ID: 1182736307

View in Genome Browser
Species Human (GRCh38)
Location 22:32533963-32533985
Sequence GTGGATTCACATGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 3, 2: 2, 3: 14, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182736302_1182736307 12 Left 1182736302 22:32533928-32533950 CCTGGGAAAGTGGGGAAGCGGGT 0: 1
1: 0
2: 2
3: 17
4: 216
Right 1182736307 22:32533963-32533985 GTGGATTCACATGGAAAAACAGG 0: 1
1: 3
2: 2
3: 14
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182736307 Original CRISPR GTGGATTCACATGGAAAAAC AGG Intronic
901112699 1:6810931-6810953 GAGGATGCAGATGGAAAAACGGG + Intronic
902117054 1:14129720-14129742 GAGCCATCACATGGAAAAACAGG + Intergenic
902446147 1:16465857-16465879 GAGGACACACATGGAAACACAGG - Intergenic
904982651 1:34519670-34519692 GTGAATTCTCCTGGCAAAACAGG - Intergenic
905499267 1:38423713-38423735 GTGGATCCAGATGGATATACTGG + Intergenic
907943056 1:59107522-59107544 GAGGATACATATGGAAAAATTGG + Intergenic
911315942 1:96356919-96356941 TTGGATTTACACAGAAAAACTGG + Intergenic
914907801 1:151761116-151761138 GTAGATTCACAAAGAGAAACAGG + Intronic
918808543 1:189083695-189083717 GTTTAGTCACATGGAAGAACTGG - Intergenic
920253187 1:204636306-204636328 GTGGATTCACATGCACACAGAGG + Intronic
920529205 1:206689595-206689617 GAGGATACACATGTAAAAAATGG + Intronic
921569981 1:216766124-216766146 GTGCACTCACATGGAAAAACTGG + Intronic
921605681 1:217151699-217151721 TTGGATGCACAGGGAAAAAAAGG - Intergenic
923565120 1:235070668-235070690 GTTCAGTCCCATGGAAAAACTGG + Intergenic
924083217 1:240420889-240420911 TTGGATTTATTTGGAAAAACAGG + Intronic
924165336 1:241275596-241275618 GTGGACTCAGATGGGAAAACAGG + Intronic
924635829 1:245786766-245786788 GTTGTTTCACATAGAAAATCTGG + Intronic
1065319317 10:24494431-24494453 GTGCATTCACCCGGACAAACTGG + Intronic
1066740344 10:38514007-38514029 ATGGACTCTAATGGAAAAACTGG + Intergenic
1067420168 10:46138341-46138363 GGGGTTTCATAAGGAAAAACAGG + Intergenic
1067425852 10:46211179-46211201 GGGGTTTCATAAGGAAAAACAGG - Intergenic
1067505514 10:46844829-46844851 GGGGTTTCATAAGGAAAAACAGG + Intergenic
1068223169 10:54069251-54069273 GTGGATTGACAGGTAAAGACAGG - Intronic
1069592674 10:69651681-69651703 GTGGATCCTCAGGGAATAACAGG - Intergenic
1071476334 10:86028560-86028582 GCAGATTCACATGGAATAGCTGG + Intronic
1071611097 10:87031661-87031683 GGGGTTTCATAAGGAAAAACAGG + Intergenic
1072741876 10:97914687-97914709 GTGGAACCAGATGGAAAAAGAGG - Intronic
1073556762 10:104460937-104460959 GGAAATTCACATGGAAAAAAGGG - Intergenic
1073721164 10:106173954-106173976 GAGGAGTCAAATGGAAGAACAGG - Intergenic
1074208801 10:111308910-111308932 GTGAATTTACATGGAAAGAGAGG - Intergenic
