ID: 1182730308

View in Genome Browser
Species Human (GRCh38)
Location 22:32484425-32484447
Sequence CTGCATAATACCAATGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182730306_1182730308 -3 Left 1182730306 22:32484405-32484427 CCGTGAACTTCTTCATACTCCTG 0: 1
1: 0
2: 1
3: 11
4: 241
Right 1182730308 22:32484425-32484447 CTGCATAATACCAATGTTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182730308 Original CRISPR CTGCATAATACCAATGTTGC TGG Intronic
901753347 1:11425748-11425770 TAGAATAATACCAATGTTTCAGG + Intergenic
908386277 1:63644988-63645010 GTGGAAAATACCAATGGTGCAGG - Intronic
916627320 1:166572219-166572241 CAAGATAATACCAATGTTGTTGG + Intergenic
920060295 1:203222602-203222624 CTCCAGAATAGCAATGTAGCAGG - Intronic
920445260 1:206011487-206011509 CTCCATAATCCCTATGTGGCAGG + Intronic
921944032 1:220874324-220874346 TTTCATCATAACAATGTTGCTGG + Intergenic
923192515 1:231633463-231633485 CTGCACAATCCCAATCCTGCAGG - Intronic
1064821976 10:19346948-19346970 CTGCATAAAACCAATGAGGGAGG - Intronic
1071264568 10:83953492-83953514 CTGAATAATGTCAATGTTGTTGG + Intergenic
1077640204 11:3874419-3874441 CTTCATAATGCCCATTTTGCAGG + Intronic
1079160661 11:17990343-17990365 CTGCAGAATGTCAATGTTGCAGG - Intronic
1079368419 11:19829582-19829604 CTTCATAATACCAATGATGTAGG + Intronic
1080438825 11:32271465-32271487 CTGCATTATTCCAATGTGGAAGG - Intergenic
1083262728 11:61531957-61531979 CTGCATTTTACCAAGGTTCCCGG + Intronic
1086648167 11:89250819-89250841 CTTCAACATACAAATGTTGCAGG + Intronic
1087743059 11:101911818-101911840 CAGCACAAGACCACTGTTGCTGG - Intronic
1091527019 12:1313081-1313103 CTCCATGATACCAATGGTTCTGG + Intronic
1092958439 12:13572253-13572275 CTACACAATACCAGTGTTGATGG + Intronic
1095494672 12:42771937-42771959 CAGCATGACAGCAATGTTGCAGG + Intergenic
1096701035 12:53382945-53382967 GTTCATAATTCCCATGTTGCTGG - Exonic
1098958460 12:76712521-76712543 CTGTATAAAACCAATGTGGGTGG - Intergenic
1099415899 12:82386217-82386239 CTGCATCATCCAAATGATGCAGG + Intronic
1100447108 12:94671009-94671031 CTTCAACATACCAATGTTACAGG + Intergenic
1106800296 13:33249564-33249586 CTGCATTGTACGATTGTTGCAGG - Intronic
1111811837 13:93100900-93100922 CTGCTTATTTCTAATGTTGCTGG - Intergenic
1112376303 13:98844714-98844736 CTTCATAATGCCCACGTTGCTGG + Intronic
1113377729 13:109781238-109781260 CCGCATAATGCCGATGCTGCTGG - Intronic
1121275691 14:92666184-92666206 CTGCATCATAGCAATGAGGCAGG - Intronic
1126267141 15:46768225-46768247 CAGGATAATACCAATGTTCAGGG + Intergenic
1127351294 15:58155294-58155316 CAGGATAATACCAATATTTCAGG - Intronic
1136959117 16:34825421-34825443 CTGCCTTATACCAAGGTTGTAGG - Intergenic
1140350833 16:74260699-74260721 CTGCATCATAACATTGTTGAGGG - Intergenic
1147697835 17:42369916-42369938 CTGTATAATCCCAATGTTTTGGG - Intronic
1148249704 17:46065695-46065717 CTGCACAGTACCAATTTTACTGG + Intronic
1150999006 17:70352039-70352061 CTGCATCATCCCACTGTTGATGG - Intergenic
1153620349 18:6971658-6971680 CTACATTATACCAATGTCACAGG + Intronic
1155520977 18:26668839-26668861 CTGCATAACACAAATGTTGTGGG - Intergenic
1158969791 18:62655923-62655945 CTGCATAAGACTCATGGTGCTGG + Intergenic
1165368302 19:35384071-35384093 CTGCTTAATACCAGGGTGGCAGG - Intergenic
1168466455 19:56605888-56605910 ATGTATAATACCAATCTAGCTGG - Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
932193629 2:69763483-69763505 CTGCATAATGCCTATATTCCAGG + Intronic
935236236 2:101140569-101140591 CTGCATTATATCAACGTTACAGG + Intronic
939632348 2:144540195-144540217 CTTAATCATATCAATGTTGCAGG + Intergenic
943353729 2:186824664-186824686 CTGCCTAACTCCAATGATGCTGG + Intergenic
