ID: 1182736967

View in Genome Browser
Species Human (GRCh38)
Location 22:32537657-32537679
Sequence TGTCAGAGCACAGGAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 1, 2: 6, 3: 27, 4: 355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182736960_1182736967 15 Left 1182736960 22:32537619-32537641 CCAATATGCCTGGTCTCCTAATA No data
Right 1182736967 22:32537657-32537679 TGTCAGAGCACAGGAGGGACTGG 0: 1
1: 1
2: 6
3: 27
4: 355
1182736961_1182736967 7 Left 1182736961 22:32537627-32537649 CCTGGTCTCCTAATAATGCTTCC 0: 1
1: 0
2: 1
3: 6
4: 109
Right 1182736967 22:32537657-32537679 TGTCAGAGCACAGGAGGGACTGG 0: 1
1: 1
2: 6
3: 27
4: 355
1182736962_1182736967 -1 Left 1182736962 22:32537635-32537657 CCTAATAATGCTTCCTTGCAGCT 0: 1
1: 0
2: 1
3: 13
4: 158
Right 1182736967 22:32537657-32537679 TGTCAGAGCACAGGAGGGACTGG 0: 1
1: 1
2: 6
3: 27
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182736967 Original CRISPR TGTCAGAGCACAGGAGGGAC TGG Intronic
900268298 1:1772244-1772266 TGTCTGAGCACAGTAGGTAGAGG - Intronic
900324336 1:2100642-2100664 GGACAGGGCACAGGAGGAACAGG + Intronic
900824467 1:4914741-4914763 TGGCAGAGGAGAGGAAGGACAGG + Intergenic
900972856 1:6001067-6001089 TGTCAGGGCACTGCAGGGAGAGG + Intronic
901099279 1:6706847-6706869 TGTCAGAGCTCATGAGGGAGAGG - Intergenic
901296192 1:8162469-8162491 CGTAATATCACAGGAGGGACAGG - Intergenic
902290216 1:15430408-15430430 TGTCAGAGCCTGGGAGGGAAGGG + Intergenic
903217542 1:21851717-21851739 CTTCAGAGAACAGGAGTGACCGG - Intronic
904809326 1:33153067-33153089 TGCCAGAGCAGGGGAGTGACAGG + Intronic
906219871 1:44070002-44070024 ATGCAGAGCACAGAAGGGACGGG - Intergenic
906515169 1:46434695-46434717 TCTAAGAGCACAGCAGGGGCAGG - Intergenic
906917503 1:50026705-50026727 TGTCAGAACACAGGAGCAAGGGG - Intergenic
908639909 1:66211067-66211089 TGACAGAGCACAGCAGGGCAGGG + Intronic
910601319 1:89035388-89035410 TGAGAGAGGCCAGGAGGGACAGG - Intergenic
910680045 1:89853687-89853709 TATCAGGGCACAGAAGGGTCCGG + Intronic
912256020 1:108058931-108058953 TGTCAGAGAACAAGAGGGTATGG - Intergenic
912880221 1:113404787-113404809 TAGCAGAGCACTGGAGGGAAGGG + Intronic
913192735 1:116426915-116426937 TGAGAGAGCACAGGAAGGAGGGG - Intergenic
913296818 1:117329606-117329628 TGTCAGAGCCCAGATGGGATGGG + Intergenic
913937246 1:125065953-125065975 TGTCAGAGAACCAAAGGGACTGG - Intergenic
915358896 1:155273602-155273624 TGTCAGAGCCTCGGAGGTACTGG + Intronic
915953458 1:160205316-160205338 TGTCAGAGCCGGGGAGGGGCGGG - Exonic
916233259 1:162561345-162561367 AGTTAGTGCGCAGGAGGGACCGG + Intergenic
916505459 1:165424665-165424687 TGACAGAGCACAGAGGAGACTGG + Intronic
916857116 1:168761401-168761423 TGGCAGAGCACAGAAGGAAGAGG - Intergenic
917474037 1:175352980-175353002 TGTCAGAGCACCAGAATGACTGG - Intronic
917599331 1:176558975-176558997 AGACAGGACACAGGAGGGACAGG - Intronic
918150065 1:181790710-181790732 TGTCAGAGCACATGAGAAACTGG - Intronic
920195388 1:204223116-204223138 TGTCAGCAGACAGGAGGCACAGG + Intronic
920624921 1:207587600-207587622 TGTTAAAGCATAGGTGGGACCGG + Intronic
921865048 1:220080085-220080107 TGTCAAAGCATAGGAGAAACTGG + Intronic
922452161 1:225746118-225746140 TATCAGAGAACCTGAGGGACTGG - Intergenic
922513294 1:226186987-226187009 TGTCAGTGCCCAGCAGGGGCGGG + Intergenic
922610675 1:226924681-226924703 TAAAAGAGCACAGGAGGGCCTGG - Intronic
922618613 1:226977587-226977609 TCCCAGAGCACAGGTGGGGCTGG - Intronic
923445679 1:234068785-234068807 TGTCCAAGCAGAGGAGTGACAGG + Intronic
1064103076 10:12479702-12479724 TGTCACTGCCCAGGAGGCACGGG + Intronic