1075313448 10:121433359-121433381 TTGGATTCACTTGGGAGAACTGG - Intergenic
1076026055 10:127114361-127114383 TTGGATTCACATGGGGAAATTGG + Intronic
1078422010 11:11220225-11220247 GAAGATTCACATGGAGAAAGTGG - Intergenic
1078460563 11:11512149-11512171 GCGGTTTCAGATGGAAAAATTGG - Intronic
1078610133 11:12812703-12812725 GTGGATTCACATGTACCAAGAGG - Intronic
1081706596 11:45185628-45185650 GAGGGTTCACATGGAGATACTGG + Intronic
1083014670 11:59440668-59440690 GTAGAGTCACATGGAGAAACTGG - Intergenic
1083493289 11:63028720-63028742 GGGGACTCAGATGGAAAAAGTGG - Intergenic
1088383439 11:109222250-109222272 GTAGTTTTACATGGAAAAAATGG - Intergenic
1090014716 11:123075717-123075739 GTGGGTTCAGATGGTAAAACTGG + Intronic
1095189907 12:39245846-39245868 GTGGCATCACTTGGAAAAGCAGG + Intergenic
1096579939 12:52578467-52578489 TTGGACTAGCATGGAAAAACAGG - Intergenic
1096942228 12:55359399-55359421 GTGTATTCACATAGGAAAAGAGG + Intergenic
1097448164 12:59701264-59701286 GTGGTTTCATCTGTAAAAACAGG - Intronic
1098178848 12:67823595-67823617 GTGGATCCCCATTGAACAACTGG - Intergenic
1099089651 12:78289755-78289777 GTGGATTCACATGACACATCAGG - Intergenic
1100287208 12:93178290-93178312 GTGGCTTCACAGTTAAAAACAGG - Intergenic
1100889211 12:99105288-99105310 GTGTGTACACATGAAAAAACGGG - Intronic
1100890537 12:99120792-99120814 GGGCATCCACGTGGAAAAACAGG + Intronic
1101717307 12:107321705-107321727 GGGGATTCACCTGCAAAACCTGG + Intronic
1104453129 12:128887476-128887498 GTGTACTCACATAGAAAGACTGG - Intronic
1105637899 13:22233251-22233273 GTGGATTCACATTGTTAAAGAGG - Intergenic
1108647973 13:52449673-52449695 CTGGATTGAAATGGATAAACTGG - Intronic
1109072084 13:57783213-57783235 GAGTATTCAAATAGAAAAACAGG - Intergenic
1109939819 13:69346957-69346979 GTGAATTGATATGGAAAAATTGG + Intergenic
1111662071 13:91224074-91224096 TTGTAGTGACATGGAAAAACAGG - Intergenic
1113206848 13:107926434-107926456 ATGGATGCACCTGGAAAATCGGG - Intergenic
1114463194 14:22901462-22901484 GACGATACACATGGAGAAACAGG + Exonic
1114729815 14:24980449-24980471 GTTGAATTACATGGAAAAACTGG - Intronic
1117964653 14:61194453-61194475 GTGTCTTCACATGGTAGAACGGG - Intronic
1118169216 14:63369708-63369730 GAATATCCACATGGAAAAACTGG + Intergenic
1118999258 14:70866343-70866365 GTTGATTCACAGGAATAAACAGG + Intergenic
1119209918 14:72823940-72823962 GTGGATGCATTTGGACAAACAGG + Intronic
1119273612 14:73332059-73332081 CTGGACTCAAATGGAAAAAAAGG - Intronic
1119372202 14:74156320-74156342 GTAGATTGACATGTAAAAAAGGG - Intronic
1121993230 14:98581746-98581768 GAGGCTGCACATGGCAAAACTGG + Intergenic
1122647487 14:103204928-103204950 GTGGATTAACATCCAAAAACTGG + Intergenic
1123492326 15:20791412-20791434 GTGGATTCACACAGAAGAGCTGG - Intergenic
