ID: 1182741760

View in Genome Browser
Species Human (GRCh38)
Location 22:32572777-32572799
Sequence AGCTGGAGTTGCTGAAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182741760_1182741768 28 Left 1182741760 22:32572777-32572799 CCAGGACTTCAGCAACTCCAGCT 0: 1
1: 0
2: 4
3: 21
4: 302
Right 1182741768 22:32572828-32572850 TCACTCTCACTGGCCCTCCTTGG 0: 1
1: 0
2: 4
3: 25
4: 218
1182741760_1182741764 18 Left 1182741760 22:32572777-32572799 CCAGGACTTCAGCAACTCCAGCT 0: 1
1: 0
2: 4
3: 21
4: 302
Right 1182741764 22:32572818-32572840 GTTCCCCATCTCACTCTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182741760 Original CRISPR AGCTGGAGTTGCTGAAGTCC TGG (reversed) Intronic
900787454 1:4657647-4657669 AGCTGGGGTGGCAGAAGGCCTGG + Intronic
900997623 1:6130882-6130904 AGCAGGAGTGGCTGAAGCCCTGG - Intronic
901039290 1:6354541-6354563 GGCTGGGGAGGCTGAAGTCCAGG + Intronic
902440400 1:16425641-16425663 AGCTGGGGTTGCTGCCTTCCTGG - Intronic
902755413 1:18546153-18546175 AGCTGGAGCTGCTGAACTGGGGG - Intergenic
904150275 1:28432971-28432993 AGCGGGGGTTGCTTGAGTCCAGG - Intronic
905172915 1:36119575-36119597 AGCTGGATTTGCTGTGCTCCAGG + Intronic
905945087 1:41895159-41895181 AGGTGCAGCTGCTGAAGACCAGG + Intronic
906651469 1:47515897-47515919 AGTTGGTGTAGCTGAAGTACAGG - Intergenic
906710622 1:47927184-47927206 AGCTGGTCTTGGTGAAGGCCTGG + Intronic
907183510 1:52591076-52591098 AGGTGGATTTGCTGGAGCCCAGG + Intergenic
907559565 1:55376056-55376078 ACCTGGAGTTAGTGAAGCCCTGG + Intergenic
907808140 1:57841667-57841689 AGCTGGAGTGGCTGGAATGCAGG + Intronic
907817855 1:57937797-57937819 ATCTGGAGGAGCTGATGTCCTGG + Intronic
909133423 1:71767837-71767859 AGCTGGAGTTGCTGGGATGCAGG - Intronic
911165700 1:94722521-94722543 TGCACCAGTTGCTGAAGTCCTGG - Intergenic
912413996 1:109495890-109495912 TGCTGGAGATGATGAAGCCCAGG - Exonic
912509323 1:110177572-110177594 AGCTGGGGTTTCTGATGTACAGG - Intronic
912843215 1:113057652-113057674 AGCTGTAGTGGATGAAGTGCAGG + Intergenic
913360964 1:117979471-117979493 TGCGAGAGTTGCTGAAGACCTGG - Intronic
914923275 1:151861550-151861572 AGCTGCAGTTGCTGAAGGTGGGG - Intergenic
915321167 1:155057200-155057222 GGCTGCAGTTGCTGAAGTTCAGG - Exonic
920059349 1:203216909-203216931 TGCAGGAGTTGCTGAACACCAGG + Exonic
922447315 1:225708297-225708319 AGCTGGATGTCCTGAAGTCAAGG + Intergenic
923232216 1:231997652-231997674 GGATGGAGATGCTGAAATCCTGG - Intronic
924042164 1:239994497-239994519 AGCTGGAATTGCTGAATTATAGG + Intergenic
1065045094 10:21740090-21740112 ATCTGCAGCTGCTGAAGTTCAGG - Exonic
1068832936 10:61518733-61518755 AGATGGAGTTGCTGTCATCCAGG - Intergenic
1070591970 10:77807879-77807901 ATGTGGAGATGCTGAAGCCCAGG - Exonic
1071771013 10:88728770-88728792 AGCTGGACTGGAAGAAGTCCAGG - Intronic
1074576068 10:114670539-114670561 AGATCGAGTTGCTGCACTCCTGG - Intronic
1074669631 10:115774847-115774869 AGTTGGAGTTAGTGAAGTCATGG + Intronic
1074817198 10:117151419-117151441 AGCTGGAGGAGCTGGAGGCCAGG + Intergenic
