ID: 1182739077

View in Genome Browser
Species Human (GRCh38)
Location 22:32553825-32553847
Sequence CTGGATAAACTCTGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182739077_1182739083 3 Left 1182739077 22:32553825-32553847 CCCACATCCCAGAGTTTATCCAG 0: 1
1: 0
2: 3
3: 14
4: 157
Right 1182739083 22:32553851-32553873 CAGAATGCAAATGCTTCCTGTGG 0: 1
1: 1
2: 1
3: 23
4: 258
1182739077_1182739088 24 Left 1182739077 22:32553825-32553847 CCCACATCCCAGAGTTTATCCAG 0: 1
1: 0
2: 3
3: 14
4: 157
Right 1182739088 22:32553872-32553894 GGACTACAGTTGGGCTGTATGGG 0: 1
1: 0
2: 0
3: 7
4: 144
1182739077_1182739084 14 Left 1182739077 22:32553825-32553847 CCCACATCCCAGAGTTTATCCAG 0: 1
1: 0
2: 3
3: 14
4: 157
Right 1182739084 22:32553862-32553884 TGCTTCCTGTGGACTACAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1182739077_1182739087 23 Left 1182739077 22:32553825-32553847 CCCACATCCCAGAGTTTATCCAG 0: 1
1: 0
2: 3
3: 14
4: 157
Right 1182739087 22:32553871-32553893 TGGACTACAGTTGGGCTGTATGG 0: 1
1: 0
2: 0
3: 8
4: 83
1182739077_1182739085 15 Left 1182739077 22:32553825-32553847 CCCACATCCCAGAGTTTATCCAG 0: 1
1: 0
2: 3
3: 14
4: 157
Right 1182739085 22:32553863-32553885 GCTTCCTGTGGACTACAGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182739077 Original CRISPR CTGGATAAACTCTGGGATGT GGG (reversed) Intronic
903638937 1:24843751-24843773 ATGGATCAACTCTAGGATTTAGG + Exonic
903773260 1:25777380-25777402 TTGTAAAGACTCTGGGATGTCGG - Intronic
906682575 1:47739438-47739460 CTGGATAAACTCTAGAAGGCAGG - Intergenic
908462410 1:64357968-64357990 CTGGAGAAACTCTGAGTTGGTGG - Intergenic
909779837 1:79530018-79530040 CTAGACCAACTCTGTGATGTTGG - Intergenic
909905897 1:81194223-81194245 TTGGATAAATTCTGGGAAATGGG - Intergenic
910664947 1:89714519-89714541 CTTTATATGCTCTGGGATGTAGG - Exonic
911599241 1:99830449-99830471 CTGGAGAAACTGTGGGAATTGGG - Intergenic
915146728 1:153800016-153800038 CTGGACAAACTCGGGGAGCTGGG - Intergenic
920567675 1:206988373-206988395 CTGGATAGAATCTGAGATGCAGG - Intergenic
1064501624 10:15979738-15979760 TGGGAGAAACTCTGGGATGTGGG - Intergenic
1066053614 10:31660177-31660199 CTGGATGACTTCTGAGATGTGGG - Intergenic
1067357781 10:45546863-45546885 CTGGATAAACTTTAGTCTGTGGG - Intronic
1075241684 10:120785206-120785228 GTGGATAAACTCTGGAAGGTGGG - Intergenic
1075847069 10:125553447-125553469 CTGGGACAACTCTGAGATGTGGG - Intergenic
1075849867 10:125578151-125578173 ATGGATTTACTGTGGGATGTGGG + Intronic
1076101290 10:127781080-127781102 GGGAATAAAGTCTGGGATGTAGG - Intergenic
1076804308 10:132847479-132847501 CTGCATCAACTCAGGGATGGAGG - Intronic
1078770935 11:14351023-14351045 CTGGGTAAATTCTGAGATTTGGG + Intronic
1079244548 11:18743051-18743073 CTGGCTTGACTCTGGGACGTGGG - Exonic
