ID: 1182747723

View in Genome Browser
Species Human (GRCh38)
Location 22:32618354-32618376
Sequence GTTTCCAAGCTGAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182747716_1182747723 10 Left 1182747716 22:32618321-32618343 CCTCCCAGCACGAGAGCTTCCAA 0: 1
1: 0
2: 1
3: 11
4: 90
Right 1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 202
1182747715_1182747723 29 Left 1182747715 22:32618302-32618324 CCTTAGGAAAAAGCAATTTCCTC 0: 1
1: 1
2: 1
3: 24
4: 309
Right 1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 202
1182747717_1182747723 7 Left 1182747717 22:32618324-32618346 CCCAGCACGAGAGCTTCCAAAAA 0: 1
1: 0
2: 2
3: 11
4: 143
Right 1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 202
1182747714_1182747723 30 Left 1182747714 22:32618301-32618323 CCCTTAGGAAAAAGCAATTTCCT 0: 1
1: 1
2: 5
3: 30
4: 336
Right 1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 202
1182747718_1182747723 6 Left 1182747718 22:32618325-32618347 CCAGCACGAGAGCTTCCAAAAAG 0: 1
1: 0
2: 4
3: 11
4: 88
Right 1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 202
1182747721_1182747723 -9 Left 1182747721 22:32618340-32618362 CCAAAAAGGCAGTGGTTTCCAAG 0: 1
1: 0
2: 0
3: 28
4: 276
Right 1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182747723 Original CRISPR GTTTCCAAGCTGAAAGTGGA TGG Intronic
903999481 1:27330832-27330854 GGTTCCAAGGTTTAAGTGGAAGG + Intronic
906233590 1:44187985-44188007 GTTTCCAAGGAGGAAGTTGAGGG + Intergenic
909201719 1:72697797-72697819 GTATGAAATCTGAAAGTGGAAGG + Intergenic
909248430 1:73321010-73321032 ATTTCCAATCTAAAAGTGGAAGG + Intergenic
909506917 1:76402414-76402436 GATTCCACACTGAAAGTGGAAGG - Intronic
910721142 1:90287412-90287434 TCTTCCAGGCTGAAAGTGGAAGG - Intergenic
911222777 1:95266960-95266982 TTTTTCAAGCAGGAAGTGGATGG - Intergenic
913142394 1:115954487-115954509 GTTACTTAGCTGAAGGTGGAGGG - Intergenic
913444645 1:118937792-118937814 GTTTCCTATCTGATAGTGGTAGG + Intronic
915836757 1:159183002-159183024 TTTTCCAGGCTGAATGAGGAGGG - Intronic
916255340 1:162781517-162781539 GTTTTCAAACACAAAGTGGATGG + Exonic
917312047 1:173688895-173688917 GTTTCCGAGGTAAAAGGGGAAGG - Intergenic
921585749 1:216944339-216944361 GTTTCCAGCGTTAAAGTGGAAGG - Intronic
923587935 1:235291853-235291875 ATTTACAAGCTGAAAGTAAAGGG + Intronic
923696374 1:236256114-236256136 TTTTCCAAGGAGAGAGTGGATGG - Intronic
1063672142 10:8107659-8107681 GTGTCCAAGCTGAAAGAGCCTGG - Intergenic
1064145589 10:12823870-12823892 GTTGCCAAGCAGAATGTGGCAGG + Intronic
1065941388 10:30567511-30567533 GTTTCCCAGGTTAAAGTGCAGGG + Intergenic
1065998507 10:31082692-31082714 GTTTACAAAATCAAAGTGGAAGG + Intergenic
1067157321 10:43792972-43792994 GTTTCCAGGCTGGACGTGGTGGG + Intergenic