1075188651 10:120286133-120286155 AGCAGGAGTGGCTGAAGCCTGGG + Intergenic
1075354282 10:121756721-121756743 AGCTGGAGTGGCTGAGATGCAGG + Intronic
1077141034 11:1024976-1024998 AGCTGGAGTTGGTGAACTCGTGG - Exonic
1077508510 11:2943170-2943192 GGCCGGAGGTGCTGAGGTCCTGG + Intergenic
1078145771 11:8721061-8721083 AGCTGGGCTTGCTGAGGGCCAGG - Intronic
1078320927 11:10333898-10333920 AGCTGGAGTAGCTGGAGTTGGGG + Intronic
1078827003 11:14939045-14939067 AGCTGGAGTAGCTGCAATGCAGG + Intronic
1079279752 11:19076600-19076622 AACTGGATTTGCTGAAGAACTGG + Intergenic
1080827477 11:35860330-35860352 TCATGGAGTTGCTGATGTCCAGG + Intergenic
1081528599 11:43943240-43943262 AGTCGGAGTCGCTGGAGTCCAGG - Exonic
1082119400 11:48362071-48362093 AGATGGAGTTACTGATGTCAAGG + Intergenic
1083150879 11:60791047-60791069 ACCTGGTGGTGCTGAAGTCTTGG + Exonic
1083958961 11:66003319-66003341 GGCTGGGATTGGTGAAGTCCTGG + Exonic
1084053399 11:66616050-66616072 CCCTGGGGTTGCTGAGGTCCTGG - Intergenic
1085622873 11:78050467-78050489 AGCTGAGCTTGCTGGAGTCCAGG + Intronic
1086663897 11:89456606-89456628 CGCAGGAGTTGCTGGGGTCCAGG - Intronic
1088494204 11:110417394-110417416 AGGATGATTTGCTGAAGTCCAGG + Intergenic
1089155193 11:116396522-116396544 AGCTGGAGTGGGGGAAGTGCTGG + Intergenic
1089213501 11:116821722-116821744 AGCTGGAGGAGCTGAGGGCCCGG - Exonic
1089562435 11:119350798-119350820 AGCTGGGGCTGTTGGAGTCCTGG + Intergenic
1090421231 11:126576564-126576586 AGATGGAGATGCTGAGGTCCAGG - Intronic
1090592874 11:128291131-128291153 AGCTGGAGCTGCTGGAGGCAGGG - Intergenic
1090936659 11:131348982-131349004 AGCTGAAGATGCAGAAGTCAGGG - Intergenic
1094202684 12:27809582-27809604 AGCTTGAGTTGAGGAGGTCCAGG - Intergenic
1095761561 12:45843618-45843640 AGATGCAGATGCTGCAGTCCAGG + Intronic
1096034839 12:48457594-48457616 AGTTGGATTTGCTCTAGTCCCGG + Intergenic
1096205477 12:49718149-49718171 TGCTTGAGTTGCTTAAGTCCAGG + Intronic
1098951489 12:76644930-76644952 AGCTGCAGCTGCTCAAGCCCTGG + Intergenic
1100362110 12:93888685-93888707 AGCTGGAGTTGCTGTCATCCAGG + Intronic
1100376070 12:94017481-94017503 AGCTGAAGTAGCTGAAATGCAGG - Intergenic
1102053432 12:109879651-109879673 AGATGGAGTTGCAAAATTCCAGG - Intronic
1102070307 12:110013544-110013566 AGGAGGATTTGCTGAAGCCCAGG + Intronic
1102331824 12:112039504-112039526 AGCAGGAGATGATGAAGGCCTGG - Intronic
1102993765 12:117333015-117333037 AGCTGGAGATGCTGTGGCCCAGG + Intronic
1103336528 12:120194438-120194460 AGCTCCAGCTGCTGAAGTCGAGG + Intronic
1103778437 12:123383665-123383687 TGCTGGAGTTGCTAAACTGCTGG + Intergenic
1107119573 13:36781655-36781677 AGCTGGAGCTGCTGAGGTGAAGG + Intergenic
1108230052 13:48328493-48328515 AGCTGGAGCTGCTGGAGTAATGG - Intronic
1109451416 13:62519419-62519441 ACCTGGAGATTATGAAGTCCAGG + Intergenic
1109936135 13:69287265-69287287 AGCTGGAGTTGCTGAGGGCCTGG - Intergenic
1111584052 13:90261571-90261593 AGCTGGAGTGGCTAAAATACAGG + Intergenic
