAAATGGAGGAGG + Intergenic
1062031198 9:134362807-134362829 TGGCTGGTGGCGCTTAGAGGAGG + Intronic
1062112306 9:134788785-134788807 TGGATGGGTGGGTAGACAGGTGG + Intronic
1062480584 9:136749086-136749108 CGGATGGTGGGCTGCAGAGGTGG - Intergenic
1185706068 X:2267044-2267066 CGGAGGGTGGGGTGTAGAGCTGG + Intronic
1185867899 X:3639380-3639402 TGGATGAAGGGGTAGAGGGGTGG + Intronic
1186527288 X:10260532-10260554 TGCAGGGTGGGGTAGTGAGGAGG - Intergenic
1187670900 X:21664974-21664996 TGGATGGTGGGGCACAGGGTGGG + Intergenic
1187674864 X:21706155-21706177 TGGAGGGTGTGGTTTTGAGGAGG - Exonic
1189089885 X:38070601-38070623 TGAATGCTGAGGTAAAGAGGTGG - Intronic
1189691146 X:43617890-43617912 GGGATGGTGGGGCATAGGGGAGG - Intergenic
1190114573 X:47618280-47618302 TTGAGGGTGGGGTATACAGCAGG + Intronic
1190245018 X:48685365-48685387 TGGATTGTGGGGTATAGTCTGGG - Intronic
1191910384 X:66143653-66143675 TGGCTGGTGGAGTGTACAGGAGG + Intergenic
1192611721 X:72573330-72573352 TGGATGGTGGGGGCTCTAGGTGG - Intergenic
1192675386 X:73190591-73190613 TGGGAGGTGGGGGATAGGGGAGG + Intergenic
1193132011 X:77930304-77930326 TGGACAGTGGGGTAGAGTGGAGG + Intronic
1193214476 X:78846959-78846981 TGGAAGGTGGGGGAAAGTGGGGG + Intergenic
1193264749 X:79455011-79455033 TGGAGGGTGGGGGCTAGGGGAGG + Intergenic
1193478609 X:81997926-81997948 TGGAGGGTGGGGGTTGGAGGAGG + Intergenic
1193630716 X:83884120-83884142 TGGATGGTGGGAGAAAGAGTTGG + Intronic
1193655109 X:84188401-84188423 TGGGTGGTGGGATAGAGGGGAGG + Intergenic
1194695702 X:97046796-97046818 TGGATGGTGGGTCAAAGAGCTGG + Intronic
1195677519 X:107518345-107518367 TGGATGGTGTCGTAGAGAGTGGG + Intergenic
1197460037 X:126729867-126729889 TGTGGGGTGGGGTATTGAGGAGG - Intergenic
1199238522 X:145518592-145518614 TTGGTGGTAAGGTATAGAGGAGG - Intergenic
1199679507 X:150215368-150215390 TGGAGGGAGGGGGAGAGAGGGGG + Intergenic
1199689378 X:150296736-150296758 TAGATAGTGGGGTACAGAGGTGG - Intergenic
1199695724 X:150341681-150341703 TGGAGGGAGGGGGAGAGAGGGGG - Intergenic
1200878643 Y:8187906-8187928 TCGTTGGTGGGGGATAGGGGAGG - Intergenic
1201766291 Y:17576311-17576333 TGCATGGTGGGGTCTAGGGCTGG - Intergenic
1201835261 Y:18329678-18329700 TGCATGGTGGGGTCTAGGGCTGG + Intergenic