1067337180 10:45375000-45375022 TTTCCCCAGCTGAAAATGGAGGG + Intronic
1067479264 10:46584697-46584719 GTATGCAAGCAGAAACTGGATGG - Intronic
1067544905 10:47185467-47185489 GTTACCAAGCTGAAGGTGAGCGG - Intergenic
1067615475 10:47757104-47757126 GTATGCAAGCAGAAACTGGATGG + Intergenic
1067919527 10:50439332-50439354 CTTTCCAAGCAGAAACTGGTAGG + Intronic
1068624966 10:59233878-59233900 GCTTCCAAAATGAAAGAGGAGGG + Intronic
1076602014 10:131663403-131663425 GTCTCCAAGGAGACAGTGGAGGG - Intergenic
1076834201 10:133012893-133012915 GTTTCCAAGCTGAAAACGCGAGG + Intergenic
1077350758 11:2092150-2092172 GTTTCCAATCTGTTAGTGCAAGG - Intergenic
1078372802 11:10764399-10764421 GTTTCCAAGTCTAAAATGGAGGG - Exonic
1079633769 11:22710777-22710799 GTTTCCAAGATGGAAGTGTCAGG + Intronic
1079668704 11:23138826-23138848 GTTTTCAAGCTGAGAGTGACAGG - Intergenic
1081808421 11:45902291-45902313 GTCACCAAGCTGAGAGTGGCAGG + Intronic
1082552186 11:54413192-54413214 GTTTGAAAGCTGAACTTGGAAGG - Intergenic
1082553763 11:54534232-54534254 GTTTGAAAGCTGAACTTGGAAGG - Intergenic
1085290957 11:75399199-75399221 GTGTCCACCCTGAAAGTGTAGGG + Intergenic
1086596381 11:88576526-88576548 GTGTGCAAGCTGAAAATGAAGGG - Intronic
1088399444 11:109407231-109407253 GTGTCCCATCTGAAAGTGGCAGG - Intergenic
1090511216 11:127377148-127377170 GTGTCCCAGCTGAATATGGAAGG - Intergenic
1091386808 12:101164-101186 GCTTGCAGGCTGAGAGTGGATGG - Intronic
1092118676 12:6028054-6028076 TTGTACAAGCTGAAAATGGATGG + Intronic
1092833737 12:12468803-12468825 GTTTCCCTGGTCAAAGTGGAAGG + Exonic
1094187126 12:27656688-27656710 GTTTGCAAGATGAAAGGAGAAGG + Exonic
1094751687 12:33416878-33416900 GGATCTAACCTGAAAGTGGAGGG + Intronic
1095055655 12:37594756-37594778 AGTTCCAAACTGAAAGTGGCTGG - Intergenic
1095289449 12:40460996-40461018 GTCTCCAAGCTGGAAGAGGCAGG + Intronic
1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG + Intronic
1098634896 12:72770611-72770633 GTTTCCAAGCAAAATGTTGAAGG - Intergenic
1102234891 12:111288156-111288178 GTTTACTAGCTGAAAGGGGTAGG + Intronic
1104736834 12:131140157-131140179 GTGTCCAGGTGGAAAGTGGAGGG + Exonic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1106966774 13:35080502-35080524 AAGTCCAAGCTGAAATTGGAGGG + Intronic
1109909729 13:68893434-68893456 GTTTCCAGGGTAAAAGGGGAAGG - Intergenic
1110917233 13:81036661-81036683 TTTCCATAGCTGAAAGTGGAGGG - Intergenic
1112492813 13:99882755-99882777 GTTTCCAAACTGAAAATTGGAGG - Intronic
1113626178 13:111848892-111848914 ATTATCAAGCTGGAAGTGGAAGG + Intergenic
1114145755 14:19975763-19975785 GTTTGCAAGCAGAAAGTACATGG - Exonic
1114959739 14:27870883-27870905 ATTTCCAAGCACAAAGTGAAAGG + Intergenic
1115152139 14:30297843-30297865 ATTCCCTAGCTGAAAGTGGGTGG - Intergenic
