ID: 1182734396

View in Genome Browser
Species Human (GRCh38)
Location 22:32521054-32521076
Sequence TGTATAGGCGAGTAGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182734393_1182734396 -10 Left 1182734393 22:32521041-32521063 CCTCTTTCATGATTGTATAGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1182734396 22:32521054-32521076 TGTATAGGCGAGTAGATGGGAGG 0: 1
1: 0
2: 0
3: 24
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182734396 Original CRISPR TGTATAGGCGAGTAGATGGG AGG Intronic
900612353 1:3549483-3549505 AGTCTAGGCGAGAAGATGGGGGG + Intronic
900747833 1:4373227-4373249 TGGATAGATGAGTGGATGGGTGG - Intergenic
901662447 1:10807056-10807078 TGGATAGACGAGTGGATGGATGG - Intergenic
901863711 1:12090362-12090384 TGGATGAGTGAGTAGATGGGTGG - Intronic
903224423 1:21886755-21886777 TGTATAGGTGGGTGCATGGGTGG + Intronic
904332098 1:29767027-29767049 AGTAGAGGAGAGTAGAGGGGAGG - Intergenic
905228253 1:36493916-36493938 TGGATAGGTGAGTGCATGGGTGG - Intergenic
905357932 1:37397731-37397753 TGTATAGGTGAGTGAGTGGGTGG + Intergenic
907400931 1:54224322-54224344 TGTGTTGGGGAGTAGCTGGGAGG - Intronic
911069196 1:93818782-93818804 TGTGTAGGAGAGTAAGTGGGTGG + Intronic
911903407 1:103533193-103533215 TGCATATGCTGGTAGATGGGGGG + Intronic
915092671 1:153437484-153437506 TGTACAGGTGGGTAGGTGGGTGG - Intronic
915877628 1:159628685-159628707 TGTATAAGAGAGTAGATGCAAGG - Intergenic
919692512 1:200540497-200540519 TGGATGGATGAGTAGATGGGTGG - Intergenic
919719969 1:200823198-200823220 TATATAGACAGGTAGATGGGTGG - Intronic
923092175 1:230749027-230749049 TGCATAGGCGTGTATGTGGGGGG + Intronic
923225760 1:231937639-231937661 TGTGGAGGCGGGTGGATGGGGGG + Intronic
924559148 1:245143305-245143327 TGGACAGACGGGTAGATGGGTGG - Intergenic
1062985520 10:1765150-1765172 TGTACAGGTGAGGAAATGGGCGG + Intergenic
1063140636 10:3253961-3253983 TGGATAGGTGGGTAGATGGGTGG - Intergenic
1063140666 10:3254077-3254099 TGGATAGGTGGGTAGATGAGTGG - Intergenic
1063140694 10:3254193-3254215 TGGATAGGTGCGCAGATGGGTGG - Intergenic
1063140722 10:3254309-3254331 TGGATAGGTGGGTAGGTGGGTGG - Intergenic
1063140755 10:3254425-3254447 TGGATAGGTGGGTAGATGGGGGG - Intergenic
1067694862 10:48527450-48527472 TGGATAGGTGAATAGATGGATGG + Intronic
1070105592 10:73427832-73427854 TGTGTAGGAGACAAGATGGGGGG - Intronic
1070646666 10:78206651-78206673 TGGATAGGTGGGTGGATGGGTGG - Intergenic
1071064510 10:81614625-81614647 GCTGTAGGCTAGTAGATGGGCGG - Intergenic
1071466946 10:85949961-85949983 TGGATGGGTGAGTAGATGGATGG + Intronic
1072827482 10:98621987-98622009 TGTCTAGGAGAGTAGCTGGGGGG - Intronic
1074791488 10:116892823-116892845 TGTATAGTGGAGTAGAGGGGAGG - Intronic
1076230459 10:128816258-128816280 TGGATAGATGAGTGGATGGGTGG + Intergenic
1076837536 10:133028646-133028668 TGGATAGGTGGGTGGATGGGTGG + Intergenic
1076931755 10:133536530-133536552 TGTATAGATGGGTGGATGGGTGG + Intronic