1064895198 10:20227772-20227794 TTGCAGGGAACAGGAGGGACAGG + Intronic
1065735051 10:28743825-28743847 TGTCAGAGGGCAGCAGGGACCGG + Intergenic
1066638916 10:37535980-37536002 TGTTAGAGTACAGCAGGGGCTGG + Intergenic
1067163783 10:43848800-43848822 TCTCAGAGGACAGGAGAGATAGG + Intergenic
1067681526 10:48444961-48444983 TGCCGGAGCTCAGGAGGGGCTGG - Intergenic
1067971023 10:50971039-50971061 TGTGATAGCACTGGGGGGACAGG + Intergenic
1067971049 10:50971213-50971235 TGTGATAGCACTGGGGGGACAGG - Intergenic
1068426112 10:56866383-56866405 TGTTTGAGCCCAGGAGGCACAGG + Intergenic
1072270244 10:93769273-93769295 TGAAAGAGCACAGGATGCACAGG - Intronic
1072687377 10:97546291-97546313 TGTCAGGCCACAGGAGGGCCAGG + Intronic
1073491432 10:103855576-103855598 TGGCGGAGCAGAGGAGGGGCGGG + Intergenic
1073830941 10:107382480-107382502 TGTCAAAACACAGGAGGAATAGG - Intergenic
1073927899 10:108538387-108538409 TTGCAGAGCACATAAGGGACAGG - Intergenic
1074581166 10:114720967-114720989 TTTGAGAGCAAAGTAGGGACTGG - Intergenic
1076245931 10:128947821-128947843 TTTCAAAGCACATGAGAGACTGG - Intergenic
1077323492 11:1953189-1953211 TGTCAGAGCATGGGAGGCCCCGG + Intronic
1077446298 11:2592546-2592568 AGCCAGAGCACAGCAGGGGCTGG + Intronic
1078039782 11:7849251-7849273 TGTCAGAGCAGGAGAGGGCCAGG - Intergenic
1078660529 11:13281983-13282005 TAGCAGAACACAGGAGAGACAGG - Intronic
1083295179 11:61711450-61711472 TGTCGGAGCACAGGACTGAGTGG + Intronic
1083352749 11:62042574-62042596 TCTCAGAGAACAGGTGGGAGTGG - Intergenic
1083372949 11:62196076-62196098 TGTTAGGGCGCAGGAGGGAGGGG - Intergenic
1083996886 11:66277290-66277312 GGGCAGGGCACAGGTGGGACAGG - Exonic
1084915430 11:72425679-72425701 AGTCTGAGGCCAGGAGGGACTGG - Intronic
1084960781 11:72715241-72715263 TGCCAGTGCACAGGATGCACGGG + Intronic
1085427232 11:76415330-76415352 AGGCAGTGCCCAGGAGGGACTGG + Intergenic
1085434839 11:76491475-76491497 TGTCAGAACTCAGGCGGGGCTGG - Intronic
1086456819 11:86967509-86967531 TGTCAGAGTACACGGGGGTCAGG + Intergenic
1087045635 11:93841704-93841726 TGTCAGAGGAGAGGAGGGCCTGG - Intronic
1089632275 11:119791307-119791329 TGTCAGAGGACAGGAGGGTCTGG - Intergenic
1089732698 11:120529133-120529155 TGCAAGAGCACATGAGGGTCGGG - Intronic
1090140226 11:124250308-124250330 TGTAAGAGCAAAGGATGGTCAGG - Exonic
1090336905 11:125975021-125975043 TGGCAGTGCACAGGAGGGAAGGG - Intronic
1091208227 11:133834993-133835015 TGGTAGAGCACAGAAGGGAGTGG - Intergenic
1202806480 11_KI270721v1_random:8384-8406 TGTCAGAGCATGGGAGGCCCCGG + Intergenic
1091703225 12:2677630-2677652 TGCCAGGGCCCTGGAGGGACAGG + Intronic
1091918213 12:4284144-4284166 AGTGAGAGCAGAGGAGGGGCAGG + Intronic
1092065236 12:5584582-5584604 TGTAAGAGCACAGCAGGGGAAGG + Intronic
1092586116 12:9903031-9903053 TGTCAGGGCACAGCAAGAACAGG + Intronic
1102615969 12:114154480-114154502 TCTCACAGCACAGGCTGGACAGG + Intergenic
1103503479 12:121423626-121423648 TTTCAATGCACAGAAGGGACTGG + Exonic
1103703229 12:122858649-122858671 TGGCAGAGCACTGAAGGGCCCGG + Intronic
1106093684 13:26623043-26623065 TAGCAGAGCACAGGGGGAACAGG + Intronic
1106099440 13:26681786-26681808 TCTCAGGGAACAGGAGGGCCTGG - Intronic
1108322673 13:49303171-49303193 TGAGAGAGCACAGGAGGGTGAGG + Intergenic
1109145779 13:58777521-58777543 TGTAAAAGCAAAGGAGGGGCTGG - Intergenic
1109186267 13:59272286-59272308 TGCCCAAGCACAGGAGGGATAGG + Intergenic
1109703903 13:66063383-66063405 TGTTAGGGCTCAGGAGGGAGGGG + Intergenic
1110574773 13:77042711-77042733 TGACAAAGCACAGGAAGGAGTGG - Intergenic
1114646542 14:24259421-24259443 TGTCAGAGCCCGGGTGGGAGGGG - Intronic
