ID: 1182741333

View in Genome Browser
Species Human (GRCh38)
Location 22:32570153-32570175
Sequence CTCCACACACACTGCCTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 518}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182741328_1182741333 13 Left 1182741328 22:32570117-32570139 CCGAGGTCGATTAAACATGGTAT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1182741333 22:32570153-32570175 CTCCACACACACTGCCTTCTAGG 0: 1
1: 0
2: 1
3: 41
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182741333 Original CRISPR CTCCACACACACTGCCTTCT AGG Intronic
901034279 1:6327042-6327064 CCCCACGCACAGTGCCCTCTGGG + Intronic
902352731 1:15869942-15869964 CTGCAACCTCACTGCCTTCTGGG + Intronic
902591974 1:17481727-17481749 CACCACAACCTCTGCCTTCTGGG + Intergenic
902604366 1:17560639-17560661 CACCACAACCTCTGCCTTCTGGG + Intronic
902918020 1:19650483-19650505 TTCCACACTCACTCACTTCTAGG - Intronic
903012032 1:20338048-20338070 CTGCACACACACTGCCCAGTTGG + Intronic
903684436 1:25120471-25120493 CACGACACACACTTCCTTCCTGG - Intergenic
903702954 1:25264213-25264235 CCCCACACACAGTCCCTACTGGG - Intronic
903712220 1:25334539-25334561 CCCCACACACAGTCCCTACTGGG - Intronic
903847027 1:26284749-26284771 CCCCTCACACTCTGCCTTCACGG - Intronic
904234752 1:29108222-29108244 CTCCACAACCTCTGCCTCCTGGG + Intronic
904308287 1:29605133-29605155 CTCCACAACCTCTGCCTCCTGGG - Intergenic
904329800 1:29751162-29751184 CTCAACACTCAGTGCTTTCTTGG + Intergenic
904386131 1:30143356-30143378 CCCCACACAGAGTCCCTTCTGGG - Intergenic
904459577 1:30668201-30668223 CTCCACCCACTCTGCGTGCTTGG + Intergenic
905154673 1:35965899-35965921 CACCACAACCTCTGCCTTCTGGG + Intronic
905181910 1:36172467-36172489 CTCCAGCCACACTGCCTTCTTGG - Exonic
905824469 1:41018055-41018077 CTACACACACGCTGCCTGATAGG - Exonic
906020813 1:42627903-42627925 CTCCACACAGAGTCCCTACTAGG + Intronic
906061427 1:42951746-42951768 GGCCCCACACACTGCCTGCTAGG + Intronic
906249621 1:44301135-44301157 ATCAACTCACGCTGCCTTCTTGG + Intronic
906763960 1:48409523-48409545 CTCCACACAGAGTCCCTACTGGG - Intronic
907007752 1:50932710-50932732 CTCCACACAGAGTCCCTGCTAGG - Intronic
907171291 1:52467752-52467774 CTCCAGCCACACTGACTTCCTGG + Intronic
907184777 1:52601560-52601582 CTCCACAGACAGGGCCATCTTGG + Intergenic
907936895 1:59049501-59049523 ATGCACACACATTCCCTTCTCGG - Intergenic
908278160 1:62498875-62498897 CACCACAATCTCTGCCTTCTGGG + Intronic
908755058 1:67462073-67462095 TTCCACCCACTCTACCTTCTAGG + Intergenic
909257237 1:73439304-73439326 CTCCACACAGAGTTCCTACTGGG + Intergenic
909884618 1:80925351-80925373 CTCCACACCAACTTCCCTCTTGG - Intergenic
910256074 1:85248757-85248779 CTCCATCCCCACTGCCTTCATGG + Intergenic
910774502 1:90861767-90861789 CTCCACACAGAGTCCCTACTGGG - Intergenic
911242139 1:95478487-95478509 CCCCACACACAGTGCCTACTGGG + Intergenic
912046317 1:105463282-105463304 CACCACAAACTCTGCCTCCTGGG + Intergenic
912562417 1:110560377-110560399 CTCCACACACTCAGACCTCTAGG + Intergenic
912778233 1:112520478-112520500 GTCCAGCCACTCTGCCTTCTTGG - Exonic
914397534 1:147285186-147285208 CTCCACACACCCTGCATGGTGGG - Intronic
915390100 1:155535111-155535133 CACCACAACCTCTGCCTTCTGGG - Intronic
915529168 1:156493563-156493585 CTCCCCACCCCCTTCCTTCTGGG - Intronic
915590312 1:156866751-156866773 ATCTACACACACTGCCTTCCAGG + Intronic
915837096 1:159186191-159186213 CTCCACTCACCCTGCATTCCAGG - Intronic
916088294 1:161287173-161287195 CTCCACAACCTCTGCCTCCTGGG - Intergenic
916098709 1:161374674-161374696 CTCCCCACACACTGCCTATGGGG + Exonic
916477412 1:165183478-165183500 CTCCACACAGAGTCCCTACTGGG + Intergenic
916618763 1:166472959-166472981 CTCCACACAGAGTCCCTCCTGGG - Intergenic
917454705 1:175176462-175176484 CTCTGCACAGACTGCCCTCTGGG - Intronic
917825630 1:178817267-178817289 CACCACAAACTCTGCCTTCCAGG - Intronic
918288147 1:183078917-183078939 CACCACAAACTCTGCCTCCTGGG - Intronic
919663191 1:200268202-200268224 CTCCAGCCACACTGACTTCCTGG + Intergenic
920686750 1:208114795-208114817 CTACTCACTCACTGCCTTCTAGG - Intronic
921064752 1:211614768-211614790 CACCACACCCACGGCCTTCCTGG + Intergenic
921074228 1:211686844-211686866 CTCCGCAACCTCTGCCTTCTGGG + Intergenic
921343132 1:214154311-214154333 CTCCACACACGCTTCCTTTCAGG - Intergenic
921594321 1:217038168-217038190 CCCCACACAGAGTCCCTTCTGGG - Intronic
922167953 1:223131307-223131329 CTCCAGCCACCCTGCCTTCCTGG + Intronic
923522958 1:234750272-234750294 GTCCACACACACAGGCTTGTGGG + Intergenic
1063481469 10:6380347-6380369 CTCCACACAGAGTCCCTACTGGG - Intergenic
1064800515 10:19065209-19065231 CACCACAACCTCTGCCTTCTGGG - Intronic
1064929899 10:20613645-20613667 CTCCCCAAACACAGTCTTCTTGG + Intergenic
1065536690 10:26721965-26721987 CCCCACACACAGTGCCCCCTCGG + Intronic
1065784171 10:29198080-29198102 CTCCCCACAGAGTGACTTCTTGG + Intergenic
1066383103 10:34918397-34918419 CTCCACACTCCCTGCCTCCGTGG + Intergenic