1112881297 13:104109375-104109397 AGCTGGAGTGGCTGGAATGCAGG - Intergenic
1112984826 13:105435528-105435550 AGGTGGATTTGGTGAAGTCCAGG - Intergenic
1113897797 13:113776803-113776825 AGCTGGTGGTGCTGACGCCCTGG + Intronic
1116119713 14:40706433-40706455 AGCTGGAGTGGCTGAAATGCAGG + Intergenic
1118328149 14:64795421-64795443 TGCAGGAGCTGCTGCAGTCCCGG - Exonic
1118956777 14:70489813-70489835 AGCTGGAGTGGCTGGAATGCAGG + Intergenic
1120725564 14:87936074-87936096 GGCTGGGGTGGCTGAAGTCTGGG - Intronic
1121218099 14:92264181-92264203 AGGTGGTGTTACTGAAGCCCAGG + Intergenic
1122116185 14:99528430-99528452 ATCTGGAGTTTCTGAAGACGTGG - Intronic
1122826626 14:104373900-104373922 AGCTGGAGGTGCTGCAGTGGCGG - Intergenic
1126167502 15:45666335-45666357 AGATGGAGTTCCTGAAGGGCAGG + Intronic
1126190568 15:45873808-45873830 GGCTGGAGTGGCTGAAAACCAGG + Intergenic
1128512499 15:68322059-68322081 GGATGGAGGTGGTGAAGTCCAGG + Intronic
1128875598 15:71198699-71198721 AGCTGGGGTTCCTGAATGCCAGG - Intronic
1129389412 15:75213200-75213222 AGGTGGAGTTTCTGAACTCTGGG + Intergenic
1129904007 15:79173208-79173230 AGCTGGAGCTGCAGAAGCACTGG - Intergenic
1130823696 15:87521535-87521557 AGCTGAAGTTCCTTAATTCCTGG - Intergenic
1131767377 15:95693428-95693450 AGCAGTGGTTGCTGAAGTCTGGG + Intergenic
1131836249 15:96394378-96394400 TGCAGGAGTGGCTGAATTCCAGG - Intergenic
1132049675 15:98596635-98596657 AGAGGGAGTTGCTTCAGTCCTGG - Intergenic
1132994215 16:2814690-2814712 AGCTGGTGCTTCTGGAGTCCTGG - Intergenic
1132996802 16:2827698-2827720 AGCTGGTGCTTCTGGAGTCCTGG + Intergenic
1133023080 16:2975389-2975411 AGCAGGAGCTGGTGAGGTCCAGG - Exonic
1133553447 16:6881886-6881908 AGCTGGAGTTGCTGTATAGCAGG + Intronic
1136570543 16:31094093-31094115 AGCTGGAGATTCTGGGGTCCAGG - Intronic
1137709552 16:50556634-50556656 AGCTGGAGAATCTGAAGCCCAGG - Intronic
1138924724 16:61576869-61576891 GCATGGAGTTGCTGAACTCCAGG - Intergenic
1140670064 16:77269399-77269421 GGCTGGAGTTGCTGAAATTCTGG + Intronic
1140821865 16:78670205-78670227 AGCTGGAGTTTAGGAAGGCCAGG + Intronic
1141035066 16:80619420-80619442 AGCTGGATTTCCAGAAGTCCAGG - Intronic
1142010953 16:87713910-87713932 AGCTTGAGTTACTGAACTCGGGG - Intronic
1144176455 17:12712398-12712420 TGCTGGAGTTGCCCAACTCCAGG + Intronic
1146073627 17:29707356-29707378 ATCAGGAGTTTCTGGAGTCCAGG - Intronic
1146589636 17:34117617-34117639 AACAGAAGATGCTGAAGTCCTGG + Intronic
1147448125 17:40487426-40487448 GGCTGGAGTTGCTGGAGTGCAGG + Exonic
1150469333 17:65423495-65423517 AGCTGGAGGAGCTGGAATCCTGG + Intergenic
1150658353 17:67055379-67055401 ACCTGGAGTCGCTGATGGCCTGG - Intronic
1151336927 17:73445558-73445580 AGCTGGACTTCCTGGAGTCCAGG + Intronic
1151756918 17:76080375-76080397 GGCTGCAGTTGCTGTGGTCCCGG - Exonic
1152268085 17:79307760-79307782 AGCTGGAGGGGCTGCAGACCTGG + Exonic
1152574620 17:81134583-81134605 ACCTGGACTTGCTGCATTCCAGG + Intronic
1152648662 17:81481950-81481972 AGCTGGAGAGGCAGATGTCCTGG + Intergenic
1153819522 18:8821242-8821264 GGCTGGAGCTTCTGTAGTCCAGG - Intronic