1115491199 14:33960024-33960046 TATCAGAGCCCAGGAGTGTCTGG - Intronic
1115623860 14:35169949-35169971 TGACAGAACAAAGGAGGAACAGG - Intronic
1115669678 14:35596072-35596094 TGTCAGAGCACACCAAGGCCAGG + Intronic
1117959853 14:61152063-61152085 TGTGAAAGGACAGGAGGGAAGGG + Intergenic
1118983138 14:70732214-70732236 TTTCAGGGCACAGGAAGGGCAGG - Intronic
1120024355 14:79566103-79566125 TGTTAGAGCACAGGGGTGTCAGG - Intronic
1120860358 14:89249774-89249796 TGTGACTGCAGAGGAGGGACAGG + Intronic
1121476802 14:94216359-94216381 TGGCAGAGCATAGGAGGAAGAGG + Intronic
1122087665 14:99318739-99318761 TTTCAGAGCACAGCAGGGGCAGG - Intergenic
1122317707 14:100835663-100835685 ACTCAGACCACAGGAGGGCCAGG - Intergenic
1122649276 14:103216753-103216775 TGTCAGAGAACAGCAGGGCAGGG + Intergenic
1122680131 14:103453896-103453918 TGTCAGAGCACTGGCGGTCCAGG - Intronic
1122692848 14:103539298-103539320 TGGCAGAGCACCAGAGGGCCAGG - Intergenic
1124233516 15:27967210-27967232 GGCCAGAGCCCAGGAGGGAAGGG + Intronic
1124856107 15:33390900-33390922 TGTCCCATCACAGGAGGGAATGG + Intronic
1125414080 15:39434525-39434547 TGACAGAGCTCGGGAAGGACTGG + Intergenic
1128431422 15:67598530-67598552 TGTCAGGGCACAGGCGGGGAAGG - Intronic
1128568745 15:68718334-68718356 TCACAGAGCACAGCAGGGGCAGG - Intronic
1128749712 15:70140250-70140272 TGCCAGAGCAGAGGAGGGGCTGG + Intergenic
1129205127 15:74032945-74032967 TGTCAGAGGCCAGCAGAGACTGG + Intronic
1130042703 15:80418409-80418431 TGTCACAGCACAACAGGGACAGG - Intronic
1130414685 15:83681788-83681810 TGACAGGGCACAGGGGAGACGGG - Intronic
1131562263 15:93454978-93455000 AGTCACAGCGCAGGAGGGACAGG + Intergenic
1132647712 16:1006801-1006823 TTTCTGTGGACAGGAGGGACGGG - Intergenic
1132864655 16:2087420-2087442 AGTCAGAGTCCAGGAGGGGCAGG + Intronic
1133283850 16:4681537-4681559 TGTCAGAGTTCTGTAGGGACAGG - Exonic
1133815257 16:9192480-9192502 TGTCAGAGCAGAACAGGTACAGG - Intergenic
1133868156 16:9663143-9663165 TGTGAGAGCACAGGAGAGAAGGG + Intergenic
1133996932 16:10755334-10755356 TGTAAAAGCACAGGAGTGAAGGG - Intronic
1134656567 16:15952014-15952036 TGTCCGAGGCCAGGAGCGACTGG + Intronic
1136085841 16:27884438-27884460 TCTCAGAGCACAGGCGAGAAAGG - Intronic
1136718041 16:32300989-32301011 TGGCAGGGCACAGGTGGGGCAGG + Intergenic
1136836417 16:33507259-33507281 TGGCAGGGCACAGGTGGGGCAGG + Intergenic
1137537560 16:49339025-49339047 TCTCAGCGTACAGCAGGGACTGG + Intergenic
1137626928 16:49914916-49914938 TGTCCCAGCAGAGGAGGGAGTGG + Intergenic
1138047746 16:53743444-53743466 CGTATGAGCACAGGAGGAACAGG - Intronic
1138141392 16:54571632-54571654 TGGCAGAGCAAAGACGGGACTGG + Intergenic
1138335113 16:56246761-56246783 TGTCAGAGAGGAAGAGGGACAGG - Intronic
1139508158 16:67409958-67409980 TGGCAGAACACAGGGTGGACAGG + Intronic
1140479380 16:75254165-75254187 TTTCGGGGCACAGAAGGGACAGG + Intronic
1141833104 16:86520657-86520679 GGTCAGAGCACGGGAGTCACAGG + Intergenic
1203008387 16_KI270728v1_random:216776-216798 TGGCAGGGCACAGGTGGGGCAGG - Intergenic
1203146599 16_KI270728v1_random:1807560-1807582 TGGCAGGGCACAGGCGGGGCAGG + Intergenic
1143377629 17:6476800-6476822 AGTCAGAGCAGGGCAGGGACAGG + Intronic
1143593653 17:7901115-7901137 TGTCTGAGAACAGGAGGAATTGG + Intronic
1147460040 17:40562495-40562517 TGTCAGAACAGAGGTGGGGCCGG - Intronic
1149874816 17:60221588-60221610 TGTCTGAGCCCAGGAGGCAGAGG - Intronic
1150027595 17:61693196-61693218 TGTCAGTGGACAGGGGGGAGAGG + Intronic
1150558443 17:66274738-66274760 TGTCAGAGCCCAGGAAGTCCAGG - Intergenic
1150750770 17:67860611-67860633 TTTCAGAGCAAAGGATTGACAGG - Intronic