1068590687 10:58849905-58849927 CACCATACACAATGTCTTCTAGG - Intergenic
1068738527 10:60442169-60442191 CACCACAACCTCTGCCTTCTGGG + Intronic
1069211003 10:65760370-65760392 CTCCACACAGAGTCCCTACTGGG - Intergenic
1069539505 10:69283048-69283070 CTCACCACAAACTGCCTCCTGGG - Intronic
1070431008 10:76337564-76337586 CTCCAGCCACACTGACCTCTTGG - Intronic
1070694699 10:78553125-78553147 CTGCAAACACACTCCCTGCTTGG + Intergenic
1070734279 10:78852688-78852710 CCCCAAACACACAGCCTTCAAGG + Intergenic
1070948635 10:80413314-80413336 CTCAACCCACACTCCCTTCCTGG - Intronic
1070948961 10:80415509-80415531 CTCCAAAGCCACTTCCTTCTGGG + Intronic
1071423612 10:85526515-85526537 TTCCACACACACTGATTTGTCGG + Intergenic
1071755591 10:88535342-88535364 CTACTCCCAGACTGCCTTCTTGG - Intronic
1072569702 10:96647962-96647984 CTCCTCAAACATTGACTTCTGGG - Intronic
1073612197 10:104955652-104955674 CTCCACTCTCACTGCATTCATGG - Intronic
1074046021 10:109839858-109839880 CACCACAACCTCTGCCTTCTGGG - Intergenic
1074283993 10:112080791-112080813 CTCCACACACACTGGGTTGTTGG + Intergenic
1074895802 10:117776645-117776667 CTCAACTCAAACTGCCTTATGGG - Intergenic
1075835672 10:125450651-125450673 CTCTTAACACACTGCATTCTAGG + Intergenic
1075874168 10:125792893-125792915 ACCCACACACAGTGCCTTCGTGG + Intronic
1076790460 10:132774543-132774565 CCCCACCCAGCCTGCCTTCTGGG + Intronic
1077532847 11:3105378-3105400 GTCCACACACACTGTCCACTGGG - Intronic
1077738497 11:4817953-4817975 CTCAACAGTCTCTGCCTTCTTGG - Intronic
1077763055 11:5124519-5124541 TTCCAAACACACTTCTTTCTTGG - Intergenic
1079475493 11:20825262-20825284 CTCCACACACAATCCCCACTGGG + Intronic
1080698761 11:34625825-34625847 CACCACACACCCTGGCCTCTGGG + Intronic
1080711831 11:34755823-34755845 TTCCACTCCCACAGCCTTCTGGG - Intergenic
1081499558 11:43652790-43652812 CTCCCCACACTCTGTCCTCTTGG + Intronic
1082736519 11:56861873-56861895 CCCCACACACCTTGCCTTCTTGG - Intergenic
1083355748 11:62064861-62064883 CACCACAACCTCTGCCTTCTGGG + Intergenic
1083488812 11:62999972-62999994 CTCCCCAGACACAGCTTTCTTGG + Intronic
1083740021 11:64704388-64704410 CTCTACACACACTGCCTAGAAGG + Intronic
1084276789 11:68055970-68055992 CACCACAACCTCTGCCTTCTGGG - Intronic
1084661274 11:70547987-70548009 AGCCACACCCACAGCCTTCTAGG - Intronic
1084822794 11:71705021-71705043 CGCCACAACCACTGCCTCCTGGG - Intergenic
1084849984 11:71930906-71930928 CACCACAACCTCTGCCTTCTGGG + Intronic
1084901258 11:72311634-72311656 CTCCTCACACCCTGACTCCTTGG + Intronic
1085002429 11:73051916-73051938 CCCCACACACACTGACATCAGGG + Intronic
1085651559 11:78273152-78273174 CCCCACACAGAGTCCCTTCTGGG + Intronic
1085693686 11:78686235-78686257 CTCCCCAAACTCTGTCTTCTTGG - Intronic
1086799364 11:91152523-91152545 CCCCACACACAGTCCCCTCTGGG - Intergenic
1087253066 11:95924583-95924605 CTCCACACTCCCTTCCTGCTAGG - Intronic
1088729538 11:112668606-112668628 CTCCAGGGAGACTGCCTTCTAGG - Intergenic
1089596595 11:119584748-119584770 CTCCTCACAAATTGCCTTGTCGG + Intergenic
1090534747 11:127628400-127628422 CTGCACACCCTGTGCCTTCTGGG - Intergenic
1091455542 12:604710-604732 CCCCACACCCAGTGCCTTCCTGG - Intronic
1091728963 12:2865726-2865748 CTCCACAACCACCGCCTCCTGGG + Intronic
1091981825 12:4870737-4870759 CTCCACACAGACTTCCTTTCTGG + Intergenic
1092352413 12:7766395-7766417 CACCACAACCTCTGCCTTCTGGG - Intronic
1092372085 12:7925009-7925031 CTCCCCATACCCTGCCTTTTGGG - Intronic
1092780138 12:11978652-11978674 CTCCATCCATGCTGCCTTCTGGG + Intergenic
1092808870 12:12253186-12253208 CACCACAACCTCTGCCTTCTGGG - Intronic
1093150185 12:15611573-15611595 CACCACAAACTCTGCCTCCTGGG + Intergenic
1093627560 12:21367407-21367429 CTCCAAACTGACTGCTTTCTAGG - Intronic
1095207134 12:39451048-39451070 TTCCACAAATACTGCCTTTTAGG - Intergenic
1095568459 12:43654187-43654209 CTTCTCAAACACTGCCTTCAGGG + Intergenic
1095966922 12:47874262-47874284 CTCCAGCAACACTGACTTCTTGG + Intronic
1096229752 12:49890276-49890298 CCCCACACACACTGACTTTCGGG + Intronic
1096520316 12:52181229-52181251 CTCCACACCCACTCCCCTCCAGG + Intronic
1097173449 12:57129526-57129548 CTCCCCACCCACAGCCTTCCCGG - Intronic
1097379956 12:58882866-58882888 CACCACACACAAAGCCATCTGGG + Exonic
1097494814 12:60317542-60317564 CTCCATCCACACCTCCTTCTTGG + Intergenic
1098941512 12:76542093-76542115 CACCACAACCTCTGCCTTCTGGG - Intronic
1099274856 12:80561608-80561630 CTGCACAGCCACTGGCTTCTCGG + Intronic
1099668471 12:85660266-85660288 CTCCACACAGAGTCCCTTCTGGG + Intergenic
1099674635 12:85742919-85742941 CTCCACACAGAGTCCCTACTGGG - Intergenic
1099722581 12:86382977-86382999 CCCCACACAGAGTGCCTACTGGG + Intronic
1099858964 12:88205207-88205229 CTCCACACAGAGTCCCTACTGGG + Intergenic
1100376125 12:94017763-94017785 CTCCACACAGAGTCCCTACTGGG + Intergenic
1100615154 12:96225725-96225747 ACACACACACCCTGCCTTCTGGG + Intronic
1100870945 12:98909462-98909484 TTCCATACACAATGCCTTCCTGG + Intronic
1100936890 12:99680039-99680061 CTCCAAACACACATCCTCCTTGG + Intronic