1116606242 14:46999688-46999710 GTTTCCAAGCTGTCAGACGAGGG - Intronic
1117301599 14:54434958-54434980 GTTTCCCAGATAAATGTGGATGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1125582138 15:40793670-40793692 CTTTCCAAGCTTACAGTGTAAGG + Intronic
1125586730 15:40825920-40825942 TTTTGCAAGATGAAAGTGGAGGG - Intronic
1125967896 15:43888843-43888865 GTGACCAAGCTGAAATTTGAAGG - Exonic
1126423564 15:48501379-48501401 ACTTCACAGCTGAAAGTGGAAGG - Intronic
1126662874 15:51049339-51049361 GTTTCAAAGCTGAAAAGGGTGGG + Intergenic
1127067419 15:55255243-55255265 GCTTCCAGGGTGAGAGTGGAAGG - Intronic
1127191750 15:56538501-56538523 GTTTCCAGGGTGAAGGGGGAGGG - Intergenic
1128218667 15:65952357-65952379 GATGCCAACCTGCAAGTGGATGG + Intronic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1134021817 16:10926283-10926305 ATTTACAAGCTGAACCTGGATGG - Exonic
1135077630 16:19407731-19407753 GTTTCCACACAGAAAGAGGAGGG + Intergenic
1141776568 16:86127125-86127147 GTTCCCAAGCTGGAAGAGCAGGG + Intergenic
1141839545 16:86566005-86566027 GTTTCGAAGCTGAAGTTGGTAGG + Intergenic
1142369835 16:89672781-89672803 GTTTCCGAGCTGAAACTCCAGGG - Intergenic
1143570505 17:7755082-7755104 GTTTTACAGCTGGAAGTGGATGG + Intronic
1150443782 17:65212744-65212766 GTTTCCACTCTGAAAGTGCATGG + Intronic
1150617920 17:66786255-66786277 GTTACCAGGCTGAGAGAGGAAGG - Intronic
1151334928 17:73434182-73434204 GTTTACAAGCCAAAAGTGAAAGG + Intronic
1153461222 18:5335475-5335497 GTTCCCATGTTGAAAGTTGAAGG - Intergenic
1153974295 18:10253835-10253857 GTTTCCCAGTGGAAAGTGGGTGG - Intergenic
1154026196 18:10709506-10709528 ATTTCCAGGCTGAACGTGGTAGG + Intronic
1154064100 18:11090504-11090526 ATTTCCAACCTGAAAGGGTAGGG + Intronic
1154341581 18:13506977-13506999 TTTTACAAGTTGAAAGTGTATGG + Intronic
1154462885 18:14613382-14613404 GTTTGCAAGCAGAAAGTACATGG - Intergenic
1155039706 18:22054727-22054749 GTTTGCAAGCAGAATTTGGAGGG - Intergenic
1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG + Intergenic
1156628345 18:38937349-38937371 GTTTCCAGGCTGAGACTGGGAGG - Intergenic
1156676426 18:39531913-39531935 GTTTCCATGCAGAGAATGGACGG + Intergenic
1156842092 18:41620891-41620913 GAATTCAAGCAGAAAGTGGATGG + Intergenic
1156881641 18:42087353-42087375 GTTTGCAAGGTGCATGTGGAAGG + Exonic
1158228287 18:55223849-55223871 GTTACCAAGATGAAACTGTATGG - Intronic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1159204828 18:65236070-65236092 TTTTCCTATTTGAAAGTGGAAGG + Intergenic
1159532961 18:69678436-69678458 GTCTCCAAGAAGAAACTGGAGGG - Intronic
1160536871 18:79599179-79599201 ATTTCTAAGGTCAAAGTGGAAGG + Intergenic
1162268273 19:9594062-9594084 GTTTCCAGGGTAAAAGGGGAAGG - Intergenic
1163508302 19:17720810-17720832 GTCTCCAAGCTGTGAGTGAAGGG + Intronic
