ID: 1182744928

View in Genome Browser
Species Human (GRCh38)
Location 22:32598155-32598177
Sequence TTCGGTGCCCACAGTGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182744928_1182744933 14 Left 1182744928 22:32598155-32598177 CCTCTTACACTGTGGGCACCGAA 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1182744933 22:32598192-32598214 CCCTCTTGATGTCTCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182744928 Original CRISPR TTCGGTGCCCACAGTGTAAG AGG (reversed) Intronic
906320125 1:44810488-44810510 CCCTGTGCCCACAGTGTAATGGG - Intronic
914741769 1:150471685-150471707 TTTGGTGCCTTCAGCGTAAGAGG + Exonic
915790894 1:158669821-158669843 TTCAGTGACCACTGAGTAAGTGG + Intronic
921116828 1:212099677-212099699 TTGAGTGCCCAAAGTGTGAGAGG - Intronic
921380148 1:214516300-214516322 TTCAGTGCCAACAATGCAAGAGG + Intronic
1062954283 10:1529948-1529970 ATGGGTGCCCACAGTGGCAGGGG - Intronic
1064977324 10:21131838-21131860 TTGGGTGCCCAAAGTGAAATTGG + Intronic
1065181210 10:23128240-23128262 TGTGGTGCACACAGTGGAAGTGG - Intergenic
1074872981 10:117591916-117591938 TTCCCTGCTCACAGTGGAAGTGG + Intergenic
1077828102 11:5832054-5832076 TTGAGTGCCCAAAGTGTGAGGGG - Intronic
1083922723 11:65789218-65789240 TCCAGTGGCCACAGTGGAAGTGG + Intronic
1087744173 11:101924386-101924408 CTCTGTGACCACAATGTAAGTGG - Intronic
1089608226 11:119654388-119654410 GGCTGTGCCCACTGTGTAAGAGG + Intronic
1089873209 11:121695241-121695263 TTGGATGCCCACAGGGCAAGAGG - Intergenic
1090270443 11:125382063-125382085 TTCTGTGTACACAGTGTGAGTGG - Intronic
1091851826 12:3705754-3705776 TGCGGACCCCACAGTTTAAGGGG - Intronic
1095225684 12:39674561-39674583 TTCAGTTCCCAAAGTGTGAGGGG + Intronic
1098482608 12:70983400-70983422 TTCCCTGCCCACAGTATAACTGG - Intergenic
1101368242 12:104098360-104098382 TCCAGTGGCCACAGTGAAAGCGG + Exonic
1105845966 13:24294107-24294129 TCCGGTGCCTACAGTTTTAGCGG + Intronic
1107169738 13:37326639-37326661 TTTAGTGCCCACTGTGTAACCGG - Intergenic
1107702128 13:43058936-43058958 TTAAGTGCCCAAAGTGTGAGAGG - Intronic
1117271197 14:54145825-54145847 GTAAGTGCCCACAGTGTGAGGGG + Intergenic
1128752661 15:70160324-70160346 TTAAGTGCCCCCAGGGTAAGGGG + Intergenic
1128774630 15:70310302-70310324 GTTGGTGCCCACACAGTAAGAGG + Intergenic
1131231483 15:90663039-90663061 TGAGATGCTCACAGTGTAAGAGG + Intergenic
1132027776 15:98417606-98417628 TTCGGTGTCCACAGTTTGTGGGG - Intergenic
1133982904 16:10646864-10646886 TTCTGTGCCCAGAATGTGAGTGG + Intronic
1138582208 16:57949027-57949049 TTTGGTGCCCACTGTGTACCAGG + Intronic
1142899602 17:3003961-3003983 GTCTGTGCCGACCGTGTAAGTGG - Intronic
1143311834 17:5998401-5998423 TTCCGTGTCCAAAGTGGAAGTGG + Intronic
1147923373 17:43932373-43932395 TTGGGTGCCCCCAGTGTGGGTGG - Intergenic
1148125636 17:45235205-45235227 TCAGGGGCCCACAGTCTAAGTGG + Intronic