1101802915 12:108037984-108038006 CACCACAGGCTCTGCCTTCTAGG - Intergenic
1102523212 12:113492324-113492346 CACCACACAGAATCCCTTCTGGG + Intergenic
1102590028 12:113949964-113949986 CTGCAGAGACACTGCATTCTTGG + Intronic
1102673098 12:114636818-114636840 TTTCACCCACTCTGCCTTCTGGG + Intergenic
1103954803 12:124569962-124569984 CTGCACACAAACAGCCTTCCCGG + Intergenic
1105438425 13:20396498-20396520 CTCGAAACACACTGTCTTCCAGG + Intergenic
1105442488 13:20427038-20427060 CTCCACATACCCTGCCCTCATGG + Intronic
1106912616 13:34479128-34479150 CTCCAGACACACTGGCCTCCTGG - Intergenic
1107321646 13:39195307-39195329 CTCAACACACAATACCTTCCAGG - Intergenic
1107361291 13:39619961-39619983 CACCACAACCTCTGCCTTCTGGG + Intergenic
1107373292 13:39775417-39775439 CTCCACACACTCTACCCACTTGG + Intronic
1107932880 13:45320788-45320810 CACTACAAACACTGCCTCCTAGG - Intergenic
1108213575 13:48161700-48161722 GTCCACACACTCTGCTTTCTTGG - Intergenic
1108453336 13:50588583-50588605 CTCCCCAGACCCAGCCTTCTAGG + Intronic
1108878388 13:55076681-55076703 CACCACAGCCTCTGCCTTCTGGG - Intergenic
1110924364 13:81131806-81131828 CCCCACACAGAGTCCCTTCTGGG + Intergenic
1110968857 13:81735659-81735681 CACCACAATCACTGCCTTCATGG - Intergenic
1113203064 13:107888050-107888072 CTCCACACAAAGTCCCCTCTGGG - Intergenic
1113224029 13:108139881-108139903 CTCCACTCACTCTTCATTCTGGG - Intergenic
1113789860 13:113022492-113022514 CTCCACACACATAGGCTTCTGGG + Intronic
1114987659 14:28250838-28250860 CTCCACACAGAGTCCCTACTGGG - Intergenic
1115434576 14:33358342-33358364 CCCCACCTACAGTGCCTTCTTGG - Intronic
1115481717 14:33867521-33867543 CTCCACACAGAGTCCCTACTGGG - Intergenic
1116986227 14:51222909-51222931 CCCCACACATACTCCCTACTGGG - Intergenic
1118239624 14:64043845-64043867 CCCCACACAGAGTGCCTACTGGG + Intronic
1118657471 14:67967862-67967884 CCCCACACAGAGTCCCTTCTGGG - Intronic
1118858562 14:69643647-69643669 CTCCCCACACACGGCTGTCTGGG - Intronic
1118876968 14:69794003-69794025 CTCCACTCACTCTGCCTCATAGG - Intronic
1118933474 14:70264384-70264406 CTCCACACAGAGTCCCTACTGGG + Intergenic
1119880674 14:78097137-78097159 CCCCACACAGACTCCCTACTGGG - Intergenic
1120245632 14:82002939-82002961 CTCACCACACTCTACCTTCTGGG - Intergenic
1122235920 14:100330584-100330606 CTCCACTCTCTCGGCCTTCTGGG + Intergenic
1122524635 14:102372339-102372361 CACCACAACCTCTGCCTTCTGGG + Intronic
1123874466 15:24609736-24609758 CTCCACACAGAATGCATTCTTGG - Intergenic
1123911105 15:24967730-24967752 CACCACAAACACTGCCTTCGGGG - Intronic
1125694490 15:41623839-41623861 CACCACAACCTCTGCCTTCTGGG + Intronic
1126697872 15:51341268-51341290 CTACCCCCACACTGCCCTCTTGG - Intergenic
1127039145 15:54954105-54954127 TGCCACACTAACTGCCTTCTTGG + Intergenic
1127266461 15:57366224-57366246 CACTACAAACTCTGCCTTCTGGG - Intergenic
1128434097 15:67628402-67628424 CACCACAGCCACTGCCTCCTGGG - Intronic
1128814012 15:70592494-70592516 CCCCACACACAGTCCCTACTGGG + Intergenic
1128863249 15:71092376-71092398 CTCCATACACAGTGTGTTCTTGG - Intergenic
1128890435 15:71327089-71327111 CACCACAACCACTGCCTCCTGGG - Intronic
1129670055 15:77602617-77602639 GTCCACACACACGGCGTGCTTGG + Intergenic
1129900663 15:79145945-79145967 GTGCACACACACTGCTTTCCTGG - Intergenic
1130908963 15:88257876-88257898 CCCCACACACACTTCTTTCCCGG - Intergenic
1131799080 15:96051371-96051393 CTTCAAACACCCTGCCTTCTAGG - Intergenic
1134637849 16:15806199-15806221 CACCACAAACTCTGCCTCCTGGG - Intronic
1134769359 16:16793491-16793513 CTCCAGACACAATGGCTTCTTGG + Intergenic
1134886052 16:17792729-17792751 CTCCACAATCTCTGCGTTCTGGG + Intergenic
1135049843 16:19183948-19183970 CTCCTCAAACACGGGCTTCTGGG - Exonic
1135167093 16:20148657-20148679 CTCCAATCTCAGTGCCTTCTTGG + Intergenic
1136048692 16:27635435-27635457 CTCCACACACCCAGGCTTTTGGG + Intronic
1136187371 16:28596217-28596239 CTTCACACACCCTGACATCTGGG - Exonic
1136189850 16:28609142-28609164 CTTCACACACCCTGACATCTGGG - Intronic
1136575914 16:31125114-31125136 CACCACAACCTCTGCCTTCTGGG - Intronic
1137318988 16:47359115-47359137 CTCCAGTCACATTGCCTCCTTGG - Intronic
1137451228 16:48576640-48576662 ATTCACACATACTGACTTCTGGG - Intronic
1137576266 16:49602318-49602340 CTCCTCACACCCTGCCTTCCAGG - Intronic
1137736628 16:50729298-50729320 CTCCCCACACTCTGCTTGCTGGG - Intronic
1138418267 16:56883890-56883912 CACCACCCACCCTGCCTCCTGGG - Intronic
1139133891 16:64178494-64178516 CTCCACACAGAGTCCCTACTGGG + Intergenic
1139340983 16:66267715-66267737 ACACACACACACTGCCTGCTGGG + Intergenic
1140122778 16:72098071-72098093 CTCTACAAACACACCCTTCTTGG - Intronic
1141524442 16:84602883-84602905 CTCCAGCAACACTGCCTTTTTGG - Intronic
1141711786 16:85703911-85703933 CACCACAGCCTCTGCCTTCTGGG - Intronic
1143135871 17:4711939-4711961 ATCCCCACACTCTGCCTCCTTGG + Intronic
1144543474 17:16169216-16169238 CTCTGGACACACTGCCTTATGGG + Intronic
1144817914 17:18049258-18049280 CACCACAAACTCTGCCTCCTGGG - Intronic