1151457438 17:74234328-74234350 GCTCTGAGAACAGGAGGGACAGG - Intronic
1151666818 17:75549874-75549896 TCCCAGAGCCCAGGAGAGACGGG + Intronic
1151804666 17:76397940-76397962 CTGCAGAGCACAGGAGGGGCTGG - Intronic
1151825675 17:76522933-76522955 TGCCTGAGCACAGGAGGTCCAGG - Intergenic
1152039143 17:77891998-77892020 TCTGAGAGCAGAGGAGGGAGGGG - Intergenic
1152126958 17:78452862-78452884 TGTTAGGGCTCAGGAGGGAGGGG + Intronic
1203163185 17_GL000205v2_random:70530-70552 GGACAGAGCACAGGAAAGACAGG - Intergenic
1153671240 18:7414534-7414556 TGGCAGAGCACAGGGAGGAGGGG + Intergenic
1155870482 18:31020856-31020878 TGTTTGAGCCCAGGAGGTACAGG + Intronic
1157221084 18:45828914-45828936 TGTCACAGCCCAGGAGGAAATGG + Intronic
1158008354 18:52699245-52699267 TGTTAGAGCACAGGTGGGCTGGG + Intronic
1158398521 18:57098704-57098726 TGTCAGAGCAGAGGTTGGGCTGG + Intergenic
1158830871 18:61277291-61277313 TGTCATAGCATAGGAGTGAGGGG + Intergenic
1159102988 18:63975870-63975892 TCTTAGAGCACAGGAGGAAAGGG - Intronic
1160361428 18:78285120-78285142 TGTAAGAGCACAGTATGGAAAGG - Intergenic
1160616967 18:80137767-80137789 TTTCAGAGCACAGCAGGAATAGG + Exonic
1160823587 19:1069138-1069160 TGTTAGAGCACAGGACAGATGGG + Intronic
1160857989 19:1226031-1226053 TGTGAGGACACAGGAGGGCCAGG - Intronic
1161063304 19:2226017-2226039 TGGGAGAGGACAGGAGGGAAGGG - Intronic
1161237020 19:3203397-3203419 TCTCTGAGCCCAGGAGGAACCGG - Intronic
1161517356 19:4703857-4703879 TGGCCGTGCACAGGAGGGGCTGG + Intronic
1161619729 19:5291757-5291779 TTTTAGAGCAGAGGAGGAACGGG - Intronic
1162353514 19:10166101-10166123 TGTCAAAGTACAGGATGGCCAGG - Intronic
1162913155 19:13860842-13860864 GTTCTGAGCAGAGGAGGGACTGG + Intergenic
1162936845 19:13985773-13985795 AGGCAGGGCACAGGAGGGAGAGG + Intronic
1163169311 19:15519663-15519685 TGTTAGAGCATAGGAGTCACAGG + Intronic
1163717309 19:18879777-18879799 TGGCAGAGAAGGGGAGGGACTGG - Intronic
1163821830 19:19500386-19500408 TGTCAGAGGACTGCAGGGGCTGG - Intronic
1164601165 19:29564611-29564633 TGTCAGAGCACAGGAGGGAACGG - Intergenic
1164660689 19:29964135-29964157 TCTCAGACAACAGGAGGCACAGG - Intronic
1164997724 19:32735018-32735040 TGTCAGTGAACAGGAAGGCCTGG - Intronic
1165414076 19:35680596-35680618 TGTCTGAGCACAGGAGGTCGAGG + Intergenic
1165492297 19:36131435-36131457 TGTTAAAGCACAGGAAGGGCTGG + Intergenic
1165678329 19:37748119-37748141 TGTCACAGAACAGAAGAGACTGG + Intronic
1166368420 19:42288916-42288938 TGTCTGAGCTCAGGAGTGTCTGG - Exonic
1166535415 19:43571068-43571090 GCTCCGAGCAGAGGAGGGACAGG - Intronic
1167436425 19:49481190-49481212 GGTCAGAGATCAGGAGGGACCGG + Intronic
1167470384 19:49672461-49672483 TCTCTGAGCAGCGGAGGGACAGG + Intronic
1167555588 19:50193191-50193213 TGTCTGAGCAGAGGAGGGACAGG + Intronic
1168228782 19:55015354-55015376 TGTGAGAGCACAGGAGGGAGAGG - Intronic
925415415 2:3666934-3666956 GGTCAGAACAAAGGAGGAACTGG + Intronic
925709551 2:6725744-6725766 TTTCAAAGCACAGGAAGGAAAGG + Intergenic
927200348 2:20574543-20574565 TTTCAGAGCCCTGGAGGGCCAGG + Intronic
927887096 2:26725289-26725311 TGCAGGAGCACAGGAGAGACTGG - Intronic
928086515 2:28349678-28349700 GGACACAGCAGAGGAGGGACAGG + Intergenic
928392187 2:30918595-30918617 TGACAAAGCACAGGAAGGAAGGG + Intronic
929562233 2:42963080-42963102 TGGCAGACCTCAGGAGAGACTGG - Intergenic
929659465 2:43769630-43769652 TGGCAAAGCACAGGAAGGAAGGG - Intergenic
929796035 2:45058921-45058943 TGTCAGAGGACATGAGGAAGTGG - Intergenic
932172361 2:69568719-69568741 TTTCAGAACATAGGAGGGTCAGG - Intronic