1077248505 11:1550552-1550574 TAAATAGGCAAGTAGATGTGTGG - Intergenic
1077248988 11:1552320-1552342 TGGATGGGTGGGTAGATGGGTGG - Intergenic
1077357726 11:2126486-2126508 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1081662943 11:44899542-44899564 TGTCTAGGAGAGCAGCTGGGAGG + Intronic
1083064764 11:59913439-59913461 TGTGCAGGGGAGTGGATGGGAGG + Intergenic
1083288157 11:61674267-61674289 TGCATAGGCGAGTGGATGGATGG + Intergenic
1083288188 11:61674448-61674470 TGAATAGGTGAGTGGATGGTTGG + Intergenic
1084255685 11:67940787-67940809 TGGATAGGTGGGTAGGTGGGTGG + Intergenic
1084457287 11:69275338-69275360 TGTATAGGTGGGTGGATGGATGG - Intergenic
1084457319 11:69275514-69275536 TGTATGGATGGGTAGATGGGTGG - Intergenic
1084491671 11:69481936-69481958 TGGATAGATGAGTAGATGGATGG + Intergenic
1084546003 11:69815355-69815377 TGGATGGGTGAGTGGATGGGAGG + Intronic
1084817067 11:71654531-71654553 TGGATAGGTGGGTAGGTGGGTGG - Intergenic
1085464262 11:76713462-76713484 TGGGTAGGCAGGTAGATGGGTGG + Intergenic
1085464363 11:76713803-76713825 TGGATGGGTGAGTAGATGGGTGG + Intergenic
1085763144 11:79259621-79259643 TGGATGGGGGAGTGGATGGGTGG - Intronic
1089870959 11:121672473-121672495 TGTATGGGAGAGTGGGTGGGCGG - Intergenic
1091187394 11:133658588-133658610 TGGATGGGTGGGTAGATGGGTGG + Intergenic
1101328503 12:103737992-103738014 TGAGTGGGTGAGTAGATGGGTGG - Intronic
1102043215 12:109814191-109814213 TGGATGGACGAATAGATGGGTGG + Intronic
1102641996 12:114374920-114374942 TGGATAGGTGAGTGGATGGAGGG + Intronic
1103184866 12:118948002-118948024 TGGATGGGTGAATAGATGGGTGG - Intergenic
1103849737 12:123924718-123924740 TGGATGGATGAGTAGATGGGTGG - Intronic
1104425676 12:128675697-128675719 TGGATATGTGAATAGATGGGTGG + Intronic
1104925766 12:132313325-132313347 TGGATGGGTGAGTGGATGGGTGG - Intronic
1104925828 12:132313542-132313564 TGGATGGGTGGGTAGATGGGTGG - Intronic
1104968149 12:132518814-132518836 TGGATGGACGGGTAGATGGGTGG - Intronic
1105362709 13:19735336-19735358 TGGGTAGGTGAGTAAATGGGTGG + Intronic
1105401886 13:20103646-20103668 TATATAGAGGACTAGATGGGGGG - Intergenic
1105586020 13:21743480-21743502 TGAATGGGTGAGTGGATGGGTGG - Intergenic
1107399818 13:40058484-40058506 TTTATAGAAGAGTAGATGGCCGG - Intergenic
1113493083 13:110707193-110707215 TGTATTGGGGTGTAGATGTGTGG - Intronic
1113581810 13:111435245-111435267 TGGATAGGTGAATAGATGGATGG + Intergenic
1120751009 14:88198375-88198397 TGGATAGGTGAGCAGCTGGGAGG - Intronic
1121554571 14:94826495-94826517 TGTATGGACGAATGGATGGGTGG + Intergenic
1122636951 14:103134524-103134546 TGGATGGATGAGTAGATGGGTGG - Intronic
1122751577 14:103937664-103937686 TGTAGAGTTGAGTACATGGGTGG + Intronic
1122879832 14:104685778-104685800 TGAATGGGTGAGTAGGTGGGTGG + Intergenic
1122923738 14:104890539-104890561 TGGATGGGTGAGTAGGTGGGTGG + Intronic
1122958499 14:105083747-105083769 TGGATAGAGGAGTGGATGGGTGG - Intergenic