1079997534 11:27310537-27310559 CTCTAACAACTCTGGGATGTAGG - Intergenic
1082029199 11:47592675-47592697 CTGGAGACAGCCTGGGATGTGGG + Intronic
1084414722 11:69024954-69024976 CTGGGTAAAATCTGGGAACTGGG + Intergenic
1084572501 11:69968090-69968112 CTCGATAAACCTTGGGATGAAGG - Intergenic
1087995267 11:104798699-104798721 CTTGATAAACTTTGGGATGGGGG - Intergenic
1089290161 11:117432896-117432918 TTGGATAAAGTCTGGGTTGGTGG - Intronic
1089773701 11:120821260-120821282 CTAGATAGGCTTTGGGATGTGGG + Intronic
1090934250 11:131327659-131327681 CTGGGGAAACTTTGGAATGTCGG - Intergenic
1091770657 12:3149004-3149026 CTGGGTAAATTGTGGGGTGTGGG + Intronic
1091858435 12:3757423-3757445 CTGGCGAAGCTCTGGGAGGTGGG - Intronic
1092438695 12:8476847-8476869 CTGGGTAAAGACTGGGAGGTTGG - Intronic
1093787129 12:23205933-23205955 CTCGATTAACTCTGGGAGTTAGG + Intergenic
1095916805 12:47487879-47487901 CTGGCTTAACTCTGGGTAGTTGG + Intergenic
1097079757 12:56421415-56421437 GTGGATAAACTCTTGGCTCTGGG - Exonic
1099532051 12:83795105-83795127 ATGCATAAGCTCTGGGAAGTAGG + Intergenic
1099586502 12:84523432-84523454 CTGTATAATTTCTGTGATGTTGG - Intergenic
1099702521 12:86105252-86105274 CTTTATAAACTCTGGGGTGAAGG + Intronic
1100936703 12:99677878-99677900 CTGGAGAATCTCTTGAATGTGGG + Intronic
1103944221 12:124517403-124517425 CGGGATAAACACTGGAAAGTTGG - Intronic
1105907679 13:24829263-24829285 CTGGAGAAACTATGGGAAGATGG - Intronic
1107401158 13:40070565-40070587 CTGGAGCAACCCTGTGATGTAGG - Intergenic
1111619190 13:90701320-90701342 CTTGATAAACACTGATATGTAGG + Intergenic
1112062134 13:95751419-95751441 CTTGATTAACTGTGTGATGTTGG + Intronic
1113170967 13:107502931-107502953 CTGGATACACTGTGGGATGTGGG - Intronic
1113543617 13:111128841-111128863 CTGAAAAAATTCTGGGATTTTGG - Intronic
1113598226 13:111549068-111549090 CTGGACATTCTCTGGGATGCAGG + Intergenic
1116226988 14:42165234-42165256 CTGGCTCAACTCTGGGAATTGGG + Intergenic
1120336109 14:83157156-83157178 ATGGATAAATTCTGTGTTGTAGG - Intergenic
1121560341 14:94870109-94870131 CTGGATCAACACTGGGGAGTGGG + Intergenic
1124011602 15:25843635-25843657 CTGGATAAACTCTGAGTAGATGG - Intronic
1128818257 15:70629906-70629928 CTGGATGAAGAGTGGGATGTGGG - Intergenic
1130042201 15:80414314-80414336 CTGGATAAGCTCTTTGCTGTGGG - Intronic
1131986031 15:98043625-98043647 CTGGGTAAACTCAGTGATGCCGG + Intergenic
1132953593 16:2578780-2578802 CAGGAAAAACTGTGGGAGGTGGG + Intronic
1132960758 16:2621387-2621409 CAGGAAAAACTGTGGGAGGTGGG - Intergenic
1135473394 16:22752111-22752133 CTGGAGAAACTCTGAGAAGAAGG + Intergenic
1137249061 16:46729794-46729816 CAGGCTGCACTCTGGGATGTAGG - Intronic
1144865769 17:18334794-18334816 CTGCTTTAACTCTGGGATGCAGG - Intronic