933017584 2:77148611-77148633 TGCCAGAGAACAGGAGGGGAAGG + Intronic
934157292 2:89215158-89215180 TGTCAGAGCCCGGGGGGGAAAGG + Intergenic
934664364 2:96159320-96159342 TGTCAGGGCAGAGGAGGAGCAGG - Intergenic
934710021 2:96508576-96508598 TGGCAGGGCCCACGAGGGACCGG - Intergenic
935664312 2:105496862-105496884 TGTCAAAGGACAGGATGGTCTGG - Intergenic
935690231 2:105724586-105724608 TGTCAGTGCATAGGAGTTACTGG - Intergenic
935714797 2:105930390-105930412 GGTCAGGGCAGAGGAGGGAGAGG + Intergenic
936731546 2:115387134-115387156 CCTCAGAGCACAGAAGGGCCAGG - Intronic
936867122 2:117087545-117087567 TGTCACAGCCCAGGAGGGTTGGG - Intergenic
938074591 2:128324997-128325019 GGCCAGCGCACAGGAGGGCCTGG - Intergenic
938488860 2:131745987-131746009 TGTCAGAGCATAAGACGGATAGG - Intronic
938680514 2:133685032-133685054 GATCAGAGGACAGGATGGACAGG + Intergenic
942163620 2:173218571-173218593 TCCCAGAGCTCATGAGGGACAGG + Intronic
942441438 2:176041597-176041619 TGTCACAGCACAGAAGGAAGAGG + Intergenic
944827602 2:203501221-203501243 AGTCAGAGCAGAGAAGGGAAAGG + Intronic
945985444 2:216349994-216350016 TGTCAGAAGACAGGAGGGCAAGG - Intronic
946179954 2:217943058-217943080 AGTCAGAGGACAGGAGGGGTGGG + Intronic
946181017 2:217948954-217948976 TGTCAGGGCAGAGGATGGAAAGG + Intronic
946252469 2:218421950-218421972 TGTCAAAGAAAAAGAGGGACGGG + Intronic
947670762 2:231934062-231934084 CCTCAGGGCACAGCAGGGACAGG + Intergenic
948679803 2:239626125-239626147 TGTCAGAGCACAGGAGCCCTCGG + Intergenic
1169058109 20:2640662-2640684 TGTCCCAGAACAAGAGGGACTGG + Intronic
1169590686 20:7138194-7138216 TGTCTAAGAACAGGAGGGAGAGG - Intergenic
1172033619 20:31997465-31997487 TGTCCCAGCACAAAAGGGACAGG + Exonic
1172227848 20:33317118-33317140 TGTTAGAGCAGGGGAGAGACAGG - Intergenic
1173524297 20:43720267-43720289 TCTCAGAGCAAGGCAGGGACTGG + Intergenic
1174047971 20:47747460-47747482 TGGCAGAGCACACGTGGGAAAGG + Intronic
1174112186 20:48204654-48204676 TGTCCCAGCACAGGAGGGACAGG + Intergenic
1174146258 20:48454824-48454846 TCTCAGAGCCCTGGAGGGGCTGG - Intergenic
1174183203 20:48687821-48687843 GGTCAGAACACAGGTGTGACAGG - Intronic
1174292975 20:49522016-49522038 GTTCTGAGCAGAGGAGGGACAGG - Intronic
1174342753 20:49908045-49908067 TCTGAGAGCACAGGATGGATGGG + Intronic
1174540418 20:51285105-51285127 TGTCATAGCAGAGCCGGGACTGG + Intergenic
1175270839 20:57733147-57733169 TGTCAGAACACAGAGGGGAATGG - Intergenic
1175881606 20:62262625-62262647 TGTCAGGGGGCAGGAGGGAAAGG - Intronic
1176085155 20:63292578-63292600 CGTCACAGCACGGGTGGGACAGG + Intergenic
1176338292 21:5619337-5619359 GGACAGAGCACAGGAAAGACAGG + Intergenic
1176339700 21:5682410-5682432 GGACAGAGCACAGGAAAGACAGG + Intergenic
1176471954 21:7114563-7114585 GGACAGAGCACAGGAAAGACAGG + Intergenic
1176495515 21:7496341-7496363 GGACAGAGCACAGGAAAGACAGG + Intergenic
1176505127 21:7642046-7642068 GGACAGAGCACAGGAAAGACAGG - Intergenic
1179002664 21:37477638-37477660 TGTCAGAGGGCAGCAGGGTCTGG + Intronic
1179413615 21:41180513-41180535 TGTCAGTGGACAGGATGGGCTGG + Intronic
1179890796 21:44334231-44334253 TGTCACATCTCGGGAGGGACAGG - Intronic
1180033294 21:45227158-45227180 TGTACGAGCACAGGTGGGCCAGG + Intergenic
1180153811 21:45967330-45967352 TGTGAGAGCAGAGGAGAAACAGG + Intergenic
1181533511 22:23530366-23530388 TGTCAGAGCTGGGGAGGGGCTGG + Intergenic
1182231424 22:28840186-28840208 TGACAGAGCACATGGGGTACTGG + Intergenic
1182678482 22:32059381-32059403 TGTCAGTGGAGAGGTGGGACTGG + Intronic
1182736967 22:32537657-32537679 TGTCAGAGCACAGGAGGGACTGG + Intronic
1183333263 22:37232554-37232576 TGCCAGAGCCCAGGAGGCAATGG + Intronic