1123406644 15:20023486-20023508 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1123515974 15:21030134-21030156 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1128706864 15:69843019-69843041 TGGATAGGTGGGTAGGTGGGTGG - Intergenic
1128773761 15:70303122-70303144 TGGATAGATGAGTGGATGGGTGG + Intergenic
1129056419 15:72823583-72823605 GGTATGGGAGAGCAGATGGGTGG + Intergenic
1130033839 15:80340628-80340650 TGGATATGAGAGTAGATTGGAGG + Intergenic
1130649368 15:85753453-85753475 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1130649372 15:85753465-85753487 TGGATGGGTGGGTAGATGGGTGG + Intergenic
1132057990 15:98666943-98666965 TGTTTATGCGAGTATATGTGTGG + Intronic
1132351438 15:101142002-101142024 TGGATAGATGGGTAGATGGGTGG - Intergenic
1132351505 15:101142305-101142327 TGGATAGGTGAGTGGAGGGGTGG - Intergenic
1132351511 15:101142325-101142347 TGAATAGGTGGGTAGAGGGGTGG - Intergenic
1132351539 15:101142437-101142459 TGGATAAGTGGGTAGATGGGTGG - Intergenic
1132644753 16:993757-993779 TGGATGGGTGAGTAAATGGGTGG - Intergenic
1132644808 16:993963-993985 TGGATGGGTGAGTAGGTGGGTGG - Intergenic
1133111638 16:3551406-3551428 TGAATGGGTGAATAGATGGGTGG - Intronic
1133317320 16:4892758-4892780 TGTATAGGAAAGGAGGTGGGGGG + Intronic
1133416613 16:5612070-5612092 TGGATGGGAGAGTAGGTGGGTGG - Intergenic
1133454366 16:5930252-5930274 TGTATAGATGGGTAGGTGGGAGG + Intergenic
1134446958 16:14338263-14338285 TGGATAGGTGAGTGGATGGATGG - Intergenic
1134447049 16:14338592-14338614 TGGATAGGTGGGTGGATGGGTGG - Intergenic
1134515325 16:14882243-14882265 TGTATATACGGGTAGAGGGGAGG + Intronic
1134636980 16:15800077-15800099 TGAGTAGGTGAGTAGGTGGGTGG + Intronic
1134636992 16:15800129-15800151 TGGATAGATGAGTAGATGGATGG + Intronic
1134637058 16:15800457-15800479 TGTGTAGATGGGTAGATGGGTGG + Intronic
1134702998 16:16280888-16280910 TGTATATACGGGTAGAGGGGAGG + Intronic
1134964545 16:18431227-18431249 TGTATATACGGGTAGAGGGGAGG - Intronic
1134968832 16:18513762-18513784 TGTATATACGGGTAGAGGGGAGG - Intronic
1135600813 16:23781901-23781923 GGTATGGGTGGGTAGATGGGGGG + Intergenic
1135614214 16:23896956-23896978 TGGATGGGTGGGTAGATGGGTGG - Intronic
1135828839 16:25755032-25755054 TGGATAGGTGGGTGGATGGGTGG - Intronic
1136279073 16:29197503-29197525 TGAATAGTTGGGTAGATGGGTGG + Intergenic
1136295401 16:29298713-29298735 TGGATAGACGAGTGGACGGGTGG + Intergenic
1136295440 16:29298913-29298935 TGGATAGACGAGTGGACGGGTGG + Intergenic
1137560151 16:49497187-49497209 TGGATGGGTGAGTGGATGGGTGG - Intronic
1137560159 16:49497215-49497237 TGGATAGATGAATAGATGGGCGG - Intronic
1140043606 16:71425443-71425465 GGGATGGGCGAGTGGATGGGTGG - Intergenic
1140067738 16:71625543-71625565 TGAGTGGGCGGGTAGATGGGTGG + Intergenic
1141578424 16:84980856-84980878 GGTATCGGAGAGTAAATGGGTGG - Intronic