1145103075 17:20093004-20093026 CAAGATAAACTCTGAGATTTGGG + Intronic
1145963181 17:28899209-28899231 ATGAACAAAATCTGGGATGTGGG - Intronic
1153653951 18:7265685-7265707 ATTAATAAAGTCTGGGATGTGGG + Intergenic
1155251940 18:23961028-23961050 CTGGAGAAACTCCGGGATATGGG - Intergenic
1156920561 18:42517233-42517255 CTGGATAAAGTAAGGGAAGTTGG - Intergenic
1156935331 18:42698874-42698896 TAGAATAAACTCTGTGATGTTGG - Intergenic
1157106491 18:44778974-44778996 CTGGTTAAACCCTGAGGTGTTGG + Intronic
1157275043 18:46304360-46304382 CTGGAGAAGCTGTGGGAAGTAGG + Intergenic
1164791927 19:30994097-30994119 CTGGAGAATCACTGGAATGTGGG - Intergenic
1165738195 19:38190798-38190820 CATGATAACCTCTGGGAGGTAGG - Intronic
925354672 2:3230431-3230453 CTGAATAAACTGTGTGTTGTGGG + Intronic
926912180 2:17861518-17861540 CTGGAAAAAGGCTGGCATGTTGG - Intergenic
927340188 2:21974461-21974483 CTAGGTAAATTCTGGAATGTAGG - Intergenic
929913860 2:46117192-46117214 ATGTGTAAACTCTGGTATGTTGG - Intronic
930417003 2:51101819-51101841 TTGGATAATCTGTAGGATGTAGG + Intergenic
931229407 2:60361501-60361523 CTGGGTGAACCCTGGGCTGTAGG - Intergenic
931364357 2:61606021-61606043 CCATATTAACTCTGGGATGTGGG + Intergenic
934606273 2:95697858-95697880 CTGGACATACACTGGGATGCTGG + Intergenic
935853512 2:107248990-107249012 CTGGATCTGCTGTGGGATGTAGG + Intergenic
937478922 2:122239494-122239516 CTGGATAAACACGGGGATGCTGG + Intergenic
938418750 2:131126225-131126247 TTGCTTAAAATCTGGGATGTTGG + Intronic
938682016 2:133701725-133701747 ATTGAAAAACTCTGGGATCTTGG + Intergenic
942860510 2:180604482-180604504 ATGTATAAACTGTTGGATGTGGG + Intergenic
943519765 2:188933973-188933995 ATGGATAAACTGTGGGAGCTGGG - Intergenic
943577392 2:189646449-189646471 CTGGCTAAACTGTGGGATATTGG + Intergenic
944652679 2:201847457-201847479 CTGGAGAAAATCTGGGAGGTAGG + Exonic
947516072 2:230806069-230806091 CTGTATAAAATATGGGATGGAGG + Intronic
948520611 2:238534647-238534669 TTGGATCAACCCTGGGATGGAGG - Intergenic
1169560925 20:6799924-6799946 CTGGATTTACTGAGGGATGTGGG + Intergenic
1169681667 20:8220990-8221012 CTGGCAACACTCTGGGAAGTTGG + Intronic
1171879581 20:30608441-30608463 CTGGATAAACAATGGGGAGTTGG - Intergenic
1172038798 20:32029463-32029485 CTGGATCAGCTCTGTGATCTTGG - Intronic
1173109223 20:40170027-40170049 CTGGATAAACACTGGAATCTGGG + Intergenic
1173709147 20:45139233-45139255 CTGGATACACACTGGGACGAGGG - Intergenic
1174708728 20:52683343-52683365 CAGGTGAAATTCTGGGATGTTGG + Intergenic
1177661149 21:24085572-24085594 CTGGACAGAATCTGGGATGGGGG + Intergenic
1179192614 21:39136275-39136297 CTGTGTAAACTCTGGGCTCTGGG + Intergenic
1179659922 21:42867858-42867880 CTGGTAAAACTCTGGGAGGCTGG - Intronic
1179955407 21:44735487-44735509 CTGGGTAAACACTGGGAGCTGGG - Intergenic