1183345378 22:37304515-37304537 GGTCAGAGCCCAGCAGGGAGGGG + Intronic
1183781455 22:40001792-40001814 TTGCAGAGCAGAGGAGGGAAGGG + Intronic
1184482460 22:44755797-44755819 TGTCAGGGCTCAGGAGAGGCAGG + Intronic
1184504111 22:44890871-44890893 TGGAAGAGCACAGGCTGGACAGG - Intronic
1184857194 22:47152785-47152807 CGGCAGAGCAGAGGAGGGACGGG + Intronic
1185115359 22:48931720-48931742 TGTCAGAGCAAAACAGGGAGGGG - Intergenic
1185355567 22:50367534-50367556 TGTGACAGCATAGGAGAGACGGG - Intronic
949325557 3:2859636-2859658 TCTGAGAGCAGAGGAGAGACAGG + Intronic
950159964 3:10753033-10753055 TGTCAGAGCACTGGGGAGAGAGG - Intergenic
950172884 3:10851743-10851765 TGTCAGAGCCCATCAGGGTCAGG + Intronic
950835423 3:15914526-15914548 TGTGAGAGCACAGTAAGGAGGGG + Intergenic
952139429 3:30461581-30461603 TGTCAGAGAACAGTAGGGAGTGG - Intergenic
952535055 3:34300515-34300537 TGTCAAAGCATTGGAGTGACAGG + Intergenic
953288765 3:41640554-41640576 TGACAGAGCTCAGGAGGGGTGGG - Intronic
954129045 3:48550432-48550454 TGCCAGAGCCCAGGCGGGCCTGG - Intronic
954411316 3:50372434-50372456 TGTCAGTGCCCAGGAGGCGCGGG + Intronic
954954492 3:54507543-54507565 TCTCATAGCCCAGGAGGCACAGG - Intronic
956789689 3:72671015-72671037 TCTCAGATCATAGGAGGGAATGG - Intergenic
957011185 3:75008175-75008197 GGACAGAGCACATGAGGGAAGGG - Intergenic
958069620 3:88593555-88593577 TGTCAGCGCAAAGGAGGCAAAGG + Intergenic
959513898 3:107244423-107244445 TGGCAGATCACAGGAGAGAAGGG - Intergenic
959846084 3:111035582-111035604 TGTGAGAGCACAGCAGTGATGGG + Intergenic
960837630 3:121923570-121923592 TCCCAGAGTACAGCAGGGACAGG + Intronic
961041046 3:123678502-123678524 TGTCAGTGCTCAGCAGGGAGGGG + Intronic
961167835 3:124775924-124775946 TGTCTGAGCACAGGAGGGTTGGG - Intronic
962700318 3:137992114-137992136 TGTGAGAGCACATGAGGACCTGG + Intergenic
964182331 3:153903671-153903693 TGTAGCAGCACAGGAGGGAGGGG + Intergenic
965360719 3:167735217-167735239 TGACAGAGCAGAGGAAGGAAGGG + Intergenic
965715601 3:171599253-171599275 TGTGTGAGCACAGGAGGCAGAGG - Intergenic
966824379 3:183951671-183951693 TGTGAGGGGTCAGGAGGGACAGG + Intronic
966988205 3:185201562-185201584 TGTCAGAGGACACGAGGGAGCGG + Intronic
967854194 3:194104162-194104184 TCCCAGATCGCAGGAGGGACTGG - Intergenic
968310430 3:197678274-197678296 TGTCAGAGCATAGGACAGTCTGG - Intronic
968310499 3:197679269-197679291 TGTCAGAGCATAGGACAGTCTGG - Intronic
968310550 3:197679872-197679894 TGTCAGAGCACAGGACAGTCTGG - Intronic
968467929 4:762304-762326 GGACAGAGCAGAGGACGGACTGG + Intronic
968973717 4:3810370-3810392 GGTCAGAGCACACCAGGGCCAGG + Intergenic
969340108 4:6535124-6535146 GGCCAGAGCAGGGGAGGGACCGG + Intronic
971140911 4:23923993-23924015 TTTCAGAGCCCAGGAGGCAGGGG + Intergenic
971433176 4:26590124-26590146 TGGCAGAGCACAGGAGGAAAAGG - Intronic
972174346 4:36385149-36385171 TCTCTGACCACAGGTGGGACAGG - Intergenic
974520082 4:62972167-62972189 GGTCAGAACACAGGAGGTATGGG - Intergenic
977156240 4:93577616-93577638 TGCCAGACCACAGGAGTTACTGG + Intronic
977294276 4:95193730-95193752 TGGCAGAGAACAGGAGAGAAGGG - Intronic
981101279 4:140831964-140831986 TGTCTGAGCACAGGAGGAGATGG - Intergenic
981181909 4:141756000-141756022 GGCCAGAGCTCAGGGGGGACAGG + Intergenic
984156978 4:176205812-176205834 TTTCAGATCTCAGGAGGGAAGGG - Intergenic
985151172 4:186948467-186948489 TTTCAAAGCACATTAGGGACTGG + Intergenic
985616662 5:927001-927023 TGCCCGAGGCCAGGAGGGACCGG + Intergenic
985947297 5:3196137-3196159 CGGCAGAGGACAGGAGGGACTGG + Intergenic
986353760 5:6904253-6904275 TTCTAGAGCACAGGAGAGACTGG + Intergenic