1123548828 15:21360499-21360521 GTGGATTCACACAGAAGAGCTGG - Intergenic
1123962276 15:25416486-25416508 GTGGTTACACATGGAAGAAAAGG + Intronic
1126981430 15:54248633-54248655 GTTTATTCAGATAGAAAAACTGG - Intronic
1127010802 15:54625354-54625376 GTGGATCCACAGGGGGAAACTGG + Intronic
1128557476 15:68641522-68641544 GTGAAGTCAGATGGGAAAACAGG + Intronic
1128600517 15:68991685-68991707 GTGGTTTAACATCCAAAAACTGG + Intronic
1129106808 15:73315406-73315428 GTGTATTCCCATGGATGAACAGG - Intergenic
1129794977 15:78369244-78369266 GTGGATGCAGATGGGAAAAGAGG + Intergenic
1202957164 15_KI270727v1_random:87733-87755 GTGGATTCACACAGAAGAGCTGG - Intergenic
1133396007 16:5448024-5448046 GTGGAGTCACATGGGGGAACAGG + Intergenic
1134277414 16:12789104-12789126 CTGGATTCTCTTGGAAAATCTGG + Intronic
1134775128 16:16846296-16846318 ATGGATGCACCTGGAAAATCGGG - Intergenic
1136680278 16:31956679-31956701 GTGGATTTACAAGGAAGAAATGG - Intergenic
1139331763 16:66197820-66197842 GTGGCTTCAAATAGAAAAACAGG - Intergenic
1139841334 16:69883224-69883246 GAGGCTTCAAATAGAAAAACTGG - Intronic
1140628421 16:76822567-76822589 GTCGATTCAGATGGAAAGTCAGG - Intergenic
1140929783 16:79616885-79616907 GTTGGTTCTCATGGAACAACAGG - Intergenic
1142913546 17:3115137-3115159 GAGAATTCACCTGGTAAAACAGG + Intergenic
1145701271 17:26832203-26832225 ATGGAATCAGATGGAAAAAATGG + Intergenic
1145706777 17:26878440-26878462 ATGGAATCAAATGGAAAAAATGG + Intergenic
1147170923 17:38618362-38618384 GGGGATTCACCTGGAAAGGCTGG + Intergenic
1147719545 17:42530440-42530462 GTGGTTTCACATGGTAGAAAGGG + Intergenic
1149977486 17:61280674-61280696 GTGTATTCACATGAAAAGATTGG + Intronic
1152146649 17:78572568-78572590 GTGGCTTCACATGTTAAAGCCGG - Intronic
1153218428 18:2841802-2841824 TTGAAATCACATGGAAAAAAAGG - Intergenic
1154449870 18:14465970-14465992 GTGGATTCACACAGAAGAGCTGG - Intergenic
1155071661 18:22322114-22322136 GTGGAATCACATGGAAGAAGGGG + Intergenic
1155617964 18:27743480-27743502 ATGGACTCACCTGGAAAATCGGG - Intergenic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1158221205 18:55152683-55152705 GTGCCTTCACATGGAAAAGATGG - Intergenic
1158312031 18:56169434-56169456 TTGGACTCACATGGAAACATTGG + Intergenic
1158751769 18:60270298-60270320 GTGGATACACATGGACATAAAGG - Intergenic
1159431803 18:68362270-68362292 ATGGATTGACATGGAACAAGGGG - Intergenic
1159842009 18:73409174-73409196 GTGAATTTAAATGGAAAAAAAGG - Intergenic
1160053806 18:75461117-75461139 GTGTCTTCACATGGCAAAAGGGG + Intergenic
1161345604 19:3767487-3767509 GTGGGGTCACATGGAAACCCAGG - Exonic
1162717752 19:12644547-12644569 GAGGAGTCACATGTTAAAACAGG + Intronic
1163549971 19:17960846-17960868 GAGGATACAGATGGACAAACAGG - Intronic