1145026096 17:19468903-19468925 CTCCACAAACTCCGCCTCCTGGG - Intergenic
1145325682 17:21822184-21822206 ATCCATACACACTACTTTCTGGG - Intergenic
1145392383 17:22465618-22465640 CTCCAGACACACCGCCCTCCAGG - Intergenic
1146381445 17:32332216-32332238 CACCACAAACTCTGCCTCCTGGG + Intronic
1147013218 17:37468974-37468996 CACCACAACCTCTGCCTTCTAGG + Intronic
1147116140 17:38301315-38301337 CACCACAACCTCTGCCTTCTGGG + Intronic
1147727808 17:42577602-42577624 CTCCTCACCCACTGCCCTCCCGG + Intronic
1148413541 17:47488279-47488301 CACCACAACCTCTGCCTTCTGGG - Intergenic
1148681859 17:49478711-49478733 CTCCAGACACCCTTCCTTCTTGG - Intergenic
1148996889 17:51718456-51718478 CTCCAAGCCCACTGCCTTCCAGG - Intronic
1149110191 17:53019244-53019266 CTCCACACAGAGTCCCTACTGGG - Intergenic
1149547345 17:57513486-57513508 GTCCACAAACAGTGCCTGCTAGG - Intronic
1149601890 17:57898722-57898744 CTCCACATTCACTCCCTTCAGGG - Intronic
1150601204 17:66652584-66652606 CTGCACACACGCTCTCTTCTTGG - Intronic
1150786233 17:68165193-68165215 CACCACAACCACTGCCTCCTAGG - Intergenic
1151106163 17:71619217-71619239 CCCCACACAGACTCCCTACTGGG + Intergenic
1151653020 17:75481578-75481600 CTCCACACATACCCCCTCCTCGG - Intronic
1151837555 17:76593229-76593251 CTCCCCAAACTCTGTCTTCTTGG - Intergenic
1152139441 17:78527852-78527874 CACCACAACCGCTGCCTTCTGGG + Intronic
1153215525 18:2816920-2816942 CTCCAGGCACACTACCTTCCAGG - Intergenic
1153276177 18:3369889-3369911 CTCCACTCACATTGACTTTTAGG - Intergenic
1154212546 18:12392392-12392414 CTTCTCACATAATGCCTTCTGGG - Intergenic
1155385800 18:25275868-25275890 CTCCCCTCACACTGCCTTCATGG - Intronic
1156482117 18:37442903-37442925 TACCAACCACACTGCCTTCTGGG + Intronic
1156933843 18:42678898-42678920 CACCACAACCACTGCCTCCTGGG + Intergenic
1157574805 18:48736482-48736504 CTCCACCCAGACTGCCGCCTTGG + Intronic
1157696318 18:49726459-49726481 AGCCACACACACTGCCTGCCAGG - Intergenic
1158056380 18:53285616-53285638 CTCCACACAGAGTCCCTGCTGGG + Intronic
1158073484 18:53500904-53500926 CTCCACACATACTACATTATGGG + Intronic
1158578459 18:58660684-58660706 CTCCACACTTCCTGTCTTCTAGG + Intergenic
1158602402 18:58865816-58865838 CTCCACACTCGCTTCCTTCCAGG - Intronic
1159138600 18:64365946-64365968 CTCCATACGCACTGACTTGTTGG - Intergenic
1159946622 18:74448612-74448634 GTGCACACACACTTCCCTCTTGG - Intronic
1159978621 18:74748910-74748932 CACAACACAAACTGGCTTCTGGG - Intronic
1160003733 18:75052741-75052763 TCCCACACAAAGTGCCTTCTGGG + Intronic
1160096475 18:75878042-75878064 CCCCACACAGACTCCCTACTGGG + Intergenic
1161221657 19:3120672-3120694 CTCCACAGCCACAGCCTTCCAGG - Intronic
1161350376 19:3787800-3787822 GTCCAGACACACAGCCTTTTGGG - Intronic
1162079590 19:8210028-8210050 CTCCGCACACACTCCCGGCTAGG - Intronic
1162958820 19:14114303-14114325 CTCCACACCCAGTGGCCTCTGGG - Intronic
1164993659 19:32703422-32703444 CACCACAGCCTCTGCCTTCTGGG + Intronic
1165097478 19:33417454-33417476 CCCCACATACCCAGCCTTCTGGG + Intronic
1165771018 19:38380385-38380407 TTCCAAAAACACTGTCTTCTTGG - Intronic
1166606220 19:44145466-44145488 CACCACAACCTCTGCCTTCTGGG + Intronic
1166638103 19:44469697-44469719 CCCCACACACAGTGCCTACCAGG - Intergenic
1167172606 19:47843249-47843271 TTCCCCACACACTGGCCTCTGGG + Exonic
1167352424 19:48983901-48983923 CACCACCCCCACAGCCTTCTGGG + Intronic
1167400836 19:49267768-49267790 CACCACAACCTCTGCCTTCTGGG + Intergenic
1168559910 19:57373994-57374016 CCCCACACAGACTCCCTACTGGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925825828 2:7847572-7847594 CTCCATCCACACTGCCCTCCTGG + Intergenic
926211697 2:10875832-10875854 CACCACAACCTCTGCCTTCTGGG + Intergenic
926412050 2:12614717-12614739 CTCCAGACACACTGCCTATAGGG - Intergenic
926673645 2:15600508-15600530 CCCCACATTTACTGCCTTCTTGG + Intronic
926836697 2:17031384-17031406 CTCCACACACACTCCCCACTGGG - Intergenic
926947463 2:18203695-18203717 CTCCACACAGAGTCCCTACTGGG + Intronic
927249191 2:20982782-20982804 CTGCACGCACATTCCCTTCTGGG + Intergenic
927611835 2:24548996-24549018 CCCCACACACAGTCCCTACTGGG - Intronic
927871238 2:26625426-26625448 CACCACAACCTCTGCCTTCTGGG + Intronic
927893931 2:26769382-26769404 CTCCACAGACACTGTATTCTAGG - Intronic
928043214 2:27899546-27899568 CTCCTCAACCTCTGCCTTCTGGG + Intronic
928134247 2:28676335-28676357 CTCCACAGACACAGGCTTCTAGG - Intergenic
928264083 2:29796010-29796032 GTCCACACACACAGCCTTGAAGG + Intronic
928695791 2:33848675-33848697 CTCCACACAATCTGTCTCCTTGG - Intergenic
929078708 2:38100488-38100510 CTCCACCCACCCTGGCTTCCCGG + Intronic
930187561 2:48425641-48425663 CTCTGCACACACTGTATTCTGGG + Intergenic
930263138 2:49170389-49170411 CTCCACACAGAGTACCTACTGGG + Intergenic
931254975 2:60562853-60562875 CTCCACACCCACTTCCATCAGGG + Intergenic
932058901 2:68474742-68474764 CACCACAACCTCTGCCTTCTGGG + Intronic
932194940 2:69775145-69775167 CCCCACATAAACTGCCTTCTTGG + Intronic
932407239 2:71521693-71521715 CTCACCACACACTGGCTCCTTGG + Intronic
