ID: 1182744946

View in Genome Browser
Species Human (GRCh38)
Location 22:32598296-32598318
Sequence ACCCCCACACTGGCCTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182744944_1182744946 -9 Left 1182744944 22:32598282-32598304 CCTCATCTCATTTTACCCCCACA No data
Right 1182744946 22:32598296-32598318 ACCCCCACACTGGCCTTAGAAGG No data
1182744943_1182744946 -8 Left 1182744943 22:32598281-32598303 CCCTCATCTCATTTTACCCCCAC No data
Right 1182744946 22:32598296-32598318 ACCCCCACACTGGCCTTAGAAGG No data
1182744939_1182744946 22 Left 1182744939 22:32598251-32598273 CCGCCTGTGCATCACAAAGCCAT No data
Right 1182744946 22:32598296-32598318 ACCCCCACACTGGCCTTAGAAGG No data
1182744940_1182744946 19 Left 1182744940 22:32598254-32598276 CCTGTGCATCACAAAGCCATTCT No data
Right 1182744946 22:32598296-32598318 ACCCCCACACTGGCCTTAGAAGG No data
1182744942_1182744946 3 Left 1182744942 22:32598270-32598292 CCATTCTGTGGCCCTCATCTCAT No data
Right 1182744946 22:32598296-32598318 ACCCCCACACTGGCCTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182744946 Original CRISPR ACCCCCACACTGGCCTTAGA AGG Intronic