986410714 5:7476064-7476086 TGTCAGAGCACAGGAAGACGCGG - Intronic
986662831 5:10074542-10074564 TGTCAGAGTCCAGGAGGTACAGG + Intergenic
987315573 5:16720106-16720128 TGTCAGGGCAGAGCAGGGACTGG - Intronic
988975896 5:36515554-36515576 TGTCTGGGCACAGCAGGGATAGG + Intergenic
991017044 5:61943520-61943542 TGCCTGAGCACAGTAGGGACTGG + Intergenic
991083666 5:62628107-62628129 TGTCACAGCACAGGTGGGACTGG - Intronic
991454435 5:66787484-66787506 TGTCAAAGCACAGGAGCTAGGGG - Intronic
992719465 5:79545895-79545917 TGAAAGAGCAAAGAAGGGACTGG - Intergenic
993710254 5:91217271-91217293 ACTCAGACCACAGGAGGGATTGG + Intergenic
996823144 5:127652731-127652753 TGTTAGAGCACAGCAGGTATTGG + Intronic
999705588 5:154269807-154269829 TGGCAGAGGGTAGGAGGGACTGG + Intronic
1000225481 5:159257035-159257057 TGTCAGAGCCCTGGAAGGAGAGG + Intergenic
1002099223 5:176849060-176849082 TGGGAGGGCACAGCAGGGACAGG + Intronic
1003295515 6:4822976-4822998 CGTCAGAGCACAGAAGGAATTGG - Intronic
1003786913 6:9497070-9497092 TGTCAGTGCACAGAAAGAACTGG + Intergenic
1004506184 6:16248733-16248755 TGACAGAGCAGAGCAGGGAAAGG - Intronic
1005995230 6:30926796-30926818 TGTCAGAGCACAGAAGGTGGGGG - Intergenic
1006173919 6:32110387-32110409 AGCCAGAGGACAGGGGGGACAGG + Intronic
1006960494 6:37925382-37925404 TGTAAGACTACAGGAAGGACGGG + Intronic
1006998104 6:38282523-38282545 CATCAGAGCAGAGGAGGGGCAGG - Intronic
1007364673 6:41383126-41383148 TGTGACATCATAGGAGGGACAGG - Intergenic
1007409268 6:41652422-41652444 GGTCTGAGCAGAGGAGGGCCAGG + Intronic
1007602041 6:43088339-43088361 AGTGAAGGCACAGGAGGGACTGG - Intronic
1008426279 6:51361179-51361201 AGTCAGAGAACACGAGGGAAAGG + Intergenic
1010792070 6:80075966-80075988 TGGCACAGCACAGGAGCCACTGG + Intergenic
1012972132 6:105742677-105742699 TGTCAGAGGGCAGAAGGCACAGG - Intergenic
1013180525 6:107713516-107713538 GATCAGAGCCCAGGAGGGACGGG - Intronic
1015073394 6:129124904-129124926 TGTCAGAACACAGGAGGGAAGGG + Intronic
1015117249 6:129663343-129663365 TGTCAGAGCAAGATAGGGACTGG - Intronic
1018615103 6:165679565-165679587 TGTCACAGCACAGGAACGCCGGG + Intronic
1018708839 6:166483246-166483268 TCCCAGAGAAAAGGAGGGACAGG + Intronic
1018820235 6:167368391-167368413 TCCCAGAGCTCAGGAGAGACTGG - Intronic
1019122209 6:169812284-169812306 TGGCAGAGGACAGGAGCAACGGG - Intergenic
1019925923 7:4191735-4191757 TGGCAGAGCTCAGGGTGGACAGG + Intronic
1020242151 7:6404076-6404098 TGTCTCCACACAGGAGGGACAGG + Intergenic
1022490655 7:30815288-30815310 TGTAAGAGCCCAGGATGGAAAGG - Intronic
1023200712 7:37694180-37694202 TGTCAGGGCACAGTAGTAACTGG + Intronic
1023589994 7:41771678-41771700 TGTGAGCACACAGGAGGCACAGG - Intergenic
1023830905 7:44038639-44038661 TGTCAGAACCTAGGAGGGCCGGG - Intergenic
1023851172 7:44151323-44151345 TGACAGAGCACAGCCGGGCCAGG - Intronic
1023857664 7:44194648-44194670 TGTCAGAGCAAGGGAGGAACAGG - Intronic
1024629757 7:51237183-51237205 AGTCAAAGCAAATGAGGGACAGG - Intronic
1026978811 7:74514776-74514798 TGTCAGAGCACAGAAAGGCATGG + Intronic
1027189087 7:75987616-75987638 GGTCAGGGCACAGGACGGCCAGG + Intronic
1027442857 7:78238792-78238814 TGTCTGAGCAGAGGAGTGATAGG - Intronic
1029741241 7:102492959-102492981 TGTCAGAACCTAGGAGGGCCGGG - Intronic
1029759231 7:102592128-102592150 TGTCAGAACCTAGGAGGGCCGGG - Intronic
1029776601 7:102688038-102688060 TGTCAGAACCTAGGAGGGCCGGG - Intergenic
1030757688 7:113308560-113308582 TGTCAAGGCACAGGAGAAACTGG - Intergenic
1031124341 7:117756438-117756460 TGTCAGAGCACAGGGTGGGGGGG + Intronic
1032015856 7:128380154-128380176 GGTCAGTGAACAGGAGAGACTGG + Intergenic