933047613 2:77558389-77558411 CTCCACACAGAGTCCCTACTGGG + Intronic
933371270 2:81418679-81418701 CTCCACACTATCTGCCTTCCTGG - Intergenic
935316191 2:101836510-101836532 CACCACAACCTCTGCCTTCTGGG - Intronic
935798030 2:106664200-106664222 CTCCACACTGGCTGCCTTCATGG - Intergenic
935860029 2:107319640-107319662 CACCACAACCTCTGCCTTCTGGG + Intergenic
936543499 2:113371214-113371236 AGTCACAGACACTGCCTTCTAGG + Intergenic
936874493 2:117172220-117172242 CTCCACACACAGTCCCCACTGGG + Intergenic
937210798 2:120268560-120268582 CCCCACACACACTCCCGTCCTGG - Intronic
937322047 2:120966751-120966773 CTGCCCTCACACAGCCTTCTTGG + Intronic
937368712 2:121283571-121283593 CTCCAGACAAACTTCCATCTCGG + Intronic
937908502 2:127064265-127064287 CTCCACGCTCACTGCCCTCCCGG - Intronic
939559254 2:143714029-143714051 CCCCACACAGAGTCCCTTCTGGG - Intronic
941693874 2:168529959-168529981 CTCTACACAGACTGTCTTATAGG - Intronic
941694672 2:168538273-168538295 AGCCACACACAGTGCCTTCTAGG - Intronic
942054313 2:172168182-172168204 CTCCACACAGAGTCCCTACTGGG + Intergenic
942387850 2:175460937-175460959 CCCCACACACAGTCCCTACTGGG + Intergenic
943936271 2:193920097-193920119 CACCACAACCTCTGCCTTCTGGG - Intergenic
944155594 2:196604078-196604100 CACCACAACCTCTGCCTTCTGGG - Intergenic
944687673 2:202132098-202132120 CACCACAAACTCTGCCTCCTGGG - Intronic
945073701 2:206016004-206016026 CTCCACACAGAGTCCCTACTGGG + Intronic
945336593 2:208599766-208599788 CTCCACACAAAGTCCCTGCTGGG - Intronic
945561469 2:211345950-211345972 GTCCACACAGACTGCCATCATGG + Intergenic
945644103 2:212467711-212467733 CTCCACACACAGTTCCTACTGGG + Intronic
945904919 2:215581140-215581162 CACCGCAAACTCTGCCTTCTGGG - Intergenic
947276267 2:228395852-228395874 CTCCACAGAGACTCCCTACTGGG - Intergenic
948931070 2:241132711-241132733 TTCCACACACACTGACTGCTGGG - Intronic
1169237186 20:3940032-3940054 CACCACAACCTCTGCCTTCTGGG + Intronic
1169351116 20:4868732-4868754 CATCACACACAGTCCCTTCTGGG + Intronic
1169739901 20:8880940-8880962 CACCACAACCACTGCCTCCTGGG + Intronic
1169908746 20:10629943-10629965 CCGCACACACTCAGCCTTCTGGG - Intronic
1169945775 20:10986287-10986309 CCCCACCCCCACTGCCTTCATGG - Intergenic
1170748451 20:19121908-19121930 CTCAGCACACACTACATTCTTGG - Intergenic
1170873308 20:20228482-20228504 CTCCACACACCCTGCCTATGTGG + Intronic
1171425984 20:25048950-25048972 CTCCTCACTCACTGGCTTATCGG + Intronic
1172126227 20:32626831-32626853 CTCCACTCACCCTGCCTTGCAGG - Intergenic
1172351766 20:34248567-34248589 CTCAAGAGACACTGCCTCCTCGG - Intronic
1173228585 20:41176796-41176818 CAACAAACACTCTGCCTTCTGGG - Intronic
1173319700 20:41976341-41976363 CTCTACACACAATGACTCCTGGG + Intergenic
1173512734 20:43643089-43643111 CACCACAACCTCTGCCTTCTGGG - Intronic
1173902169 20:46598858-46598880 CTCCAGCCACACTGGCTTCCTGG + Intronic
1174598531 20:51704702-51704724 CACCACAACCTCTGCCTTCTGGG - Intronic
1175054906 20:56189241-56189263 CACCGCAAACTCTGCCTTCTGGG - Intergenic
1175138112 20:56840131-56840153 CTCCCCACACACTGCCTGGGGGG - Intergenic
1175467836 20:59204599-59204621 CTCCACACACATTCCTTTCTGGG - Intronic
1177077774 21:16599301-16599323 CACCACACCCTCTGCCTCCTGGG - Intergenic
1177699245 21:24615126-24615148 CTCCACACAGAGTCCCTACTGGG + Intergenic
1180830546 22:18903820-18903842 CTCCACACAGACACCCTTCATGG + Intergenic
1180861555 22:19085603-19085625 CTTCCCACTCACTCCCTTCTGGG - Intronic
1180976105 22:19849442-19849464 CACCACACCCTCTGCCTCCTGGG + Exonic
1181433127 22:22894909-22894931 CTCCCCACACACTGCCTGCCAGG + Intronic
1181892509 22:26076021-26076043 CACCCTACACACTACCTTCTAGG + Intergenic
1181963055 22:26636924-26636946 CTCTACATCCAGTGCCTTCTAGG - Intergenic
1182097980 22:27638752-27638774 CTCCACACCTCCTGCCTTCCTGG - Intergenic
1182741333 22:32570153-32570175 CTCCACACACACTGCCTTCTAGG + Intronic
1182869633 22:33634806-33634828 CTCCAAACACACATCCTTCTTGG - Intronic
1183539586 22:38422301-38422323 CACCACAACCTCTGCCTTCTGGG - Intergenic
1183937992 22:41274999-41275021 CTCCACACACACCACCTACTTGG - Intronic
1184233671 22:43171736-43171758 CCCCGCCCACACTGCCTCCTAGG - Intronic
1185066597 22:48635398-48635420 CTCCAGCCACTCTGCCTTCCTGG + Intronic
1203280636 22_KI270734v1_random:129091-129113 CTCCACACAGACACCCTTCATGG + Intergenic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
953399957 3:42604762-42604784 CACCACACCCTCTGCCTTCCTGG + Intronic
953856934 3:46506390-46506412 CCCCATACACACTCCCTACTAGG + Intergenic
954002181 3:47566382-47566404 CGCCACACTCACTGCCTGCAAGG - Intronic
954445117 3:50542252-50542274 CTCTACACTCCCTGCCTCCTTGG + Intergenic
954453580 3:50585081-50585103 TTCCTCACCCACTCCCTTCTGGG - Intergenic
954465133 3:50649867-50649889 CTCCACCCCCACTTCCTTCAGGG + Intergenic
954873394 3:53784838-53784860 CTCCAGCCACACTGGCTGCTGGG - Intronic
954980427 3:54740713-54740735 CACCTCACCTACTGCCTTCTGGG - Intronic
955435455 3:58894709-58894731 CACCACACAGACTCCCTACTGGG - Intronic