1154981109 18:21503230-21503252 AGATGGAGTTTCTGTCGTCCAGG + Intronic
1156521899 18:37728960-37728982 AGAGGGAGATGCTGATGTCCTGG + Intergenic
1157567949 18:48692639-48692661 GGCTGGAGATGCAGAAGTTCAGG - Intronic
1158019706 18:52827055-52827077 ATCTGGGGATGCTCAAGTCCGGG - Intronic
1158550464 18:58431292-58431314 AGCTGGAAGTGCTGCAGTACAGG - Intergenic
1159722944 18:71915846-71915868 AGCTGGAGATGCTGGGGTACTGG - Intergenic
1160763247 19:796273-796295 AGCTGGGGAAGCTGAGGTCCGGG - Intergenic
1160802527 19:976950-976972 ACATGGAGTGGGTGAAGTCCAGG + Intergenic
1161045554 19:2132560-2132582 GGCTGGGGCTGCTCAAGTCCTGG + Exonic
1162069743 19:8146506-8146528 AGCTGGAGGTGCTGGGGTCCTGG + Intronic
1162966970 19:14160622-14160644 AGGTGCAGTTGCTGAGGTCAGGG + Exonic
1165255711 19:34576399-34576421 AGCTGGGGAAGCTGAATTCCAGG + Intergenic
1167383581 19:49151814-49151836 AGGTGGAGTTGCTGGAGCCAAGG - Intronic
1167435985 19:49478976-49478998 AGCTGGTGGCGCTGAAGCCCTGG + Exonic
1167738667 19:51311663-51311685 GGCTGGAGCTGCTGCAGACCCGG - Intergenic
1168073029 19:53963141-53963163 AACTGGAGTCGCTGAAGCGCTGG + Exonic
1168300562 19:55402480-55402502 AGCTGGGGCTGCTGGAGGCCTGG - Intronic
925552430 2:5090834-5090856 AGCTGGAGGAGCTGAAGCTCAGG - Intergenic
926774289 2:16406891-16406913 AGCTGGAATTTCTGAGGGCCAGG + Intergenic
926912313 2:17862541-17862563 AGCTGGTGTGGCTGATGGCCTGG + Intergenic
928495002 2:31822690-31822712 GCATGGAGTTGCTGCAGTCCAGG + Intergenic
928876175 2:36042449-36042471 AGCTGGAGCTGCTTGGGTCCAGG + Intergenic
929689198 2:44060440-44060462 AGCTGGAGTGGCTGAGATGCAGG + Intergenic
929876398 2:45800426-45800448 GGCTGGAGTGGCTGGAGCCCAGG + Intronic
931912555 2:66917373-66917395 AGCTGAAGGTGCTGAACTTCTGG - Intergenic
933719612 2:85389712-85389734 AGCTGGAGTTGCTGCTGACTGGG + Intronic
934886768 2:98031910-98031932 AGCTGGAGATCCTGGAGTTCTGG + Intergenic
936281996 2:111149901-111149923 GGCTGTAGTTGTTGAAGTCAGGG + Intronic
936816562 2:116467996-116468018 ACCTGGAGTTGTAGAAGACCTGG - Intergenic
936872151 2:117146115-117146137 AGCTGGAGTGGCTGAGATGCAGG + Intergenic
937906951 2:127057069-127057091 AGCTGTGGGAGCTGAAGTCCAGG + Intronic
938102614 2:128507374-128507396 AGATTGAGGAGCTGAAGTCCTGG + Intergenic
938103016 2:128511323-128511345 AGCTGGAGTTCCTGAGCTGCGGG + Intergenic
938562249 2:132483638-132483660 TGCTGGAGTTGTTTTAGTCCAGG + Intronic
939224992 2:139353732-139353754 AGCTGGAGTTGCTGGGATGCAGG - Intergenic
942059614 2:172215884-172215906 AGCTGGAATTGTGGAAGTCCAGG - Intergenic
942283361 2:174389796-174389818 AGCTGGAGTGGCTGGAATGCAGG - Intronic
943386682 2:187210477-187210499 AGCTGGAGTGGCTGAGATGCAGG - Intergenic
945294193 2:208154657-208154679 AGATGGAGTTGTTGATGTGCTGG + Intergenic
945336637 2:208600047-208600069 AGCTGGAGTGGCTGGAATGCAGG + Intronic
946317171 2:218923977-218923999 AGCTGGAGTGGCTGGGATCCAGG + Intergenic
947508098 2:230725313-230725335 GGCTGGGATTGGTGAAGTCCTGG - Intronic