1164436604 19:28236034-28236056 GTGGGTTCACGTGGGAGAACAGG - Intergenic
1164452521 19:28379155-28379177 GTGGATTCATCAGGAACAACAGG + Intergenic
1164813555 19:31176948-31176970 GTAGAATCACTTGGGAAAACTGG + Intergenic
1165638670 19:37365162-37365184 GAGGATTAACATCCAAAAACTGG + Intronic
927708342 2:25310700-25310722 GGGGATTCACATGGAAGAAAAGG + Intronic
928209897 2:29315754-29315776 GTGGATTCCCAGAGAAGAACTGG - Intronic
930312859 2:49763827-49763849 GTGTCTTCACATGGTAAAATGGG - Intergenic
930633914 2:53784679-53784701 TTGGATACACATGGACACACAGG - Intronic
932136660 2:69237014-69237036 GTGTAATCAGATGGAAAAAGGGG + Intronic
935523846 2:104142384-104142406 ATGGGTTCAAATGGAAAAAGTGG + Intergenic
935940793 2:108237110-108237132 GTCGATTAACATCCAAAAACTGG - Intergenic
936579063 2:113680346-113680368 GTGTTTTCACATGGTAAAAGGGG + Intergenic
936579074 2:113680427-113680449 GTGTTTTCACATGGTAAAAGGGG + Intergenic
937067774 2:119031167-119031189 GTGGCTTCAGAAGGAAAAAAAGG + Intergenic
937703592 2:124892237-124892259 CTGGAATCAGATGGAGAAACTGG + Intronic
938324383 2:130388455-130388477 GTGGGTGGACATGGAGAAACAGG + Intergenic
940192149 2:151053254-151053276 GTGGAATGACATGGAAGAGCTGG - Intergenic
944097679 2:195987626-195987648 GTGGATTTATATGGAAAATATGG - Intronic
945195484 2:207233524-207233546 GTGTCTTCACATGGCAAAAGGGG - Intergenic
945931633 2:215861068-215861090 GAGCATTCACATGGAGAAAGAGG + Intergenic
946030548 2:216700443-216700465 ATGGAATCACATGGAAAAAGAGG + Intergenic
1169763913 20:9128221-9128243 GTGGTGTCACATGGAAAGAGTGG - Intronic
1170136458 20:13079736-13079758 GTGAATTCACCTGGAAAAGATGG - Intronic
1170696750 20:18666010-18666032 GAGGATATAAATGGAAAAACTGG - Intronic
1170825481 20:19790906-19790928 GAGGATTCACATGGAAAGGCAGG - Intergenic
1172583994 20:36069785-36069807 GAGGATTCACATAGAAGAAAAGG - Intergenic
1173913322 20:46687304-46687326 GTAGATATAGATGGAAAAACTGG - Intronic
1174305109 20:49609507-49609529 GTGGATTTACATGGATTAAGGGG + Intergenic
1175603222 20:60291751-60291773 GTGGAGTCACATAAAGAAACAGG - Intergenic
1176446306 21:6824389-6824411 GTGGATTCACATGGAAAAGCTGG + Intergenic
1176824475 21:13689419-13689441 GTGGATTCACATGGAAAAGCTGG + Intergenic
1180894237 22:19316868-19316890 GTGGATTAACATCCAAAGACCGG - Intergenic
1182736307 22:32533963-32533985 GTGGATTCACATGGAAAAACAGG + Intronic
1183847796 22:40556964-40556986 GTGGTTTCACATAGAGTAACAGG + Intronic
1183883181 22:40854432-40854454 GTGGAATCAGAAAGAAAAACTGG + Intronic
1184899613 22:47436766-47436788 GTGGTGTCACATGGCAAAAGAGG - Intergenic
1185195211 22:49465041-49465063 GAGGATTCACGTGGACAGACGGG - Intronic
1185217761 22:49612453-49612475 CTAGATTTAAATGGAAAAACTGG - Intronic