955905264 3:63800894-63800916 ATCCACATATCCTGCCTTCTTGG - Intergenic
956683251 3:71801665-71801687 CACCACACCCTCTGCCTCCTGGG + Intergenic
957260601 3:77896981-77897003 CTCCACACAAAATCCCTCCTGGG - Intergenic
958160820 3:89815252-89815274 CTCCACACAGAGTCCCTACTGGG - Intergenic
958550565 3:95607122-95607144 CCCCACACAGACTCCCTACTGGG - Intergenic
958724481 3:97887678-97887700 CACCACAACCCCTGCCTTCTGGG - Intronic
958765444 3:98361570-98361592 CTCCACACACACTCCTCTCAAGG - Intergenic
959059919 3:101607007-101607029 CTCCACAACCTCTGCCTGCTGGG + Intergenic
959626509 3:108457956-108457978 CACCACAATCTCTGCCTTCTGGG - Intronic
960564382 3:119118162-119118184 CTCCACACAGAGTCCCTACTGGG - Intronic
961071995 3:123940636-123940658 ATTCACACACTCTACCTTCTTGG + Intronic
963441434 3:145344921-145344943 CCCCACACAGAATCCCTTCTGGG - Intergenic
963757476 3:149250725-149250747 CTCCAGACACACAGGCCTCTTGG - Intergenic
963893900 3:150665120-150665142 CTCCAGACAAACTTCTTTCTTGG - Intronic
963952861 3:151221809-151221831 CCCCACACAGAGTGCCTACTGGG + Intronic
964088556 3:152847047-152847069 CCCCACACAGAGTGCCTACTGGG + Intergenic
964122229 3:153196858-153196880 CTCCCCACACACTGACTACTTGG - Intergenic
964508585 3:157425361-157425383 CTCCACACAGAGTCCCTACTGGG + Intronic
964880924 3:161422073-161422095 CTCCACATCCCCTGGCTTCTGGG + Intergenic
965305090 3:167054083-167054105 ACACACACACACTGCCTTTTTGG - Intergenic
966083293 3:176033530-176033552 CTCCCCTCACACTGTTTTCTAGG + Intergenic
966326991 3:178767881-178767903 CTACACACACACTCCATACTGGG + Intronic
967388102 3:188929825-188929847 CCCCACACTCACAGCCCTCTTGG + Intergenic
968036098 3:195549408-195549430 CACCACAAACTCTGCCTTCTGGG + Intergenic
968067889 3:195768936-195768958 CTGCACACACACTCCCATCCTGG - Intronic
968147169 3:196309339-196309361 CACCACAAACTCTGCCTCCTGGG + Intronic
968190152 3:196661364-196661386 CTGCTCAGACACAGCCTTCTGGG - Exonic
968392737 4:206007-206029 CTCCACAAACCCTCCCTTCACGG - Intergenic
968405659 4:337347-337369 CTCCACAAATCCTGCCTTCGGGG - Intergenic
968469529 4:773005-773027 CACCATGCACACTGCCTTGTAGG + Intergenic
969630767 4:8334724-8334746 CTCTACAGACACTGCGTGCTAGG + Intergenic
969667729 4:8571555-8571577 CTCCACATGGACTGTCTTCTTGG + Intronic
970106648 4:12593416-12593438 CTCCAGACCCAGTGCCTCCTTGG - Intergenic
970127613 4:12832191-12832213 CCCCACACAGAGTCCCTTCTAGG - Intergenic
971214550 4:24651046-24651068 CTACACAGACATTGCTTTCTTGG - Intergenic
972463420 4:39328586-39328608 CTCCAGGCACACTTCCGTCTCGG - Intronic
972734662 4:41828989-41829011 CTCCACAGATACATCCTTCTTGG + Intergenic
973035181 4:45397113-45397135 CTCCACACAGAGTCCCTACTGGG - Intergenic
974269589 4:59633304-59633326 CTCCACACAGAGTCCCTCCTGGG - Intergenic
974322530 4:60369580-60369602 CTCCACACAGAGTCCCTACTGGG + Intergenic
974430572 4:61791625-61791647 CTCCACACAAAGTCCCTACTGGG - Intronic
974517495 4:62936343-62936365 CTCCACACAGAGTCCCTACTGGG + Intergenic
974897621 4:67958172-67958194 CTCCACACAAAGTCCCTACTGGG + Intronic
975581160 4:75907986-75908008 CACCACAGACTCTGCCTCCTGGG - Intergenic
975935096 4:79570162-79570184 CACCACAACCTCTGCCTTCTGGG + Intergenic
976057116 4:81081593-81081615 CTCCACACAGAGTCCCTACTGGG + Intergenic
976882760 4:89948876-89948898 CTGCACACAGCTTGCCTTCTAGG - Intronic
976890472 4:90040173-90040195 CTCCACACTGCCTGCCTTGTCGG + Intergenic
977014697 4:91678116-91678138 CTCCACACAGAGTCCCTACTGGG + Intergenic
979079131 4:116312095-116312117 CTCCACACAGAGTCCCTACTGGG - Intergenic
979426384 4:120572425-120572447 CCCCACACAGACTCCCTACTGGG - Intergenic
981281648 4:142966086-142966108 CCCCACACAGAGTGCCTACTGGG - Intergenic
981638956 4:146913072-146913094 CACCCCCCAAACTGCCTTCTAGG - Intronic
982165996 4:152614107-152614129 CTCACCACACACTGCCATGTCGG - Intergenic
983416892 4:167468566-167468588 CACCACAACCTCTGCCTTCTGGG - Intergenic
983437247 4:167731293-167731315 CCCCACACAGAGTGCCTACTGGG + Intergenic
983529051 4:168791119-168791141 CTGCAAACACACTTCCTCCTGGG - Intronic
984416016 4:179459284-179459306 CCCCACACACAGTCCCTACTGGG + Intergenic
984774297 4:183467268-183467290 CTCCACACAGACTCCCTCCTGGG + Intergenic
985430099 4:189871029-189871051 TCCCACATTCACTGCCTTCTTGG + Intergenic
985635548 5:1034088-1034110 CTCCAGCCACGCTGCCCTCTAGG + Intronic
987131898 5:14868122-14868144 CTCCACACACACTGGCTCTGGGG + Intronic
987511655 5:18847570-18847592 CTCCACACAGAGTCCCTACTGGG - Intergenic
987571112 5:19660696-19660718 TTCTACAGACTCTGCCTTCTTGG - Intronic
988909321 5:35823848-35823870 TACCACAAACTCTGCCTTCTGGG - Intergenic
989032785 5:37136561-37136583 CCCCACACAAATTCCCTTCTGGG - Intronic
989186725 5:38633117-38633139 CTCCACATTGACTACCTTCTTGG - Intergenic
989662654 5:43816029-43816051 CTCCACACATAGTCCCTACTGGG + Intergenic
989736597 5:44715125-44715147 CTGCACACAGAGGGCCTTCTGGG + Intergenic
989767475 5:45104086-45104108 CTCCACACAGAGTCCCTACTGGG + Intergenic