948292435 2:236835733-236835755 AGCTGGAGTGGCTGGAATGCAGG + Intergenic
948866033 2:240775307-240775329 AGCTGGAGAGGCTGATGCCCAGG - Intronic
1169974855 20:11313029-11313051 AGATGGAATAGCTGAGGTCCAGG - Intergenic
1173679898 20:44870971-44870993 AGCAGGAGTTGCAGAAGTCCAGG - Intergenic
1173995052 20:47331613-47331635 TGCTGGAGTTGCTGAAAGCTTGG - Intronic
1176190542 20:63807638-63807660 AAATGGAGTAGCTGAAGGCCGGG - Intronic
1176311736 21:5154321-5154343 GGCTGGAGTTGGTGCAGTCGGGG - Intronic
1178623595 21:34197604-34197626 GGCTGGTCTTGCTGAACTCCTGG - Intergenic
1179804240 21:43826872-43826894 AACTGGGGGTGCTGAGGTCCAGG + Intergenic
1179845314 21:44107714-44107736 GGCTGGAGTTGGTGCAGTCGGGG + Intronic
1181105846 22:20574735-20574757 AGCTGGTGTTTCTGGAGACCAGG - Intronic
1182741760 22:32572777-32572799 AGCTGGAGTTGCTGAAGTCCTGG - Intronic
1182838985 22:33369344-33369366 AGCTGGAGTCTCTGAAAACCTGG - Intronic
1183625208 22:38997542-38997564 AGCTGCTGATGCAGAAGTCCAGG + Intergenic
1183707102 22:39480858-39480880 TGCTGGATTTGCTGAAGAGCTGG - Intronic
1183857323 22:40643894-40643916 AGACGGAGTTGATCAAGTCCTGG - Intergenic
1184782958 22:46658286-46658308 TGCAGGAGGTGCTGAAGGCCAGG + Exonic
1185195910 22:49469510-49469532 ACCTGGAGTTGGTGAACACCCGG - Intronic
950079794 3:10213203-10213225 GAATGGAGGTGCTGAAGTCCTGG - Exonic
952483761 3:33788857-33788879 AGCAGCAGTTGCAGAAGTTCAGG + Intergenic
952752210 3:36833745-36833767 AGCTGGTGTTCTTGAAGTCTCGG - Exonic
952866114 3:37856234-37856256 AGGTGGAGGTCCTGAAGACCAGG - Intergenic
953885281 3:46711536-46711558 AGCAGCAGTTGCTGAAGACTGGG + Intergenic
953953801 3:47214614-47214636 AGATGGACTTGCTGATGTCCTGG - Intergenic
954509027 3:51105865-51105887 TGCAGGAGTTGCTGAAGGTCAGG - Intronic
958583889 3:96061448-96061470 AGCTGGAGTGGCTGGAATGCAGG - Intergenic
959374957 3:105577930-105577952 TGCTCAAGTTGCTGAAGTTCAGG + Intergenic
959730037 3:109590751-109590773 AGCTGGAGTGGCTGGAATGCAGG + Intergenic
960372881 3:116862661-116862683 AGCTGGTTTTGCTGCAGCCCTGG + Intronic
961379556 3:126488105-126488127 GGCTGAGGTTCCTGAAGTCCTGG - Intronic
962257195 3:133880634-133880656 AGCTGGGGCTGCAGAAGTGCAGG - Intronic
963442636 3:145358514-145358536 AGGTGGAGTTTCTGAAGCCCAGG + Intergenic
963882845 3:150547241-150547263 ATCTGGAATTACTTAAGTCCAGG - Intronic
967085668 3:186093107-186093129 AGCTGGAATTGCTGATATGCTGG - Intronic
967197233 3:187038926-187038948 AGCTGGTGTGGCAGATGTCCTGG + Intronic
967291094 3:187921046-187921068 AGCTGGAATTGCTCAACTTCAGG - Intergenic
967347743 3:188477166-188477188 AGCTGCAGCTCCTGAAGACCTGG + Intronic
967512064 3:190323361-190323383 GGCTGGAGTTGAGGAAGTCTGGG + Intronic
968816949 4:2827218-2827240 AGCTGGAGTCGCTGCAATGCAGG - Exonic
969443581 4:7231967-7231989 TGCTGGAGATGCAGATGTCCTGG + Intronic
970036149 4:11738221-11738243 AGCTGGAGTGGCTGGGGTGCAGG - Intergenic
970125586 4:12806435-12806457 AGCTGGAGTTACTTATGTCAAGG - Intergenic