1141650098 16:85388269-85388291 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1141650118 16:85388349-85388371 TGGATGGGTGAGTGGATGGGCGG + Intergenic
1142083477 16:88163651-88163673 TGGATAGTTGGGTAGATGGGTGG + Intergenic
1142083604 16:88164240-88164262 TGAATAGTTGGGTAGATGGGTGG + Intergenic
1142101325 16:88272879-88272901 TGGATAGACGAGTGGACGGGTGG + Intergenic
1142152217 16:88517620-88517642 TGGATAGGTGGGTAGATGGATGG + Intronic
1142152839 16:88520344-88520366 TGGATAGATGAATAGATGGGTGG + Intronic
1142152858 16:88520436-88520458 TGGATAGGTGGGTAGATGGATGG + Intronic
1142638905 17:1273748-1273770 TGTTTTGGAGAGTAAATGGGAGG + Intergenic
1145897598 17:28469474-28469496 TGGATGGGTGGGTAGATGGGTGG - Intronic
1148685510 17:49498365-49498387 TGGATAGGGGAGGAGTTGGGAGG - Intronic
1148781643 17:50125519-50125541 TGAGTAGGCAAGTAGATAGGTGG - Intronic
1150631383 17:66882750-66882772 TGGATTGGTGAGTGGATGGGCGG + Intronic
1151973313 17:77470282-77470304 TGGGTGGGTGAGTAGATGGGTGG - Intronic
1151973317 17:77470298-77470320 TGGATGGGTGAGTGGATGGGTGG - Intronic
1152767221 17:82148063-82148085 TGGATGGGTGGGTAGATGGGTGG + Intronic
1153944597 18:10008131-10008153 TGGATAGGTGGGTAGATAGGTGG - Intergenic
1153944614 18:10008212-10008234 TGAATAGGTGAGTGGATGGTTGG - Intergenic
1153944618 18:10008236-10008258 TGAATAGGTGGGTGGATGGGTGG - Intergenic
1153944643 18:10008340-10008362 TGAATAGGTGGATAGATGGGTGG - Intergenic
1157592939 18:48846676-48846698 TGAATAGGTGAGTAGATAGATGG + Intronic
1160236710 18:77091611-77091633 TGTATAGGGGTGTGGGTGGGTGG - Intronic
1160297366 18:77650546-77650568 TGTATGGGTGGGTAGATGGATGG - Intergenic
1160687303 19:442868-442890 TGGATAGATGAGTGGATGGGTGG + Intronic
1160692233 19:465420-465442 TGGGTAGGTGAGTAGATGGTTGG + Intronic
1160692417 19:466102-466124 TGTATGGGTGAATAGATGGGTGG + Intronic
1160767865 19:816430-816452 TGGGTAGGTGGGTAGATGGGTGG - Intronic
1160926794 19:1550326-1550348 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1161090378 19:2357207-2357229 TGGATAGGTGTGTGGATGGGTGG - Intergenic
1161165317 19:2783674-2783696 TTTGTGGGTGAGTAGATGGGTGG - Intergenic
1161565455 19:4999685-4999707 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565507 19:4999881-4999903 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565525 19:4999953-4999975 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565575 19:5000138-5000160 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565598 19:5000217-5000239 TGGATAGGTGGGTGGATGGGTGG - Intronic
1161858075 19:6777161-6777183 TGGATAGATGAGTAGACGGGTGG - Intronic
1162388912 19:10377743-10377765 TGGATAGGTGGGTGGATGGGTGG + Intronic
1162672762 19:12271519-12271541 TGTAGAGGTGACTAGATGTGTGG - Intronic
1162685402 19:12378894-12378916 TGTAGAGGTGACTAGATGTGTGG - Intergenic
1163675783 19:18654621-18654643 TGTATAGGTGAGTTAATGGATGG - Intronic
1164286698 19:23823245-23823267 TGTATTGGGGAGGAAATGGGAGG - Intronic