990429190 5:55717807-55717829 CCCCACAGACACTCCCTACTGGG + Intronic
990844546 5:60122282-60122304 CTCCACACAGAGTCCCTACTGGG - Intronic
991572562 5:68070734-68070756 CTCCACACACACTTTCTCCCTGG + Intergenic
991577173 5:68116507-68116529 CTACACACAGGCTGCCTTCCTGG + Intergenic
992169567 5:74088190-74088212 CTCTACAGCCTCTGCCTTCTGGG - Intergenic
993293835 5:86109259-86109281 CTCCACACAGAGTCCCTACTGGG + Intergenic
994349175 5:98724932-98724954 CTCCACATCCTCTGCCTTGTAGG - Intergenic
994849462 5:105035856-105035878 CTCCACACAGAGTCCCTACTGGG - Intergenic
994895575 5:105697974-105697996 CCCCACACAGAGTGCCTACTGGG - Intergenic
995220402 5:109641497-109641519 CTCCACACAGAGTTCCTACTGGG + Intergenic
995834534 5:116387149-116387171 CTCGAGGGACACTGCCTTCTTGG - Intronic
996257762 5:121426487-121426509 CTCCACACAGAGTCCCTACTGGG - Intergenic
996273431 5:121636587-121636609 CTCTACACAGACTCCCTTCTGGG - Intergenic
996967273 5:129321062-129321084 CCCCACACACAGTCCCTACTGGG - Intergenic
997643995 5:135468271-135468293 CTCCAGACACACACCCTCCTTGG - Intergenic
998483295 5:142480657-142480679 CTCCACCTTCACTGGCTTCTGGG + Intergenic
998871480 5:146557076-146557098 CTCCACACAGAGTCCCTACTAGG - Intergenic
999164438 5:149536027-149536049 CACCACAATCTCTGCCTTCTGGG + Intronic
999716156 5:154361982-154362004 CTCCACCCAGACAGCCATCTGGG + Intronic
999804862 5:155071988-155072010 CTCCACACACAGTCCCTACTGGG - Intergenic
1000141376 5:158406786-158406808 CTCCAATCATGCTGCCTTCTGGG - Intergenic
1000452025 5:161401089-161401111 CTACCCACACTCTGCCCTCTAGG + Intronic
1000564867 5:162834809-162834831 CCCCACACACAGTCCCTACTGGG - Intergenic
1000676305 5:164126758-164126780 CTCCACACAGAGTCCCTACTGGG - Intergenic
1001083322 5:168682613-168682635 CTCCACACACACTGTTGTCAAGG - Intronic
1001485055 5:172113835-172113857 CTCCACAACCGCTGCCTCCTGGG - Intronic
1001846322 5:174924586-174924608 CTCCACCCACACTCTCTTTTTGG - Intergenic
1002447219 5:179296964-179296986 CTACAGACACCCTGCTTTCTGGG - Intronic
1002555284 5:180033047-180033069 CACCACAACCTCTGCCTTCTGGG + Intronic
1003227418 6:4218764-4218786 CTCCACACAGAGTCCCTACTGGG - Intergenic
1004320234 6:14626207-14626229 TGTCACACCCACTGCCTTCTGGG + Intergenic
1004386198 6:15174841-15174863 CTCCTCACACACATCCTTATGGG + Intergenic
1006244137 6:32715386-32715408 CACCACAACCTCTGCCTTCTGGG - Intergenic
1006757173 6:36426444-36426466 CACCACAACCTCTGCCTTCTGGG + Intronic
1007060666 6:38937617-38937639 CTTCACACCCACTGTCATCTTGG - Intronic
1007671481 6:43558017-43558039 CACCACAACCTCTGCCTTCTGGG - Intronic
1007741947 6:44016949-44016971 CTCCAGGCACACCACCTTCTAGG - Intergenic
1007922858 6:45626473-45626495 CTGCCCACTCTCTGCCTTCTGGG - Intronic
1008224223 6:48892887-48892909 CCACACACACACTTACTTCTTGG - Intergenic
1009396233 6:63203658-63203680 CTCCACACAGAGTCCCTACTGGG - Intergenic
1009634924 6:66253087-66253109 CCCCACACAGAGTGCCTACTGGG - Intergenic
1009772505 6:68161279-68161301 CCCCACACAGAGTGCCTACTGGG + Intergenic
1010234752 6:73566034-73566056 CACCACACCCTCTGCCTCCTGGG - Intergenic
1010920346 6:81673064-81673086 CCCCACACAGAGTGCCTACTGGG - Intronic
1010968768 6:82242291-82242313 CACCACAAACTCTGCCTCCTGGG - Intronic
1011609023 6:89132372-89132394 CTCCACAGGAACTGCCTCCTTGG - Intergenic
1012261767 6:97095601-97095623 CTATACACAAAATGCCTTCTAGG + Intronic
1012569099 6:100700428-100700450 CTCCACACAGAGTCCCTACTGGG + Intronic
1016593289 6:145769731-145769753 CACCACAATCTCTGCCTTCTGGG - Intergenic
1017580484 6:155859469-155859491 CTCCACACAGAGTCCCTACTGGG + Intergenic
1019018521 6:168898427-168898449 CTCTACAAACACTGGCTACTTGG + Intergenic
1019643841 7:2118681-2118703 CTGCCCACACACTGCCTCCATGG + Intronic
1020590725 7:10133278-10133300 CACCACAACCTCTGCCTTCTGGG - Intergenic
1020941067 7:14538002-14538024 CACCACAAACTCCGCCTTCTAGG - Intronic
1021439736 7:20664253-20664275 CCACACTCACACTGTCTTCTTGG + Intronic
1021733870 7:23623518-23623540 CACCACAACCTCTGCCTTCTGGG - Intronic
1022637767 7:32153442-32153464 CTCCATCCACACTGCCTTGACGG - Intronic
1023451651 7:40292342-40292364 TTCCAGAAACACTGTCTTCTTGG + Intronic
1023906475 7:44525843-44525865 CTACAAACCCACTGCCATCTGGG - Intronic
1024070759 7:45783329-45783351 CACCACATTCTCTGCCTTCTGGG + Intergenic
1024383504 7:48725330-48725352 CTCCACACAGAGTTCCTTCTGGG - Intergenic
1026278696 7:68902903-68902925 CTCCACACAGAGTTCCTACTGGG + Intergenic
1026410683 7:70118699-70118721 CACCACAACCTCTGCCTTCTGGG - Intronic
1026972328 7:74475988-74476010 CTCCACGCACACAGACATCTTGG - Intronic
1027969292 7:85057853-85057875 CTCTACAACCTCTGCCTTCTGGG - Intronic
1028160626 7:87480668-87480690 CTCCAGCCACACTGGCCTCTTGG + Intergenic
1028180195 7:87711248-87711270 CTCCACAACCTCTGCCTCCTGGG - Intronic
1029516811 7:101029110-101029132 CACCACAACCTCTGCCTTCTGGG - Intronic
1030722362 7:112884826-112884848 CTCCACACAGAGTCCCTACTGGG - Intronic
1031143416 7:117971084-117971106 CACCACATACACTACCTTTTAGG + Intergenic