971446694 4:26757981-26758003 ATCTGGAGAGGCTGAAGTACAGG - Intergenic
971545485 4:27880179-27880201 AGCTGGAGTGACTGAAATGCAGG + Intergenic
973046574 4:45541387-45541409 AGCTGGAGTGGCTGAGATGCAGG - Intergenic
973297409 4:48540457-48540479 AGGAAGAGCTGCTGAAGTCCTGG + Exonic
973646655 4:52956931-52956953 GGCTGGAGTTGCTGAAATCCTGG + Intronic
974267450 4:59603518-59603540 AGCTGGAGTGGCTGGAATGCAGG - Intergenic
975495814 4:75034979-75035001 AGCTGGAGTTTCTGAAGTTCAGG - Intronic
976798215 4:88958319-88958341 AGCTGGAGTGGCTGAGATGCAGG - Intronic
977820945 4:101472106-101472128 AGCTGGAGTGGCTGGGGTGCAGG - Intronic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
979732806 4:124045235-124045257 GGCTGGAGTTTCTGAAATTCAGG + Intergenic
982476234 4:155854799-155854821 AGCTGGAGGAGCTGTGGTCCTGG - Intronic
982634670 4:157879182-157879204 GGCCGGGGTTGCTGAGGTCCAGG - Intergenic
983171443 4:164540832-164540854 AGCTGGAGTTGCTGAGATGCAGG + Intergenic
983277226 4:165632673-165632695 AGTTGGAATTGCTGAAGACAAGG + Intergenic
984309371 4:178037459-178037481 AGCTGGAGTTACTTATGTCTAGG - Intergenic
985152129 4:186958410-186958432 TGCTGGAGACGTTGAAGTCCAGG - Intergenic
985156061 4:186988176-186988198 AGCTGGAGTGGCTGGAATGCAGG + Intergenic
987096974 5:14558897-14558919 AGCTGGAGCAGCAGAAGGCCAGG + Intergenic
987259871 5:16192648-16192670 AGCAGGAGTTGCTACAGCCCAGG - Intergenic
988256209 5:28823212-28823234 AGCTGGAGTGGCTGACATGCAGG - Intergenic
988916474 5:35899282-35899304 GGTTTGAGTTGCTGAACTCCTGG - Intergenic
989492791 5:42077161-42077183 GGCTGGAATGGCTGAAGCCCTGG - Intergenic
992405006 5:76448499-76448521 ATCTGGAGTAGCTGAAGATCTGG + Intronic
993958245 5:94263815-94263837 AGGTGGAGATGCTGCAGGCCTGG - Intronic
995623388 5:114052536-114052558 AGCAGGAGTTGCTGCAAACCTGG + Intergenic
997273717 5:132564783-132564805 AGCTGGAGTGGCTGAAACACAGG - Intronic
997531986 5:134587088-134587110 AGCAGGAGGTGCTGGAGTGCAGG - Intergenic
997863619 5:137442139-137442161 AGCTGGACTAGCTGAGGTCTTGG - Intronic
998860541 5:146439348-146439370 ATATGGACTTGCTGAAGACCAGG - Intergenic
998876797 5:146608364-146608386 ACCTGGAGATGATGAAGCCCAGG - Intronic
999316619 5:150588372-150588394 GGCTGGGGTTGCAGAAGTCCAGG - Intergenic
999341668 5:150778699-150778721 AGCTGGAGTTGCCGGGGCCCCGG + Exonic
1000039232 5:157472786-157472808 AGCTGGCGCAGCTGATGTCCAGG - Exonic
1000515436 5:162232694-162232716 AGCTGGAGCTGCTGAGATGCAGG - Intergenic
1001378937 5:171289641-171289663 AGGTGGAGTTGCTTGAGACCAGG + Intronic
1001944452 5:175767084-175767106 AGCTGGAGTGGCTGAGATGCAGG + Intergenic
1001994226 5:176142683-176142705 AGCTGGAGTGGCCAAAGTGCAGG - Intergenic
1003478064 6:6503331-6503353 AGCTGGACTTGCTGAGCTCAGGG - Intergenic
1005400149 6:25423632-25423654 AGCGGGAGTTACTGAAGAACAGG + Intronic
1005479393 6:26241122-26241144 AGATGGAGTTGCTCTTGTCCAGG + Intergenic
1005655289 6:27929261-27929283 AGCTGGAGTGGCTGGTGTACAGG + Intergenic
1005800495 6:29417477-29417499 CGCTGGAGTAGCAGATGTCCAGG - Intronic