1203291352 22_KI270735v1_random:41986-42008 ATGGAATCAAATGGAAAAAATGG - Intergenic
1203331039 22_KI270738v1_random:89389-89411 ATGGATGCACCTGGAAAATCGGG + Intergenic
949202908 3:1401626-1401648 TTGGATGCATATGGAAACACTGG + Intronic
949544210 3:5058462-5058484 GTGAATTCAAAAGGGAAAACAGG + Intergenic
950263813 3:11560610-11560632 GTGGATCCACAAGGATGAACTGG + Intronic
950847830 3:16031861-16031883 GTGGAATCACATGGCACAAGGGG + Intergenic
951717709 3:25665866-25665888 GTGGAATTACACTGAAAAACAGG - Intergenic
955061589 3:55497081-55497103 GTTGATTAAAATGGACAAACCGG - Intergenic
956126646 3:66017284-66017306 GCGGCTGCAGATGGAAAAACCGG + Intronic
956171319 3:66435869-66435891 GTGGAATCAGATGGAAAGTCTGG + Intronic
957430607 3:80100800-80100822 GTTCATTCACATGGAGAAAGAGG - Intergenic
958954148 3:100449413-100449435 GTGGTTCCATAAGGAAAAACAGG + Intronic
959509211 3:107190582-107190604 GTGGCTTCACATGGCATAAGGGG + Intergenic
959819314 3:110713567-110713589 GTTGATTCACAAGGAAGAAAGGG + Intergenic
962016655 3:131447934-131447956 GTGTCTTCACATGGAAAAAGGGG + Intergenic
966153242 3:176888884-176888906 GTGGTTTCACATGGTAGAAGGGG - Intergenic
967089355 3:186122051-186122073 CTGGGTTCACAAGGAAGAACAGG + Intronic
967316980 3:188158907-188158929 GAGGATTCACATGGACAAACGGG + Intronic
968004145 3:195227983-195228005 GTGGGGGCACATGGAACAACAGG - Intronic
968876578 4:3270942-3270964 GGGGAATCACGTGGAAAAAATGG - Intronic
970984967 4:22146676-22146698 ATGGATGCACCTGGAAAATCGGG + Intergenic
971913611 4:32829038-32829060 GGGGTTCCACAAGGAAAAACAGG + Intergenic
972651802 4:41025062-41025084 GCGGATTAACATCCAAAAACTGG - Intronic
972992203 4:44834532-44834554 GTGTCTTCACATAGAAAAAGGGG + Intergenic
976224889 4:82788094-82788116 GTGTCTTCACATGGCAAAAGGGG - Intronic
978599273 4:110411176-110411198 ACGGATTCACCTGGAAAATCGGG - Intronic
978602479 4:110443371-110443393 TTGGAGTCACAGGGAAAAGCTGG + Intronic
978719797 4:111895050-111895072 ACGGATTCACCTGGAAAATCGGG + Intergenic
979138601 4:117144477-117144499 GTGTCCTCACATGGCAAAACGGG - Intergenic
979701651 4:123675165-123675187 CTGGATTCACATGAAAGAATAGG - Intergenic
979960949 4:127020818-127020840 ATGGACTCACCTGGAAAATCGGG + Intergenic
980334040 4:131445387-131445409 GTAAATTCACATGGCAGAACTGG - Intergenic
980754960 4:137147015-137147037 GTGTCTTCACATGGCAAAAGGGG + Intergenic
981130959 4:141157984-141158006 ATGGATTAACATTTAAAAACTGG + Intronic
982819233 4:159925976-159925998 GTGGATTAACATCCAAAAACTGG + Intergenic
983227530 4:165099029-165099051 CTGGACTCAAATTGAAAAACAGG + Intronic
983937270 4:173510646-173510668 GTGGATTCACAGGGAATCCCAGG - Intergenic
985661292 5:1158140-1158162 CTGGACTGACATGTAAAAACAGG + Intergenic