1032008499 7:128324547-128324569 CTCCCTACTCACAGCCTTCTCGG + Exonic
1032927024 7:136618862-136618884 TTTCAAACACACTGCCTTTTGGG - Intergenic
1033082842 7:138314102-138314124 CCCCACACTGACTACCTTCTTGG + Intergenic
1033463046 7:141564803-141564825 CACCACAACCTCTGCCTTCTGGG + Intronic
1033481667 7:141747920-141747942 CGCTACAAACACTGCCTCCTGGG - Intronic
1034750021 7:153559902-153559924 CTCCACACAGAGTCCCTACTGGG - Intergenic
1035673311 8:1436650-1436672 CTCTACACACACTGCAAACTTGG - Intergenic
1036233882 8:7021787-7021809 GTCCACACACACTGTCTGCTGGG - Intergenic
1036461800 8:8960064-8960086 CCCCACACACAGTCCCTACTGGG - Intergenic
1036796736 8:11761515-11761537 CACCACAACCTCTGCCTTCTGGG - Exonic
1037797229 8:22006066-22006088 ATCCACACACACTGCCTCGAGGG - Exonic
1037993311 8:23336027-23336049 CTCCAGACACACTTCCTGCAAGG + Intronic
1039365796 8:36926706-36926728 CTCCACAAAGACTGTCTTCTGGG + Intronic
1039473413 8:37827225-37827247 CCCCACCCACTCTGCCTTCTAGG + Intronic
1039651463 8:39344116-39344138 CACCACAACCTCTGCCTTCTGGG + Intergenic
1039828551 8:41195022-41195044 CTTCACACAGACAGCCTGCTGGG + Intergenic
1040722912 8:50348136-50348158 CTCCAGTCTCACTGCCTCCTTGG - Intronic
1042124358 8:65522458-65522480 CACCACAACCTCTGCCTTCTGGG - Intergenic
1042181034 8:66087974-66087996 CCCCACACACAGTCCCTACTGGG - Intronic
1042185155 8:66129275-66129297 CTCTTCACACCGTGCCTTCTAGG - Intronic
1042279116 8:67036085-67036107 TTCCACCCACACTGTCCTCTGGG - Intronic
1042933016 8:74031782-74031804 CTCCACATTGACTGTCTTCTTGG - Intergenic
1043254922 8:78123124-78123146 CTTCAGACACACTGGCTTCTGGG - Intergenic
1045733820 8:105272236-105272258 CTCCACCCAAACTGGCTTATTGG - Intronic
1045818059 8:106300862-106300884 CTCTTCATACACTGCCTTCCAGG + Intronic
1047565388 8:126038899-126038921 CACCACAAACTCTGCCTCCTGGG + Intergenic
1051286619 9:15503820-15503842 CACCACACCCTCTGCCTCCTGGG + Intronic
1054810117 9:69427960-69427982 GTCCTCACACACTGCCTTGATGG + Exonic
1055794095 9:79955464-79955486 CTCCACACAGAGTCCCTACTGGG + Intergenic
1055856671 9:80696518-80696540 CACCACAAACTCTGCCTCCTGGG - Intergenic
1056027239 9:82511756-82511778 CTCCATACACAGTTCATTCTGGG + Intergenic
1056719616 9:89060563-89060585 CTCCAGCTACACTGGCTTCTGGG - Intronic
1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG + Intergenic
1057365937 9:94420821-94420843 CACCACAATCACTGCCTCCTGGG - Intronic
1057492983 9:95537105-95537127 CTCACCACAAACTGCCTCCTTGG + Intergenic
1057537508 9:95927482-95927504 CCCCACACACAGTGCTTTCAGGG - Intronic
1057622491 9:96648847-96648869 CACCACAACCTCTGCCTTCTGGG + Intronic
1057776890 9:98018680-98018702 TTCCACACTCACTGCAATCTTGG - Intergenic
1057910222 9:99014583-99014605 CTCCACTCAGAATCCCTTCTTGG + Intronic
1059279492 9:113120125-113120147 CACCACAACCTCTGCCTTCTGGG - Intergenic
1059316135 9:113427243-113427265 CACCACAACCTCTGCCTTCTGGG + Intronic
1059892443 9:118817914-118817936 CCCCACATTGACTGCCTTCTTGG + Intergenic
1060821888 9:126665925-126665947 CTCCGCACATGCTGCCTGCTGGG - Intronic
1061142405 9:128775691-128775713 AACCACAAACTCTGCCTTCTGGG - Intergenic
1062366696 9:136213073-136213095 CTGTACCCACACTGCCTTCAAGG + Intronic
1062564771 9:137159277-137159299 CTCCACACACACTCCAGTCCTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1187352423 X:18532698-18532720 GTACACACACACTACTTTCTCGG - Intronic
1188467059 X:30493684-30493706 CCCCCTCCACACTGCCTTCTCGG + Intergenic
1188771817 X:34162705-34162727 CTCCACACATACTGGGTTTTGGG - Intergenic
1188814469 X:34694614-34694636 CACCACAACCTCTGCCTTCTGGG + Intergenic
1189198987 X:39175586-39175608 CTCCTTCCCCACTGCCTTCTGGG - Intergenic
1189327354 X:40120852-40120874 CTCCCCACACCCTGCCTTCCAGG - Intronic
1190707631 X:53043841-53043863 CTCCAAACACACTACCCTCTGGG + Intergenic
1191598432 X:62974183-62974205 CCCCACAGACAGTCCCTTCTGGG - Intergenic
1191635878 X:63376355-63376377 CACCACAACCTCTGCCTTCTGGG + Intergenic
1191689794 X:63927878-63927900 CCCCACACACACTCCCCACTGGG + Intergenic
1192347211 X:70320666-70320688 CTCCACTCCCACACCCTTCTTGG - Intronic
1193322561 X:80139846-80139868 CTCCTGACACTCTGCCTGCTGGG + Intergenic
1194200716 X:90950599-90950621 CCCCACACCCACCGCCATCTTGG - Intergenic
1194489323 X:94527246-94527268 CCCCACACACAGTCCCTACTTGG - Intergenic
1196395596 X:115258627-115258649 CTCCTCAAACTCTTCCTTCTAGG + Intergenic
1198989437 X:142494595-142494617 ACACACACACACTGCCTTCAGGG + Intergenic
1199228700 X:145409774-145409796 CTCCACACACAGTCCCCACTGGG + Intergenic
1199310025 X:146311321-146311343 CTCCACACAAAGTCCCTACTGGG - Intergenic
1199325513 X:146493808-146493830 CCCCACACACAGTCCCTACTGGG + Intergenic
1199964434 X:152807780-152807802 CTACTCCCACACTGCCTTCTGGG - Intergenic
1201794472 Y:17880078-17880100 CTCCACACTTACTGCCTGGTGGG + Exonic
1201807082 Y:18025907-18025929 CTCCACACTTACTGCCTGGTGGG - Exonic
1201924075 Y:19265993-19266015 CTCCACACAGAGTCCCTACTGGG - Intergenic