1163988376 19:20973798-20973820 GTTTAAAAACTGAAAGTGAAAGG - Intergenic
1166643950 19:44517286-44517308 AATTCCAAGGTGAAAGTGAATGG - Intronic
925528322 2:4829930-4829952 GTTTGGAAGCTGGAAGTCGAGGG - Intergenic
928370445 2:30736558-30736580 CTTACCCAGCTGAAAGTGAATGG - Exonic
930136689 2:47909107-47909129 GTTTCCACCCTGAGAGGGGATGG + Intergenic
931878284 2:66538796-66538818 GTTTCAAAGCTGACAATTGAAGG + Intronic
932001184 2:67886593-67886615 GCTTCCAAGCTGACAGGGCAGGG + Intergenic
935541981 2:104359175-104359197 GTTTCCAAGGTGAGAAAGGAAGG + Intergenic
935958311 2:108400129-108400151 GTGCCCAAGCTGGAAGGGGAGGG - Intergenic
937566212 2:123292396-123292418 GTTTCCAACCTGAAACCAGATGG + Intergenic
937825056 2:126359821-126359843 GTTTCCACACTGAAAATGGCAGG - Intergenic
938587143 2:132702242-132702264 CTTTCCAAAGTGACAGTGGACGG - Intronic
938831044 2:135050573-135050595 ATATCCAAGCTGAAACTTGAAGG + Intergenic
940100866 2:150036812-150036834 CTATCCAAGGTGAAAGTGAAAGG + Intergenic
941638579 2:167962565-167962587 GTTTTCAAGCTGTAATGGGAAGG + Intronic
943926602 2:193791534-193791556 GTTTCCCAGCTGGTAGAGGAAGG + Intergenic
945558715 2:211311467-211311489 GTTGCCAAGCTTAAACTGAATGG - Intergenic
1169526841 20:6437663-6437685 TTTATAAAGCTGAAAGTGGATGG + Intergenic
1170252101 20:14295178-14295200 GTTTCCAAGCTGAATTTAAATGG - Intronic
1170561063 20:17558936-17558958 TTTTCCATGCTGGAAGTGGAAGG - Intronic
1171426947 20:25054940-25054962 GTTGTAAAGGTGAAAGTGGAAGG - Intronic
1175003037 20:55650755-55650777 GTATTGAAACTGAAAGTGGAGGG - Intergenic
1175337353 20:58205251-58205273 GTGGCCAAGCTGAAAGTCGAGGG - Intergenic
1175767226 20:61599884-61599906 TTTTCCAAGCTGTGAGTGCACGG - Intronic
1176383164 21:6123843-6123865 GTTTCAAATCTTAAAGAGGAGGG + Intergenic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1178669285 21:34576681-34576703 GTTTCAAAGTTTAAACTGGATGG + Intronic
1179740303 21:43414396-43414418 GTTTCAAATCTTAAAGAGGAGGG - Intergenic
1180709725 22:17831612-17831634 GTTTAGAAACTGGAAGTGGAAGG - Intronic
1181158244 22:20939083-20939105 GTGTCCAAGTTGAGACTGGAGGG - Intronic
1182573189 22:31254422-31254444 ATTTCCAAACTGAAAATGGTAGG - Intronic
1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG + Intronic
1183583487 22:38739056-38739078 GTCTCCTCGCTGAAGGTGGACGG + Intronic
1185071292 22:48658188-48658210 GTTTCGGAGGTGGAAGTGGACGG - Intronic
950279534 3:11694734-11694756 GTTTGCAAGATGAAAGTGGAGGG + Intronic
950568176 3:13783793-13783815 GTTTGGAAGGTGAAAGAGGAAGG + Intergenic
952581459 3:34838255-34838277 ATTTCCAAGCAAAGAGTGGAAGG - Intergenic
954596392 3:51829322-51829344 TTTTCCAGGCTCAAAGTTGATGG - Exonic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
954929181 3:54265912-54265934 GTTTCCTAGTTCAAAGAGGAAGG + Intronic