1150737550 17:67753296-67753318 GTCGGTGGCCACAGTGGAAATGG - Intergenic
1159084213 18:63769958-63769980 CTTGGTGCACACAGTGTGAGTGG + Intronic
1159511872 18:69404848-69404870 TGGAGTGCCCACAGTTTAAGAGG + Intronic
1159886703 18:73914494-73914516 TTCAGTGCCCCCAGTGTGCGGGG + Intergenic
1165068426 19:33241785-33241807 TTGGGGGCCCACAGTGCAAGAGG + Intergenic
929589709 2:43136917-43136939 TCTGGTGCCCAGAGTGTATGTGG - Intergenic
932383891 2:71312886-71312908 TTCAGTGCCCACATTATAAAAGG + Intronic
1169931485 20:10837724-10837746 CACGATGCCCACAGTGCAAGGGG + Intergenic
1172326651 20:34040951-34040973 TTTGGTGCCCTGAGTGTAATAGG + Intronic
1172501264 20:35429401-35429423 TTCAGTGACCACAGTGAGAGGGG - Intergenic
1176664811 21:9675819-9675841 TTCAGTGCCTACAGTGTTTGGGG - Intergenic
1181959187 22:26610705-26610727 TTGGGTGCCCACAAGGTAACAGG + Intronic
1182744928 22:32598155-32598177 TTCGGTGCCCACAGTGTAAGAGG - Intronic
958542087 3:95491028-95491050 TTTGGTTCCCACAGTCAAAGTGG - Intergenic
967102411 3:186226616-186226638 TTGGGTTACCACAGAGTAAGAGG - Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
976097901 4:81528447-81528469 TTCTGAGCCTACAGTGGAAGGGG + Intronic
985410282 4:189676460-189676482 TTCAGTGCCTACAGTGTTTGGGG - Intergenic
986669773 5:10132550-10132572 CTAGATGCCCACAGTCTAAGGGG + Intergenic
995031272 5:107484271-107484293 GTAGGTGCCCACAGTGAGAGAGG + Intronic
1000979659 5:167803142-167803164 TTTGGTGTTCACTGTGTAAGAGG - Intronic
1001462849 5:171933560-171933582 TGGGATGCCCACATTGTAAGAGG + Intronic
1006451576 6:34108706-34108728 TTCAGTGCCCACAGTGTGCCAGG + Intronic
1007074025 6:39055523-39055545 TTCGGTGACCTCACTGGAAGTGG + Intronic
1008930209 6:56931534-56931556 TTCCAGGCCAACAGTGTAAGCGG - Intronic
1009644244 6:66377444-66377466 TTAAGTGCCCAAAGTGTGAGAGG + Intergenic
1022957081 7:35390865-35390887 TTCAGTCCCCACAGCGCAAGAGG - Intergenic
1029987169 7:104932798-104932820 TGTGGTGCCAACAGTGTAATTGG - Intergenic
1037413863 8:18627183-18627205 CTCGGTTCCAACAGTGGAAGAGG + Intronic
1054810164 9:69428192-69428214 GTTGGTGCCCACAGGGTGAGGGG + Exonic
1059093355 9:111385720-111385742 TTCGGTGCCCAGTGTGTATGTGG - Intronic
1062620934 9:137422321-137422343 TTCTGGGCCCACAGTTTAAAAGG - Intronic
1203661287 Un_KI270753v1:45928-45950 TTCAGTGCCTACAGTGTTTGGGG + Intergenic
1203672476 Un_KI270755v1:29020-29042 TTCAGTGCCTACAGTGTTTGGGG + Intergenic
1190291088 X:48992761-48992783 TTCTGAGCCCAGATTGTAAGTGG - Intronic
1192501934 X:71660273-71660295 TTTTCTGCCCACAGAGTAAGAGG + Intergenic
1192509087 X:71711631-71711653 TTTTCTGCCCACAGAGTAAGAGG + Intergenic
1192517610 X:71769922-71769944 TTTTCTGCCCACAGAGTAAGAGG - Intergenic
1196224045 X:113144545-113144567 TTAGGAGGCCACAGTCTAAGTGG - Intergenic
1199989272 X:152976127-152976149 TGTGGAGCTCACAGTGTAAGAGG + Intergenic