943699874 2:190978285-190978307 CTTCATAACACCAAGGTTTCTGG + Intronic
943891913 2:193298689-193298711 CTGCATAATATAGATGCTGCAGG - Intergenic
947433120 2:230048204-230048226 CTTCATTATACCCATTTTGCAGG + Intronic
947962617 2:234252372-234252394 CTGCATATTTGCAATGTTCCTGG - Intergenic
1169925520 20:10780257-10780279 CTGCATAATACCTAGATTACAGG + Intergenic
1178917275 21:36713233-36713255 CTGAATATTACCAATTTTTCTGG + Intronic
1178922005 21:36744925-36744947 CAGCAAAAAGCCAATGTTGCCGG + Exonic
1182730308 22:32484425-32484447 CTGCATAATACCAATGTTGCTGG + Intronic
950792728 3:15486352-15486374 CCATATGATACCAATGTTGCTGG + Intronic
956037198 3:65106942-65106964 CTGTATAATACCAGTGATACTGG + Intergenic
956563492 3:70611252-70611274 CTGAGTGATGCCAATGTTGCTGG + Intergenic
962401023 3:135058757-135058779 CTGCAGAATCCCCATGTAGCCGG - Intronic
971279240 4:25227867-25227889 CTGAATAATTCAAATGTTGGAGG + Intronic
981528992 4:145734115-145734137 CCCCACCATACCAATGTTGCTGG - Intronic
981919949 4:150076837-150076859 CTGGGTAATGCCAATGCTGCTGG - Intergenic
985926348 5:3022675-3022697 CTGCATAAGCCAAATGTTGAGGG - Intergenic
987461808 5:18221771-18221793 ATGCATAATACGATTCTTGCAGG + Intergenic
990813944 5:59761839-59761861 CTTAATAATAACTATGTTGCTGG - Intronic
993110498 5:83651376-83651398 CTGAATAATGCCAATGTTCATGG + Intronic
993983480 5:94569874-94569896 GAGGATAATACCAATGTTTCAGG - Intronic
994704397 5:103183282-103183304 CTGCATTATACCAGTGGTGTGGG + Exonic
998314723 5:141172726-141172748 CTGAATAATAGCAATGTTTGTGG - Intergenic
999096401 5:148981672-148981694 CTACATAATACCAAAGCTACAGG + Intronic
999948674 5:156625141-156625163 CTGCATCATTCCTATGGTGCTGG - Intronic
1003258583 6:4495468-4495490 CTGCAGAATACGAACGTTCCAGG - Intergenic
1003817167 6:9854474-9854496 CTTCATTTTACCAATTTTGCTGG + Intronic
1004109179 6:12698443-12698465 TTGCAAAATACCACTGTTTCAGG + Intergenic
1005863538 6:29920157-29920179 CTGCATCAAACCAAAGTTACTGG + Intergenic
1007819840 6:44553120-44553142 CTGCCTATTACCATTGGTGCAGG - Intergenic
1007952014 6:45880891-45880913 CAGAATAATAGCAGTGTTGCCGG + Intergenic
1012279274 6:97309875-97309897 CTGGATGATGCCAATGCTGCTGG - Intergenic
1012839712 6:104314468-104314490 CTGCATAAAAACAAAGTTTCTGG + Intergenic
1014159429 6:118151199-118151221 CTGCAGAATCCCAAGGTTGGAGG - Intronic
1015291825 6:131546250-131546272 TTGCATAATGCCAATTTTGGTGG + Intergenic
1018440102 6:163804185-163804207 GTGCGTAATACAAATGCTGCTGG - Intergenic
1026427141 7:70306844-70306866 CTGCATAATTCCAAGACTGCTGG + Intronic
1028840191 7:95421206-95421228 GTTCAGAATACAAATGTTGCTGG + Intronic
1031784406 7:126010831-126010853 CTACATAATATAAATGTTGTAGG - Intergenic
1036383392 8:8255039-8255061 CTGCCTAAAGCAAATGTTGCTGG - Intergenic
1038664117 8:29522701-29522723 CTGCCTAATACCAAAGCTCCCGG - Intergenic
1044500235 8:92946338-92946360 CTGCAAAAAACAAATCTTGCTGG + Intronic
1047315718 8:123731194-123731216 CTGGATTATACCAATGATGCGGG + Intronic
1054827861 9:69590814-69590836 CTGCAGAAACCCACTGTTGCTGG - Intronic
1055801282 9:80039100-80039122 TGGCATAATTCCAATGATGCTGG + Intergenic
1056141611 9:83686265-83686287 CACCATAATCCCAATGTTCCAGG + Intronic
1058198104 9:102003522-102003544 GAGCATAATACCCATATTGCTGG - Intergenic
1188382810 X:29518374-29518396 CTGAGTGATGCCAATGTTGCTGG + Intronic
1190547383 X:51542806-51542828 CTGCATTATACAAATTTTGTTGG + Intergenic
1192486119 X:71528257-71528279 CTGCAAAATAATAATGGTGCTGG - Intronic
1193255246 X:79341098-79341120 CTGCATGATTCAAATGTGGCAGG - Intergenic
1194945249 X:100059104-100059126 CTGAATAAGGCCAATGTTGGAGG + Intergenic