986225446 5:5807586-5807608 AGGGATTCCCATGGAAACACAGG - Intergenic
988014765 5:25540287-25540309 TTGTATTTACATGGAAAAGCAGG - Intergenic
988536781 5:32075501-32075523 GTGGTATCATATGGAATAACAGG + Intronic
990355907 5:54965918-54965940 TTGGATTCACATGGCAATCCTGG - Intergenic
990355962 5:54966398-54966420 GAAAATTCAGATGGAAAAACAGG - Intergenic
990588158 5:57232738-57232760 GTGTACTCTCATGGCAAAACTGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993114269 5:83701278-83701300 GTAGCTTCACAAGGCAAAACTGG + Intronic
993281774 5:85934217-85934239 GTGGACTAAGATGAAAAAACAGG + Intergenic
995044966 5:107635371-107635393 GTGGTTTGACATTGAAAACCAGG - Intronic
995397898 5:111707704-111707726 GTGAATACACATGGATGAACAGG - Intronic
999742037 5:154563277-154563299 GTAGATTCTATTGGAAAAACTGG - Intergenic
1001192197 5:169641588-169641610 GAGGAATCACATGGAAATCCAGG + Intronic
1002341564 5:178519536-178519558 CTGGCTTCTCTTGGAAAAACTGG - Intronic
1002957528 6:1881682-1881704 GAGGAGTCCCATTGAAAAACTGG - Intronic
1007331061 6:41109149-41109171 GTGCATGCACATGCATAAACAGG + Intergenic
1011105365 6:83773797-83773819 GTGGATTAACATTTAGAAACTGG - Intergenic
1011571197 6:88737663-88737685 GTGTATTCACATGGCACAAGGGG - Intronic
1012277780 6:97294728-97294750 GTTGATTCATATGCAGAAACGGG + Intergenic
1014393807 6:120898557-120898579 TTGGATAAACATGGAAAAGCTGG - Intergenic
1015790353 6:136959056-136959078 CAGCATTCACATGGGAAAACAGG - Intergenic
1016435582 6:144034143-144034165 GTGGTTTTACATGTAAACACAGG - Intronic
1016466520 6:144330832-144330854 ATGGAGTCAAATTGAAAAACAGG - Intronic
1018229277 6:161660503-161660525 GAAGATTCACAAGGAAAAAATGG + Intronic
1019302622 7:315563-315585 GCGGTTTCACAGGGAAAAATAGG - Intergenic
1019537100 7:1534820-1534842 GTGGATGCCCATAGAGAAACGGG - Intronic
1020508475 7:9021961-9021983 GTGTCATCACATGGAAAAATGGG + Intergenic
1021793304 7:24227906-24227928 GAGGAGACACATGGAGAAACAGG - Intergenic
1022929211 7:35093206-35093228 ATGGACTCACCTGGAAAATCGGG + Intergenic
1023197264 7:37655163-37655185 GTGTACTCACATGGTAAAAGGGG + Intergenic
1023416083 7:39934109-39934131 GTGTCTTCACATGGCAAAAGAGG - Intergenic
1027792054 7:82646601-82646623 GTGTATTCAAATAGAAAAAGAGG + Intergenic
1030078683 7:105758656-105758678 GTAGACCCTCATGGAAAAACTGG - Intronic
1030096520 7:105905485-105905507 GTGAATTCACATGAACAAATAGG - Intronic
1030372017 7:108711391-108711413 GTGGATTAACATGGACATACTGG - Intergenic
1030572899 7:111249275-111249297 ATGGATGCACCTGGAAAATCGGG - Intronic
1031207458 7:118778796-118778818 GAGGATTCAAATTAAAAAACCGG + Intergenic
1032150278 7:129423147-129423169 GTGGATTGACGTGGAGAGACAGG - Intronic
1032612208 7:133426955-133426977 TTGGATTCACATTGAAAAGATGG + Intronic