955682554 3:61517651-61517673 GTTTCCAAGGTCCAAGTGGATGG + Intergenic
955774611 3:62420156-62420178 GTTTCCAAGCAGATAGTGAAAGG + Intronic
962979425 3:140474308-140474330 GTACCCAAGCTGGAAGGGGAGGG - Intronic
963124677 3:141804173-141804195 GTGTGCAAGCTGAAGGTGCAAGG - Intronic
963637483 3:147816953-147816975 GTTTTCCAGCTGAAAGTCTAAGG - Intergenic
964345350 3:155749520-155749542 GTTCCCAAGATGAAAGGGGCTGG + Intergenic
964500820 3:157346451-157346473 GTTTCTAAGTTGAAATTAGATGG + Intronic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965314351 3:167172752-167172774 GTTTGCAAGTTGGAAGAGGAGGG + Intergenic
966181254 3:177190622-177190644 GTTTCTTAGATGAAAATGGATGG - Intronic
967265402 3:187687003-187687025 GTTTCCAAGCTGGGAGCGGCAGG + Intergenic
970291153 4:14573704-14573726 GTTTCCAGGCTCAAGGTGAAAGG - Intergenic
970377063 4:15469507-15469529 GTTTTCCAGTTAAAAGTGGAAGG - Intergenic
973969304 4:56195236-56195258 GTTTCCAGGCTTAGAGGGGAGGG + Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978563697 4:110060048-110060070 GTTCCCAAGCTGAAACTCAAAGG - Intronic
978983038 4:114974689-114974711 GGTGCCAAACTGAAAGAGGAAGG - Intronic
980699951 4:136412524-136412546 TTTAAGAAGCTGAAAGTGGAAGG + Intergenic
984638838 4:182142601-182142623 GCTCTGAAGCTGAAAGTGGAGGG + Intergenic
985019899 4:185676875-185676897 GTTTCCAAGCAGGAAGGGAAAGG - Intronic
985696301 5:1342624-1342646 GTCACCAGGCTGAAAGTGTAGGG + Intronic
986753083 5:10807873-10807895 GTTTCTAAGCTGAAAATAGCAGG + Intergenic
986833088 5:11603844-11603866 GTTTCCAAAATAAAACTGGATGG - Intronic
989417331 5:41195077-41195099 GTTTGTAAGCTGAGACTGGATGG + Intronic
990339085 5:54804759-54804781 TTTTCAAAGCTGATAGGGGAAGG - Intergenic
993132749 5:83919988-83920010 GGTGCCAAGCTGAAAAGGGATGG + Intergenic
994044986 5:95297384-95297406 GATCCCAACCTGAAACTGGAGGG - Intergenic
995456975 5:112362210-112362232 GTTGCCAGGCTTAAGGTGGAAGG - Intronic
995524707 5:113041214-113041236 GCCTCCAAGCTGATGGTGGATGG - Intronic
1000657275 5:163894980-163895002 GTTTCTGAGCTGGAAGTAGAGGG + Intergenic
1003823651 6:9928090-9928112 AGTTCCAAGGTGAAGGTGGAAGG - Intronic
1011241301 6:85274028-85274050 GTTACTTAGCTGAGAGTGGAAGG - Intergenic
1012684423 6:102226384-102226406 GATGCCAAGCTGACAGTGGGTGG - Intergenic
1012720901 6:102743146-102743168 GTTGCAAAACTGAAGGTGGATGG + Intergenic
1012741458 6:103020813-103020835 GTTTCCATGGTGGAAGTGGTGGG + Intergenic
1015394986 6:132723199-132723221 GTTTCAAGTCTGAAAGTAGAGGG + Intronic
1017543064 6:155422842-155422864 GATTCCAGGCTGGCAGTGGACGG - Exonic
1020019091 7:4851659-4851681 GTTTCCAAGCAGAGTGTAGAAGG + Intronic
1021577276 7:22116019-22116041 GTTTCCAACCTGGAAATGGGTGG - Intergenic