1164701372 19:30287308-30287330 TGAATAGATGAGTGGATGGGTGG + Intronic
1164816346 19:31206286-31206308 TGGATGGGTGAATAGATGGGTGG + Intergenic
1164920445 19:32085078-32085100 TGGATAGGTGGGTAGGTGGGTGG + Intergenic
925119374 2:1405435-1405457 TGGATAGATGAGTAGATGGGTGG - Intronic
925170973 2:1750429-1750451 TGAATAGGTGAGTTGATGGGTGG - Intergenic
925347844 2:3183193-3183215 TGGATGGGTGAGTGGATGGGTGG - Intergenic
925978413 2:9156870-9156892 TGTATGGGTGTGTAGATGGGTGG + Intergenic
926050323 2:9740313-9740335 TGGATGGGTGAATAGATGGGTGG - Intergenic
931635765 2:64339497-64339519 TGTATAGGACAGGAGAAGGGTGG - Intergenic
931810011 2:65845572-65845594 TGGGAAGGGGAGTAGATGGGTGG - Intergenic
933593384 2:84258320-84258342 TTTAGAGGTGAGAAGATGGGTGG - Intergenic
937229073 2:120386809-120386831 TATATAAGTGAGTGGATGGGTGG - Intergenic
937234070 2:120419845-120419867 TGGATAGGTGGGTAGAGGGGTGG - Intergenic
937418828 2:121738142-121738164 TGTAAATGCGAGGGGATGGGCGG + Intronic
937883195 2:126883479-126883501 TGAATAGGTGGGTTGATGGGTGG - Intergenic
938169587 2:129063051-129063073 TGGATGGGTGGGTAGATGGGTGG - Intergenic
943212384 2:184984381-184984403 TCTTTAGGAGAGTAGATGGAAGG - Intergenic
947836023 2:233176354-233176376 TGGATAGGCGAATGGATAGGTGG + Intronic
948375309 2:237517038-237517060 TGGATAGGTAAGTGGATGGGTGG + Intronic
948375316 2:237517066-237517088 TGGATAGGTAAGTGGATGGGTGG + Intronic
948899841 2:240950719-240950741 TGGATGGGCAAGTGGATGGGTGG - Intronic
1168848709 20:961972-961994 TGGATAGGAGGGTAGATGGGAGG - Intronic
1169245154 20:4019101-4019123 GGTATAAGGGAGGAGATGGGAGG - Intergenic
1169728113 20:8757980-8758002 TGTTTACCCCAGTAGATGGGAGG + Intronic
1172196170 20:33093231-33093253 TGGATAGGTGGGTTGATGGGTGG - Intronic
1172899095 20:38320995-38321017 TGGATGGGTAAGTAGATGGGAGG + Intronic
1174291462 20:49511958-49511980 TGGATGGATGAGTAGATGGGTGG + Intronic
1174291529 20:49512334-49512356 TGGATAGATGAGTGGATGGGTGG + Intronic
1174888179 20:54358982-54359004 TGTGTGGGTGAGTAGATGGAGGG + Intergenic
1175189785 20:57203494-57203516 TGGATGGATGAGTAGATGGGTGG + Intronic
1175515889 20:59569533-59569555 TGGATGGATGAGTAGATGGGTGG + Intergenic
1176129868 20:63492163-63492185 TGTATGGGTGGGTAGGTGGGTGG + Intronic
1179715398 21:43284239-43284261 TGGATAGATGAATAGATGGGTGG - Intergenic
1179726319 21:43343385-43343407 TATATAGGCCAGGAGAGGGGAGG - Intergenic
1181822553 22:25487311-25487333 TGGGTAGGTGAGTGGATGGGTGG + Intergenic
1182009372 22:26987532-26987554 TGAATAGATGAGTAGATGGATGG + Intergenic
1182009417 22:26987748-26987770 TGAATGGGTGAGTGGATGGGTGG + Intergenic
1182072131 22:27470994-27471016 TGAATGGGCGGGTAGATGGATGG + Intergenic
1182734396 22:32521054-32521076 TGTATAGGCGAGTAGATGGGAGG + Intronic
1183261789 22:36800083-36800105 TGGATGGGTGAGTAGATGGGTGG - Intergenic
1183261838 22:36800257-36800279 TGGATGGGTGAGTAGATGGGTGG - Intergenic