1006131965 6:31874991-31875013 AGCTGAAGATGTTGAAGTACAGG + Exonic
1006416986 6:33910556-33910578 AGCTGGAGATCCTGGAATCCAGG + Intergenic
1007454973 6:41969974-41969996 AGCTGGAACTGCTTAAGCCCAGG + Intronic
1007589534 6:43013126-43013148 AGATGTAGTTGCTGACATCCAGG - Exonic
1008153822 6:47989536-47989558 AGCTGGAGTGGCTGAGATGCAGG - Intronic
1008337512 6:50324830-50324852 AGCTGGAGTGGCTGGAATGCAGG + Intergenic
1008572777 6:52830973-52830995 AGCTGAAATTGCAGAAGCCCAGG + Intergenic
1009637288 6:66281942-66281964 ACCTGTAGTTGCTGAGGTCCAGG + Intergenic
1009904797 6:69857593-69857615 AACTGGAGTTGCTATAGCCCTGG - Intergenic
1010872249 6:81058108-81058130 AGGTGGAGTGCCTGAAGTCAAGG - Intergenic
1011134401 6:84084803-84084825 AGCTGGAGTCCCAGAAGACCAGG + Intronic
1012363876 6:98416222-98416244 TGCTGGAGTTGCTGAACTGCTGG - Intergenic
1012893100 6:104919422-104919444 AGGTGGAATTGCTTAAGCCCAGG + Intergenic
1015355678 6:132274888-132274910 AACTGAAGTTCCTCAAGTCCTGG + Intergenic
1015754674 6:136595521-136595543 AGCAGGAGTTGCTGATGGACTGG + Intronic
1018407672 6:163505004-163505026 AGCTGGAGCTGCTGGAATGCCGG - Intronic
1018461582 6:164004239-164004261 AGCTGGAGTTTATGGAGTCAGGG + Intergenic
1018575788 6:165258895-165258917 AGCTGGAGTGGCTGAGATGCAGG + Intergenic
1018634932 6:165852743-165852765 AGCTGCAGCTGCTGACTTCCTGG + Intronic
1018651062 6:165991537-165991559 TGCAGGAGTTCCTGGAGTCCAGG + Intergenic
1018721552 6:166576972-166576994 AGCTGGAGTGGCTGAGATGCAGG - Intronic
1018916185 6:168134003-168134025 AGCTGGAGTCCCTGAAGGCATGG + Intergenic
1021275021 7:18639859-18639881 GGCTGAAGGTTCTGAAGTCCAGG + Intronic
1023690270 7:42779181-42779203 AGCTGGAGTGGCTGAAATATAGG - Intergenic
1024523796 7:50330853-50330875 AAATGGAGTTGCTGAAATGCAGG + Intronic
1029282116 7:99442233-99442255 AGCTGGGGCTGGTGAATTCCTGG + Intronic
1029338995 7:99927850-99927872 AGCATGAGTTGCTGCAGTTCTGG + Intronic
1033234796 7:139629766-139629788 ACCTGGAGCGGCTTAAGTCCTGG + Intronic
1034543842 7:151777021-151777043 AGCTGGAGCTCCTGCAGTACAGG + Intronic
1034908630 7:154973359-154973381 AGCTGGCCTTCCTCAAGTCCTGG - Intronic
1035041363 7:155930295-155930317 AGCTGAAGTTTCTGAGGACCAGG + Intergenic
1035680789 8:1486236-1486258 GGCTTGACTTGCTCAAGTCCAGG - Intergenic
1038497561 8:28014655-28014677 TGCTGGAGATGCTGAAGCCATGG + Intergenic
1039830651 8:41211233-41211255 ATCTGGGGTTGCTGAGGGCCTGG - Intergenic
1041632102 8:60099757-60099779 AGCTGGAGCAGCTGAGGTGCAGG + Intergenic
1041672328 8:60504239-60504261 AGCTGGACCTGGTGAGGTCCTGG + Intergenic
1042578020 8:70242994-70243016 AGGTGCAGGTGTTGAAGTCCAGG - Intronic
1042681659 8:71392338-71392360 CGCTGTAGCTGCAGAAGTCCAGG - Intergenic
1044877192 8:96681335-96681357 GGCTGGAGCTGCTGAAATGCAGG - Intronic
1045137046 8:99232793-99232815 TGCTGAAGCTGCAGAAGTCCTGG + Intronic
1045994985 8:108352103-108352125 CTCTGGACTTGCTGAGGTCCTGG + Intronic
1048031767 8:130639820-130639842 AGCTGGAGTTGATGCTCTCCAGG - Intergenic