1024231056 7:47363894-47363916 GGATCTAAGCTGAAAGAGGAGGG + Intronic
1027702778 7:81488479-81488501 GTGTCCCAGCTGACAGAGGAGGG + Intergenic
1031068876 7:117139961-117139983 GTTTAAAAGCTGAATGTGGCTGG - Intronic
1033425985 7:141244763-141244785 GTTTCCAGGATGAAAGAGGAAGG + Intronic
1036044095 8:5120310-5120332 AATTCCAAACAGAAAGTGGAGGG + Intergenic
1036513718 8:9423915-9423937 GTTTCCTGGCAGAATGTGGATGG + Intergenic
1038215124 8:25554940-25554962 GTTTCCAAGGACAAAGTTGATGG + Intergenic
1040072962 8:43203336-43203358 ATTTCCAAATTCAAAGTGGATGG + Intergenic
1040902950 8:52435867-52435889 GTTTTCTAGTTTAAAGTGGAAGG - Intronic
1041749518 8:61245161-61245183 ACTTCAAAGTTGAAAGTGGAAGG - Intronic
1042367205 8:67951574-67951596 CTTTCCAAGCTCAGACTGGAGGG + Intergenic
1046397313 8:113657050-113657072 GTTGCTACGCTGAAAGGGGAGGG + Intergenic
1047024909 8:120813725-120813747 TTTTCCATCCTGAGAGTGGATGG - Intergenic
1047754611 8:127908906-127908928 GGTTCAAAGCTGAAATTGGATGG - Intergenic
1048069559 8:131007303-131007325 ATTTCCAAGGTGAAAGAGGTAGG + Intronic
1050058193 9:1677760-1677782 TGGTCAAAGCTGAAAGTGGATGG - Intergenic
1052261945 9:26526926-26526948 CTTTCCAAGCTGACAAGGGAAGG + Intergenic
1052989768 9:34512358-34512380 GTCATCAAGCTGAAGGTGGAAGG + Exonic
1055033598 9:71794681-71794703 GAGTGCAAGCTGGAAGTGGATGG - Intronic
1056033065 9:82573550-82573572 GTTCCCAACCTCAAACTGGAGGG + Intergenic
1056474010 9:86935427-86935449 GTTATCAAGCTGGAATTGGATGG + Intergenic
1056478352 9:86975136-86975158 CTTTCCAAGCTAAACATGGAGGG - Intergenic
1057518107 9:95738472-95738494 ATTTCCAGGCTGAAAGGGCAGGG + Intergenic
1060303047 9:122387176-122387198 ATGTCCAAGCAGAAATTGGAAGG + Intronic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1061306618 9:129736245-129736267 CTTCCCAAGCTCAAGGTGGAGGG + Intergenic
1061998701 9:134204837-134204859 GTATTTAAGCTGAAACTGGAAGG - Intergenic
1186608779 X:11118492-11118514 CTTTCCTAGGTGGAAGTGGAAGG + Exonic
1192185430 X:68943828-68943850 GTTTCCAAGCAGAAACTTGGAGG + Intergenic
1194066892 X:89271701-89271723 GTTTCCACACTGGAAGAGGAGGG + Intergenic
1194371199 X:93074308-93074330 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1197804587 X:130386644-130386666 GTATCCAAGATGAGAGTGGCAGG - Intergenic
1198327472 X:135587558-135587580 GTTTCTTAGCTGAGAGAGGAGGG - Intergenic
1198868788 X:141154301-141154323 GTTTCCAAGCTGGAAGGAGGAGG + Intergenic
1199837717 X:151609403-151609425 TTTTCAAAGCTGGAAATGGATGG - Intronic
1199945015 X:152658360-152658382 GTGTACAAGCTGAAAATGGACGG - Intergenic
1200678998 Y:6186196-6186218 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1200721057 Y:6605860-6605882 GTTTCCACACTGGAAGAGGAGGG + Intergenic
1202594772 Y:26525864-26525886 CTTTCCAAGTTTAAAGTTGAAGG + Intergenic