1182589246 22:31366193-31366215 CTGGCTTGAATCTGGGATGTGGG - Intergenic
1182739077 22:32553825-32553847 CTGGATAAACTCTGGGATGTGGG - Intronic
949130426 3:493342-493364 ATGGATAAACCCTGGAATCTTGG - Intergenic
949632831 3:5947501-5947523 TTGGATAAAGCCTAGGATGTTGG - Intergenic
950338997 3:12224887-12224909 GTGCATAATCTCTGGAATGTGGG - Intergenic
951116593 3:18870484-18870506 CTCAAGAAAATCTGGGATGTAGG + Intergenic
952558262 3:34558604-34558626 GTGGATAAAGTCTGGTAGGTTGG - Intergenic
954638805 3:52085909-52085931 CTGGCTGAGCTCCGGGATGTTGG + Intronic
957187325 3:76958552-76958574 CTTAAAAAACTCTGAGATGTTGG - Intronic
959101732 3:102017658-102017680 ATGGATAAAAGCTGGGAGGTGGG + Intergenic
961948293 3:130717628-130717650 TTGGATAAACTCTGGAAACTAGG - Intronic
963942268 3:151106650-151106672 ATGGATAAAGTCTGCAATGTTGG - Intronic
964868567 3:161288846-161288868 CTGTATAATCTCTAGGATATAGG - Intergenic
966492428 3:180542868-180542890 ATGGCTAAAATATGGGATGTGGG + Intergenic
966948941 3:184798369-184798391 CTGGGAAAACTCTGGGAAATGGG - Intergenic
967357658 3:188590734-188590756 CTGGGTTAAATCTGGGAGGTTGG - Intronic
969789252 4:9480737-9480759 GTGTACACACTCTGGGATGTTGG + Intergenic
973610924 4:52635429-52635451 CTGGAGAAACCCTGAAATGTGGG - Intronic
973846281 4:54916270-54916292 CTGGACAACTTCTGGAATGTTGG - Intergenic
973962673 4:56127340-56127362 CTGCATAAGCTCTGGAATTTAGG + Intergenic
977144318 4:93417572-93417594 GTGGTTAGACTCTGGGATGCTGG - Intronic
978729821 4:112012656-112012678 CTGAATAAACTGTGTGTTGTGGG + Intergenic
981135282 4:141204042-141204064 GTGGATAAAGACTGGGGTGTTGG + Intronic
984497223 4:180514184-180514206 CTGCATTAACTCTGGGTAGTTGG - Intergenic
987547109 5:19324999-19325021 CTGGATAATCTCTTGAATTTCGG + Intergenic
988468598 5:31514897-31514919 CTGGATAAATTCTTGATTGTGGG - Intronic
990800714 5:59599620-59599642 CTGGATAGAGTCTGAGATGATGG - Intronic
993373630 5:87121984-87122006 CTGGATACACTCTGGGAGTAGGG - Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
996922415 5:128784248-128784270 CTGGATAAACTCTGTGATGCAGG - Intronic
997161073 5:131609890-131609912 CTGGTTGGACTCTGGTATGTGGG - Intronic
998565019 5:143209322-143209344 CTGGAAATACTTTGGGAGGTAGG - Intronic
1002624874 5:180519056-180519078 CTGAATAAACTCTGGAAAGTTGG - Intronic
1002652456 5:180710028-180710050 GTGGATCAACTCTAGGATTTAGG - Intergenic
1003727636 6:8783575-8783597 CTGGGTAAAGGCTGGGAGGTGGG - Intergenic
1004883464 6:20031072-20031094 CTGGATAGAGCCAGGGATGTTGG - Intergenic
1007886135 6:45232604-45232626 CTGGATAACCTGTGTGATGTGGG + Intronic
1009824657 6:68851545-68851567 CTGCATAAACTATGGCATTTAGG + Intronic
1015499982 6:133921655-133921677 CTAGAGAAACCCTGGGATTTAGG - Intergenic
