ID: 1182733049

View in Genome Browser
Species Human (GRCh38)
Location 22:32510736-32510758
Sequence GGTGAGGTTCCCCCATTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182733049_1182733055 0 Left 1182733049 22:32510736-32510758 CCTTCTAATGGGGGAACCTCACC No data
Right 1182733055 22:32510759-32510781 TGCCCTTGTCAGGAAAGAAGGGG No data
1182733049_1182733056 1 Left 1182733049 22:32510736-32510758 CCTTCTAATGGGGGAACCTCACC No data
Right 1182733056 22:32510760-32510782 GCCCTTGTCAGGAAAGAAGGGGG No data
1182733049_1182733061 12 Left 1182733049 22:32510736-32510758 CCTTCTAATGGGGGAACCTCACC No data
Right 1182733061 22:32510771-32510793 GAAAGAAGGGGGAAGGGCCCAGG No data
1182733049_1182733054 -1 Left 1182733049 22:32510736-32510758 CCTTCTAATGGGGGAACCTCACC No data
Right 1182733054 22:32510758-32510780 CTGCCCTTGTCAGGAAAGAAGGG No data
1182733049_1182733053 -2 Left 1182733049 22:32510736-32510758 CCTTCTAATGGGGGAACCTCACC No data
Right 1182733053 22:32510757-32510779 CCTGCCCTTGTCAGGAAAGAAGG No data
1182733049_1182733059 5 Left 1182733049 22:32510736-32510758 CCTTCTAATGGGGGAACCTCACC No data
Right 1182733059 22:32510764-32510786 TTGTCAGGAAAGAAGGGGGAAGG No data
1182733049_1182733050 -10 Left 1182733049 22:32510736-32510758 CCTTCTAATGGGGGAACCTCACC No data
Right 1182733050 22:32510749-32510771 GAACCTCACCTGCCCTTGTCAGG No data
1182733049_1182733060 6 Left 1182733049 22:32510736-32510758 CCTTCTAATGGGGGAACCTCACC No data
Right 1182733060 22:32510765-32510787 TGTCAGGAAAGAAGGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182733049 Original CRISPR GGTGAGGTTCCCCCATTAGA AGG (reversed) Intergenic
No off target data available for this crispr