1032540830 7:132701634-132701656 TGTCATGGCACAGCGGGGACAGG - Intronic
1035295144 7:157863052-157863074 AGCCGGAGCACAGGAGGCACTGG - Intronic
1035461301 7:159040862-159040884 GGACAGAGGACAGGAGGGAGGGG - Intronic
1035950000 8:4009803-4009825 TCTCTGAGAACAGGAGGGAGGGG - Intronic
1037441593 8:18921819-18921841 TATGAGAACACAGGAGGGAGTGG + Intronic
1038150657 8:24940494-24940516 TGCCAGAGCAAGGGTGGGACAGG - Intergenic
1038529498 8:28306389-28306411 TGCCAGAGCACAGAAGCCACAGG + Intergenic
1039037724 8:33377935-33377957 TGGCAGAACACAGGAGAGAGAGG + Intronic
1039923141 8:41906973-41906995 TGTCTGTGCACAGGATGGACAGG + Intergenic
1040651724 8:49456768-49456790 TGCCAGAGCAGAGCAGGGCCAGG + Intergenic
1041480830 8:58318298-58318320 TGTCAGAGGTCAGCAGGCACAGG + Intergenic
1044429788 8:92095482-92095504 TGTGTGAGCGCAGGAGGGAGAGG + Exonic
1045365372 8:101470779-101470801 TATCAGGGCTCAGGAGGAACAGG - Intergenic
1045444619 8:102247801-102247823 TGTGAGAGCATTGGAAGGACAGG + Intergenic
1045939252 8:107718742-107718764 TGTCAGAGACCATGAGGGAAGGG + Intergenic
1046104357 8:109648294-109648316 TGGCAAAGCACAGGAGAGATAGG + Intronic
1046931335 8:119844710-119844732 TGTCAAAGCACTGGAGAGAGGGG - Intronic
1047759926 8:127946879-127946901 TGTCAGAGCAGGGAAGGGAAGGG - Intergenic
1048496419 8:134939679-134939701 TGTCAGAGCAAAGGTAGGAGAGG + Intergenic
1049095004 8:140543537-140543559 TGCCAGAGCACAGGAGGTCGAGG - Intronic
1049537498 8:143189106-143189128 TTTCAGACCACAGCAGGGAGAGG - Intergenic
1053365584 9:37520356-37520378 GCTCAGAGCTCAGGAGTGACAGG - Intronic
1053379209 9:37635621-37635643 GGGCAGGGCACAGGTGGGACAGG + Intronic
1055281663 9:74681318-74681340 TGTCAGAGCCCAGAAGGGCCTGG - Intronic
1057345714 9:94248699-94248721 TGGCATATCACAGGAGGGATAGG + Intergenic
1057881681 9:98796806-98796828 TGTCAGGGCAGAGGTGGGAGCGG + Intronic
1058924062 9:109644238-109644260 TGTGAGACCCAAGGAGGGACAGG - Intronic
1059023806 9:110603495-110603517 TGTCAGGACACAGGGGGGTCTGG + Intergenic
1059669240 9:116477455-116477477 TCTCGGAGCTCAGTAGGGACGGG - Intronic
1060252321 9:121996202-121996224 TGAGAGAGGACAGGAGGGAAGGG - Intronic
1060282112 9:122221620-122221642 TGTCAGAAGGCAGGAGGGCCAGG + Intronic
1061637851 9:131926069-131926091 GGCCAGAGCACAGGAGTGAGGGG - Intronic
1061893574 9:133635393-133635415 TGGGAGAGGACAGGAGGGAGAGG + Intergenic
1061905716 9:133695891-133695913 TGTGAGAGCATGGGGGGGACTGG + Intronic
1061997494 9:134193921-134193943 TGTCAGAGCAGAAGTGGGACAGG - Intergenic
1062162756 9:135088832-135088854 TTTCAGAGGCCAGGAGGGAGGGG - Intronic
1062198318 9:135286973-135286995 TGGCAGAGCAAAGGAGGCAGAGG + Intergenic
1062384184 9:136302573-136302595 TGCCAGCGCCCAGGAGGGAGGGG - Intronic
1203423371 Un_GL000195v1:15583-15605 GGACAGAGCACAGGAAAGACAGG - Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1187398469 X:18938412-18938434 GGGCAGAGCCCAGCAGGGACAGG - Intronic
1188179697 X:27039478-27039500 TGTCAGACCACAGGAGTGTAAGG - Intergenic
1189911901 X:45818430-45818452 TGTCAGAGAACAGGAGCAAAGGG + Intergenic
1189942365 X:46137933-46137955 TGTGAGATGACAGGAGGGAATGG + Intergenic
1192525171 X:71836739-71836761 TGCCAGAGCCCAGGAGGAAGAGG + Intergenic
1196607639 X:117674202-117674224 TGTTGTAGCACAGGAGAGACTGG + Intergenic
1196960175 X:120992657-120992679 GGACAGAGCACATGAGGGAAGGG - Intergenic
1198495191 X:137185291-137185313 GGTGAGACCACAGGAGGAACAGG + Intergenic
1198675276 X:139124423-139124445 TGTGAGGGCACTGAAGGGACTGG - Intronic
1201705148 Y:16928528-16928550 TGACAGAGCACCTGAGGGAATGG + Intergenic