1016869771 6:148805396-148805418 CTGGAAAAAGCCTGAGATGTTGG + Intronic
1016906667 6:149157837-149157859 CTAGATAACCTCTGGGAATTTGG + Intergenic
1016913017 6:149217320-149217342 CTACAAAAACTCTGTGATGTAGG - Intergenic
1017424339 6:154305190-154305212 CTGGGTAAACTCTGAGATGGAGG - Intronic
1017806229 6:157947872-157947894 CTGCTTATACTATGGGATGTGGG + Intergenic
1017865700 6:158441489-158441511 CTGGCTAAACGCTGGCATTTAGG - Intronic
1020669844 7:11093213-11093235 CAGAACAAACTCTGGGATGACGG - Intronic
1024585160 7:50835764-50835786 CTGAATAAGCACTGGGAGGTGGG - Intergenic
1028283067 7:88957186-88957208 CTGGATAAACTCTAAGATGTGGG - Intronic
1028917287 7:96273125-96273147 CAGGATAAATTCTGGGGTATAGG - Intronic
1030098511 7:105923292-105923314 CTGGATGAACTCTTTGATGCGGG + Intronic
1031250753 7:119377660-119377682 TTGTATAAACTTTGGGGTGTGGG - Intergenic
1038072895 8:24037043-24037065 CTGGATATACACTGGGAAGTGGG + Intergenic
1040741512 8:50580893-50580915 ATGTATGAACTCTAGGATGTAGG - Intronic
1041647430 8:60267671-60267693 CTGCCTCAACCCTGGGATGTGGG - Intronic
1042860289 8:73306234-73306256 CTGTATAAACCCAGGGATGCAGG - Intronic
1042864259 8:73343850-73343872 TTGGATAAACTCAGGGCTGGGGG - Intergenic
1046256272 8:111700065-111700087 ATGGAGAAACCCTGGAATGTGGG + Intergenic
1047920716 8:129631828-129631850 CCAGATAAAATCTGGGATGCAGG + Intergenic
1049081344 8:140445594-140445616 CTGGTTTAACCCTGGGTTGTGGG - Intronic
1050225533 9:3450632-3450654 TGGGATTAACTCTGGGATATTGG - Intronic
1050390654 9:5140640-5140662 CTGGTGACAGTCTGGGATGTTGG - Intronic
1052324863 9:27206647-27206669 CTGGATAAATTGTAGGATCTGGG - Exonic
1056063050 9:82904378-82904400 CTGCATAATCACTGGGATATTGG - Intergenic
1060166875 9:121424637-121424659 ATGGATAAATTCTTGGATATTGG - Intergenic
1060349053 9:122841679-122841701 CTGAATAAGCTCTGGATTGTAGG + Intergenic
1061276420 9:129571473-129571495 CTGGATAGAAGCTGGGATGTGGG + Intergenic
1061378395 9:130239713-130239735 GTGGATAAAATCTGTGGTGTAGG + Intergenic
1187166320 X:16807207-16807229 AGGGATTAACTCTGGGATTTAGG - Intronic
1187476454 X:19615345-19615367 CTGGATAACTTCTGGGAAATTGG - Intronic
1188164514 X:26845524-26845546 CTGGAGAATCTCTGTGATTTAGG + Intergenic
1189445764 X:41079674-41079696 GTGGATACACTCTAGGATTTAGG + Intergenic
1189980554 X:46506140-46506162 CTGGCTAAAGTCTGGGAACTTGG + Intronic
1193248603 X:79261084-79261106 CTGTATAAACTTTGGGATATTGG + Intergenic
1193781620 X:85709975-85709997 TTGGAGAAACTCTAGGATATTGG + Intergenic
1195429371 X:104771150-104771172 CTGAAGGAACTCTGGGCTGTCGG + Intronic
1195717505 X:107831133-107831155 CTGAATACACTCTAGGATGCTGG + Intronic
1197502317 X:127256717-127256739 TTAGATAAATTCTGGGATGGTGG - Intergenic
1200926741 Y:8661535-8661557 CTGGCTACACTCTAGGTTGTGGG + Intergenic