1183660942 22:39220772-39220794 TGGATGGGCGGGTGGATGGGTGG + Intergenic
1184444534 22:44539625-44539647 TGGATAGGTGGGTGGATGGGTGG + Intergenic
1184444594 22:44539864-44539886 TGGATAGGTGAGTGGATGGATGG + Intergenic
1184444634 22:44540019-44540041 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1184731231 22:46372208-46372230 TGGATGGGTGAGTAGATGGATGG - Intronic
949212715 3:1524915-1524937 TAGATAGGCGAATAGATGTGTGG - Intergenic
950116501 3:10453924-10453946 TGGATGGGTGGGTAGATGGGTGG - Intronic
950121961 3:10488017-10488039 TGAATGAGTGAGTAGATGGGTGG - Intronic
950173429 3:10854918-10854940 TGAATAGGTGAATAGATGGATGG + Intronic
950541823 3:13617647-13617669 TGGATGGGTGGGTAGATGGGTGG - Intronic
951706366 3:25547725-25547747 TGTATGGATGAGTAGATGGATGG + Intronic
952307697 3:32160403-32160425 TGGATGGGTGAGTGGATGGGTGG + Intronic
954714862 3:52521945-52521967 TGTACAGGTAAGCAGATGGGCGG + Exonic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
956744644 3:72301758-72301780 TGGATAGGTGGGTGGATGGGAGG + Intergenic
957477591 3:80746429-80746451 TGGATGGGTGAGTAGGTGGGTGG + Intergenic
959619730 3:108386882-108386904 GGTAGAACCGAGTAGATGGGTGG + Intronic
962261631 3:133912838-133912860 TGAATGGGTGAGTTGATGGGTGG + Intergenic
962754055 3:138455028-138455050 TGAACAGGTGAGCAGATGGGTGG + Intronic
965363689 3:167772342-167772364 TTCATAGGTGAGTGGATGGGAGG - Intronic
965957462 3:174388686-174388708 TGTATAGGCCCGTAGGTGGCAGG - Intergenic
966431194 3:179832780-179832802 TAGATAGATGAGTAGATGGGCGG - Intronic
968928152 4:3560813-3560835 TGGATAGGTGAGTGGGTGGGTGG - Intergenic
969510375 4:7614270-7614292 TGGATGGGTGAGTGGATGGGTGG - Intronic
969523091 4:7690172-7690194 TGGATAGACGAGTAGATGGATGG + Intronic
969524101 4:7695473-7695495 TGGATGGGTGAGTGGATGGGTGG + Intronic
969565456 4:7974645-7974667 TGGATAGGTGGGTAGGTGGGTGG - Intronic
969612360 4:8234531-8234553 TGTATAGGTGGGTGGATGGATGG - Intronic
971484556 4:27146067-27146089 TGTATAGGTGGGGAGATGGAGGG + Intergenic
972733312 4:41815976-41815998 TGGATAGGTGAATGGATGGGTGG + Intergenic
973788429 4:54356802-54356824 TTGTTAGGCGAGTATATGGGAGG - Intergenic
974188523 4:58472355-58472377 TGTATGGGGGAGTAGGTGTGTGG - Intergenic
980178141 4:129371815-129371837 TGTGTAGGAGAGGAGATGGGAGG + Intergenic
981807050 4:148728759-148728781 TGTATAGGCCAATGGGTGGGAGG + Intergenic
983502860 4:168519782-168519804 TGTCTAGGTATGTAGATGGGAGG - Intronic
985560518 5:583903-583925 TGGGTGAGCGAGTAGATGGGTGG + Intergenic
985560553 5:584019-584041 TGGATGGGTGAGTGGATGGGTGG + Intergenic
985663021 5:1166693-1166715 TGGATAGGTGGGTAGATGGATGG - Intergenic
985869150 5:2540149-2540171 TGGATGGGCGAATAGATGGATGG - Intergenic
987150822 5:15037947-15037969 TGTATAGGGGATTATATGTGGGG + Intergenic
987413515 5:17638220-17638242 TATATAGGGGAGAAGATGGCAGG + Intergenic
989220421 5:38954829-38954851 TGTATAGGCAGGTAGACGTGAGG + Exonic