1048536878 8:135304740-135304762 AGCTGGAGTGGCTGGTCTCCAGG - Intergenic
1049400890 8:142426733-142426755 GGCTGGTGTGGCTGAAGCCCAGG + Intergenic
1051536113 9:18160122-18160144 AGCTGGTGTTTCTGTATTCCCGG + Intergenic
1052032684 9:23646128-23646150 ATCAGGTGCTGCTGAAGTCCTGG + Intergenic
1053143889 9:35699044-35699066 AGCTAGAGCAGCTGAAGCCCCGG - Exonic
1053169000 9:35865053-35865075 ACCTGGAGTCTCTGAAGCCCAGG - Intergenic
1054803369 9:69375130-69375152 AGCTGAAGTTTCTGAAGAGCTGG + Intronic
1057325736 9:94061717-94061739 AGCTGGAGCTGCTGGGGTGCAGG + Intronic
1057720657 9:97529210-97529232 AGCCTGAGGTGCAGAAGTCCAGG + Intronic
1057721400 9:97534910-97534932 AGCTGGAGTGACAGAATTCCAGG + Intronic
1058056605 9:100455144-100455166 AGCTGGAGAGGCAGAAGTCAGGG - Intronic
1058755505 9:108079430-108079452 AGCTGGTGTTGCTGGAATCTGGG + Intergenic
1059879034 9:118669047-118669069 AGCTAAAGTTGCTGAGGTTCTGG + Intergenic
1061083807 9:128387579-128387601 ACCTGGCACTGCTGAAGTCCTGG - Intronic
1062258859 9:135647432-135647454 AGTCCGATTTGCTGAAGTCCAGG + Intergenic
1185723760 X:2402906-2402928 AGATGGAGTCTCTGTAGTCCAGG + Intronic
1187096344 X:16152417-16152439 CGCAGGAGTTGGTGAAGGCCAGG - Exonic
1187356094 X:18573408-18573430 AGCTGCAGCTGCTGAAGCACAGG - Intronic
1187551991 X:20315395-20315417 ATCTGAAGTAGCTGAAGTCAGGG + Intergenic
1190108072 X:47573187-47573209 AGGTGGAGTGGGTGGAGTCCTGG + Intronic
1191832405 X:65429723-65429745 GGCTAGAGTGGCTGAAGCCCTGG + Intronic
1192330165 X:70168941-70168963 AGCTGGGTTTGCTGGATTCCCGG + Intergenic
1193264552 X:79453151-79453173 AGCAGGAGTGACTGAAGTTCTGG + Intergenic
1193295562 X:79828057-79828079 AGAATGATTTGCTGAAGTCCAGG - Intergenic
1194038880 X:88915335-88915357 AGCTGGAGTGGCTGGAATACAGG + Intergenic
1194145336 X:90254997-90255019 AGTTGGAGATGCTGAAATGCAGG + Intergenic
1194397207 X:93401418-93401440 AGCTAGAGTAGCTGAAATACAGG - Intergenic
1195370378 X:104166905-104166927 AGCCGAAGTCGCTGATGTCCAGG - Exonic
1195409653 X:104555952-104555974 AGTTGAAGATGCTGAATTCCTGG + Intergenic
1195671116 X:107470917-107470939 ACCCAGGGTTGCTGAAGTCCTGG + Intergenic
1196759621 X:119189818-119189840 AGCTGCTGTTGCTGCAGGCCTGG + Intergenic
1198311952 X:135433114-135433136 AGCTGGAGATGCAGGAGCCCGGG + Intergenic
1198872791 X:141193757-141193779 AGCTGGAATTGCTGGAGCACAGG - Intergenic
1199370465 X:147042194-147042216 AGCTGGAGTGGCTGAGATGCAGG - Intergenic
1199848523 X:151708784-151708806 AGATGGACTTGCTGAACTCCAGG - Intergenic
1200491098 Y:3824295-3824317 AGTTGGAGATGCTGAAATGCAGG + Intergenic
1200566771 Y:4778506-4778528 AGCTGGAGTATCTAAACTCCTGG - Intergenic
1200700933 Y:6401943-6401965 AGCTGCCTTTGCTGGAGTCCAGG + Intergenic
1201033179 Y:9762755-9762777 AGCTGCCTTTGCTGGAGTCCAGG - Intergenic
1201256688 Y:12114394-12114416 TGCTGCAGTTGATGAAGGCCTGG - Intergenic
1202175741 Y:22097400-22097422 AGCTGCCTTTGCTGGAGTCCAGG + Intergenic
1202215620 Y:22488983-22489005 AGCTGCCTTTGCTGGAGTCCAGG - Intergenic