1032944230 7:136831439-136831461 ATGGACGCACATGGAAAATCGGG + Intergenic
1037124517 8:15330635-15330657 GTGAATTCACATGGGAATATGGG - Intergenic
1039102734 8:33958094-33958116 GGGGATTCACATTTAAAAAGTGG + Intergenic
1039229890 8:35432656-35432678 GTGGAATGAGCTGGAAAAACGGG + Intronic
1039843964 8:41312513-41312535 CTGGCTTCTCCTGGAAAAACTGG + Intergenic
1041403429 8:57469218-57469240 AGTGATTCACATGGAAAGACTGG + Intergenic
1041810131 8:61899337-61899359 GTTGGTTCACAGGGATAAACAGG + Intergenic
1041816308 8:61975579-61975601 GTGGAATCACATGGCAGAGCTGG + Intergenic
1043043684 8:75294224-75294246 TTGGATCAAGATGGAAAAACAGG + Intergenic
1043303164 8:78760471-78760493 GGGGAATCAAATGGAAACACAGG - Intronic
1043390976 8:79791321-79791343 GTGGCTTCACTTGGATACACCGG + Intergenic
1045079914 8:98614696-98614718 ATGGATGCACCTGGAAAATCGGG + Intronic
1046308096 8:112397629-112397651 GTGTCCTCACATGGTAAAACTGG + Intronic
1046667649 8:117022391-117022413 CTGGATTCAAATGGCAGAACAGG + Intronic
1050605380 9:7295847-7295869 GTGTCTTCACATGGCAGAACAGG - Intergenic
1050954574 9:11638637-11638659 GGGTATTCAACTGGAAAAACAGG - Intergenic
1051082743 9:13311854-13311876 GAGGAGTATCATGGAAAAACTGG - Intergenic
1052103327 9:24478706-24478728 TTGGATCCACTTGGATAAACTGG - Intergenic
1052386499 9:27829463-27829485 GTGGATTCCCAAGGAGAATCTGG + Intergenic
1052900967 9:33794811-33794833 GTGGCTTCACATTGAAGAAGGGG + Intronic
1058527146 9:105870820-105870842 TAAGATTCAGATGGAAAAACAGG + Intergenic
1059219359 9:112598420-112598442 GGGGAGTGACATGGACAAACTGG + Intronic
1062614060 9:137388113-137388135 GTGGATTCACATCCAAGAGCTGG + Intronic
1203522884 Un_GL000213v1:60141-60163 GTGGATTCACATGGAAAAGCTGG - Intergenic
1187614591 X:20979663-20979685 GTGTCTTCACATGGCAAAAGGGG + Intergenic
1187706558 X:22015111-22015133 TTGGAGACACATGGAGAAACTGG - Intergenic
1189135497 X:38545165-38545187 GTAGCTTCACATGGAAAGATAGG + Intronic
1190834509 X:54087952-54087974 GTGGTTTCAGATTGAGAAACTGG - Exonic
1193351207 X:80466736-80466758 GGGTATTCACATAGAAAAAGAGG + Intergenic
1193898464 X:87144596-87144618 GTGGACTCACATAGAAACAGTGG - Intergenic
1194047376 X:89024847-89024869 GTGTCTTCACATGGCAAAAGGGG + Intergenic
1195389846 X:104350162-104350184 GCTGATGCAAATGGAAAAACTGG + Intergenic
1196245285 X:113392193-113392215 GGGGACACACGTGGAAAAACTGG + Intergenic
1198429385 X:136550214-136550236 CTGGATTCACAGGGAAAATTAGG + Intronic
1198764764 X:140069271-140069293 GTGGTTTCACAGGGTAAAATAGG + Intergenic
1200712540 Y:6500865-6500887 GTGTATTCAAATGGAATAAGCGG - Intergenic
1201021378 Y:9661173-9661195 GTGTATTCAAATGGAATAAGAGG + Intergenic
1201428256 Y:13878162-13878184 GCGGATTAACATCCAAAAACTGG + Intergenic