989524220 5:42434490-42434512 TTTATAGGTGAGGAAATGGGAGG + Intronic
990448012 5:55910827-55910849 CATATAGGTGAGGAGATGGGAGG + Intronic
992672956 5:79077827-79077849 TGTGTGGGCGTGTGGATGGGTGG - Intronic
994433459 5:99697973-99697995 TGGATAGGTAAGTAGCTGGGTGG - Intergenic
995845951 5:116494013-116494035 TCTCTTGGCGAGTAGATGGATGG - Intronic
1000381901 5:160636940-160636962 TAGATGGGTGAGTAGATGGGTGG - Intronic
1000381938 5:160637100-160637122 TAGATGGGTGAGTAGATGGGTGG - Intronic
1001088975 5:168723111-168723133 TGAATAGGTGGGTGGATGGGTGG - Intronic
1001329876 5:170754516-170754538 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1001833695 5:174811622-174811644 TGGGTAGGTGAGTGGATGGGTGG - Intergenic
1001840374 5:174871209-174871231 TGGATAGGTGAGTGGGTGGGTGG - Intergenic
1002303319 5:178269630-178269652 TGGATTGGTGAGTGGATGGGTGG - Intronic
1002917976 6:1544264-1544286 TGGATGGGTGAGTGGATGGGTGG + Intergenic
1002917988 6:1544312-1544334 TGTATGGATGAGTGGATGGGTGG + Intergenic
1005157953 6:22829255-22829277 TGTATAGGTAAGTAGGTAGGTGG - Intergenic
1006299781 6:33187524-33187546 TGGATAGATGAGTGGATGGGTGG + Intronic
1013309428 6:108879510-108879532 TGGATAGATGGGTAGATGGGTGG - Intronic
1014485521 6:121994311-121994333 TGGATAGGGGAATGGATGGGTGG + Intergenic
1019489572 7:1305922-1305944 TGGATGGGTGGGTAGATGGGTGG - Intergenic
1019555808 7:1630752-1630774 TGTGTGGATGAGTAGATGGGTGG - Intergenic
1019555879 7:1631077-1631099 TGAATAGGTGGGTAGATGGGTGG - Intergenic
1019567189 7:1690150-1690172 TGGATAGGTGAGTGGATGGATGG + Intronic
1020110910 7:5447284-5447306 TGGATGGATGAGTAGATGGGTGG + Intronic
1026581386 7:71621448-71621470 TGAATAGGCGGGTGGATGGATGG + Intronic
1026904260 7:74053848-74053870 TGGATAGGTGAGTGGATGGATGG + Intronic
1027163791 7:75820779-75820801 TGGATAGATGAGTAGATGGGTGG - Intronic
1032438354 7:131920905-131920927 TGTGTAGGTGGGTGGATGGGTGG + Intergenic
1034697223 7:153064600-153064622 TGGATAGGTGAGTAGATGGATGG - Intergenic
1035288525 7:157821992-157822014 TGGATAGATGAGTAGATGGATGG - Intronic
1035290731 7:157837085-157837107 TGGATAGGTGGGTGGATGGGTGG - Intronic
1035318679 7:158014216-158014238 TGAATGGGTGAATAGATGGGTGG - Intronic
1048296989 8:133221674-133221696 TAGATGGGTGAGTAGATGGGTGG + Intronic
1049223536 8:141438818-141438840 TGAATGGGTGAGTAGATGGATGG + Intergenic
1049364600 8:142231019-142231041 TGGATAGGTGGGTAGATGGATGG - Intronic
1049375071 8:142285470-142285492 TGCATGGGTGGGTAGATGGGTGG + Intronic
1049416059 8:142495876-142495898 TGGATGGATGAGTAGATGGGTGG + Intronic
1049416145 8:142496249-142496271 TGGATGGGTGAATAGATGGGTGG + Intronic
1049474893 8:142792530-142792552 TGGATAGATGAGTAGATGGATGG - Intergenic
1049477174 8:142802130-142802152 TGGATGGGAGGGTAGATGGGTGG + Intergenic
1050009568 9:1172045-1172067 TGAATAGGCGAGTAGGCGAGAGG + Intergenic
1051210764 9:14740133-14740155 TGGATAGGCAAGTATCTGGGAGG - Exonic
1053802948 9:41775621-41775643 TGGATGGGCGGGTGGATGGGTGG - Intergenic
1053803021 9:41775923-41775945 TGGATAGGTGAGTGGGTGGGTGG - Intergenic
1054142242 9:61539199-61539221 TGGATAGGTGAGTGGGTGGGTGG + Intergenic
1054191246 9:61986951-61986973 TGGATGGGCGGGTGGATGGGTGG - Intergenic
1054191310 9:61987233-61987255 TGGATAGGTGAGTGGGTGGGTGG - Intergenic
1054461990 9:65470346-65470368 TGGATAGGTGAGTGGGTGGGTGG + Intergenic
1054647059 9:67600484-67600506 TGGATAGGTGAGTGGGTGGGTGG + Intergenic
1054647123 9:67600766-67600788 TGGATGGGCGGGTGGATGGGTGG + Intergenic
1054954188 9:70889156-70889178 TTTAAAGGCTAGGAGATGGGTGG + Intronic
1057061640 9:92009214-92009236 TGGATAGGTGAGTGGGTGGGTGG + Intergenic
1059154317 9:111976455-111976477 TGTAAATGTGCGTAGATGGGAGG - Intergenic
1061071666 9:128314546-128314568 TGGATCGTCGAGTAGCTGGGAGG + Intronic
1061256537 9:129456833-129456855 TGGATGGATGAGTAGATGGGTGG + Intergenic
1061256607 9:129457171-129457193 TGGATGGATGAGTAGATGGGTGG + Intergenic
1061256666 9:129457437-129457459 TGAATGGATGAGTAGATGGGTGG + Intergenic
1061387583 9:130299615-130299637 TGGATGGGTGAGTGGATGGGTGG - Intronic
1061387615 9:130299747-130299769 TGGATAGGTGAGTGAATGGGTGG - Intronic
1061584489 9:131557098-131557120 TGTATGGATGAGTAGATGGATGG - Intergenic
1061846858 9:133392965-133392987 TGGGTAGGTGAGTAGATGGATGG + Intronic
1061846965 9:133393377-133393399 TGGGTAGGTGAGTAGATGGATGG + Intronic
1062172233 9:135141294-135141316 TGGATAGGTGAATAGATGAGTGG + Intergenic
1062210648 9:135361959-135361981 TGGATAGGTGAATGGATGGGTGG + Intergenic
1062210688 9:135362123-135362145 TGGATAGGTGAATGGATGGGTGG + Intergenic
1062247710 9:135577997-135578019 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1185580959 X:1211330-1211352 TGTATTGGTGGGTGGATGGGTGG + Intronic
1185624490 X:1472820-1472842 TGTATAGATGAGTAGGTGGATGG + Intronic
1185624754 X:1473916-1473938 TGTATAGATGAGTAGGTGGATGG + Intronic
1185624962 X:1474827-1474849 TGTATGGGTGTGTAGATGGGTGG + Intronic
1185639356 X:1578169-1578191 TGGATAGATGAGTGGATGGGTGG + Intergenic
1185808583 X:3083123-3083145 TGAGTAGGTGAGTAGATAGGTGG - Intronic
1185883271 X:3759256-3759278 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1185883297 X:3759383-3759405 TGGATGGGTGAGTGGATGGGTGG - Intergenic
1189760788 X:44319568-44319590 TTTATAGGCAAGTATTTGGGAGG - Intronic
1191127815 X:56975938-56975960 TTTATAGGGTAGTAAATGGGAGG + Intergenic
1193834673 X:86326944-86326966 TGAATACATGAGTAGATGGGTGG - Intronic
1196988453 X:121300811-121300833 TGGATAGGTGAATGGATGGGTGG - Intergenic
1199387023 X:147234824-147234846 TGTATATGTGAGTGGGTGGGTGG - Intergenic
1201070500 Y:10143629-10143651 GGTATTGGTGAGTATATGGGAGG - Intergenic
1201305843 Y:12550068-12550090 TGAATAGGTAAGTAGATGGATGG + Intergenic
1201900926 Y:19045615-19045637 TAGATAGGTGAGTGGATGGGTGG + Intergenic