ID: 1182748851

View in Genome Browser
Species Human (GRCh38)
Location 22:32626026-32626048
Sequence CAGGAAAAGCTTAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 2, 2: 3, 3: 49, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182748851 Original CRISPR CAGGAAAAGCTTAAGGAAGG AGG Intronic
900270576 1:1785216-1785238 CAGGGACAGCTTAGGGAAGCGGG + Intergenic
901050516 1:6423905-6423927 GAGGAAAAGCTGACAGAAGGTGG - Intronic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
903360903 1:22776354-22776376 CAGGAAATGAATACGGAAGGAGG - Intronic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
904043564 1:27597801-27597823 CAGGAAGAGATAAAGAAAGGGGG - Intronic
904323283 1:29710469-29710491 CAGGCAAGGCTGAAGGGAGGTGG + Intergenic
904352231 1:29916018-29916040 CAGGGAAAGCTTCAAGCAGGAGG - Intergenic
904353625 1:29924606-29924628 CAGTAAATGCTGAGGGAAGGAGG - Intergenic
905054073 1:35078043-35078065 AAGGAAAAGCTGAAGGCAAGAGG - Intronic
906185958 1:43862265-43862287 CAGGAAAAGCTTCACAGAGGAGG - Intronic
907039080 1:51241792-51241814 CAGGAAAGGCTGAAGAAGGGAGG + Intronic
907375451 1:54034442-54034464 CTGGAAAAGCTTAAGGTACTGGG - Intronic
907707416 1:56844871-56844893 TAGAAAAACCTTAAGGCAGGAGG - Intergenic
907875814 1:58486885-58486907 CAAGGAAAGCCTAAGGAAAGGGG + Intronic
909166682 1:72235079-72235101 CAGGAAAAGTTTTATAAAGGAGG + Intronic
909937745 1:81573342-81573364 AGGAAAAAGGTTAAGGAAGGGGG - Intronic
910128516 1:83873823-83873845 CAGGAAGAGGAAAAGGAAGGTGG - Intronic
910180657 1:84479207-84479229 AAGTAAAAGGTTAAGGAAGGGGG + Intergenic
912283850 1:108347211-108347233 CAGGAAAAGGGAGAGGAAGGGGG - Intergenic
912603595 1:110964485-110964507 GAGGCAAAGCTTCAGGAAAGAGG - Intergenic
912785687 1:112601603-112601625 CAGGGAAGGCTTTAGAAAGGTGG + Intronic
914974198 1:152344041-152344063 CAGAGAAATCTTAAGGAAAGAGG - Intergenic
915020428 1:152774202-152774224 GAGGAAAAGCTGAAGGGATGAGG - Intronic
915230495 1:154442285-154442307 CAGGAAAAGCTTCATGGAGGAGG + Intronic
916269231 1:162921948-162921970 CAGGAAAACCCTGAGGAAGTTGG + Intergenic
916506305 1:165430925-165430947 CAGGAAAAGCTTTGTGGAGGAGG - Intronic
918034777 1:180857568-180857590 CAGGAAAATCTTCCTGAAGGAGG - Intronic
918725531 1:187917059-187917081 AAGGAAGATCTAAAGGAAGGTGG + Intergenic
919192591 1:194242950-194242972 CAGGAGAAGCTCCCGGAAGGTGG - Intergenic
919423258 1:197398426-197398448 AAGGCAAAACTGAAGGAAGGCGG + Intronic
920582398 1:207123704-207123726 CAGTAACAGATTAAGGAATGAGG + Intronic
920587405 1:207180230-207180252 CATGACAAGTTTAGGGAAGGAGG + Intergenic
920818815 1:209361068-209361090 CAGGAAAAGTTAATGGAAGCGGG + Intergenic
921284102 1:213593585-213593607 CAGGAAGGGCTTTAGGGAGGAGG + Intergenic
921427829 1:215024620-215024642 CATGAAAAGCTTTATAAAGGAGG - Intronic
921584422 1:216930746-216930768 CAGGAAAGGCTGCAGGAAGGAGG + Intronic
921704566 1:218307480-218307502 GATGAAAAGGTTAAGGAAGCTGG + Exonic
922170891 1:223153530-223153552 CAGGAAAAGCCTCAAGCAGGAGG + Intergenic
922559802 1:226561058-226561080 CAGGAAAGGCTTTCGGAAGAGGG - Intronic
922560823 1:226568432-226568454 CAGGGACAGCTTCAGGAATGTGG + Intronic
923771421 1:236941158-236941180 CAGGTAAAGCTGGAGGAAGTGGG + Intergenic
924038515 1:239960019-239960041 AAGGAAAAAATGAAGGAAGGAGG - Intergenic
924447172 1:244144160-244144182 CTGGAAAAGCTCAATAAAGGAGG + Intergenic
924654207 1:245958538-245958560 GAGGAAAAGCTTCCTGAAGGAGG - Intronic
1063171721 10:3515496-3515518 CTGGAAGAGCTTCAAGAAGGAGG - Intergenic
1063689520 10:8273017-8273039 AGGGAATAGCTTAAGGAAGCTGG - Intergenic
1063764226 10:9119475-9119497 CACGAAAAGCTTAATTAGGGCGG + Intergenic
1064489323 10:15834155-15834177 CATAAAAAGCTTGAGGAGGGTGG + Intronic
1065117565 10:22497463-22497485 CAGAAAAAGCTATAGGGAGGAGG + Intergenic
1065498018 10:26349894-26349916 CAGAAAAATCTCAAGGAAAGGGG + Intergenic
1065791582 10:29265270-29265292 AAGGAACAGCCTAAGGAAGAGGG - Intergenic
1066293389 10:34034038-34034060 CTGCAAATGCTTAAGGAAGGAGG - Intergenic
1067115350 10:43431637-43431659 CAGGAAAAGTTTTGGTAAGGCGG - Intergenic
1067521607 10:47011744-47011766 CAGGAAGAGCTAAAGGAGAGAGG - Intergenic
1067949174 10:50712689-50712711 AAGGACAAGGTCAAGGAAGGTGG + Intergenic
1068798336 10:61109715-61109737 CAGGAAAAGACTAAGTAAGGAGG + Intergenic
1068806203 10:61196425-61196447 CAGGGAAAGCTTTAAGAAGGAGG - Intergenic
1070321495 10:75358140-75358162 CAGCAAAAGCTTAGGGAACCAGG - Intergenic
1070884489 10:79877701-79877723 AAGGACAAGGTCAAGGAAGGTGG + Intergenic
1071105346 10:82087339-82087361 CAGGAAAAGCTTCACAAAAGAGG - Intronic
1073072455 10:100803316-100803338 GAGGATAAGCTCAGGGAAGGAGG - Intronic
1073250821 10:102119578-102119600 CAGGAAAAGTTGAAGGTGGGGGG + Intronic
1073736777 10:106356987-106357009 GAGGAAAAGTAAAAGGAAGGAGG - Intergenic
1073910722 10:108340550-108340572 AAGGAAAAGATGAAGAAAGGAGG + Intergenic
1074045389 10:109833226-109833248 CAGGATATGCTTCAGGAAGGAGG + Intergenic
1074287821 10:112115176-112115198 CAGGAAAGGCTTCAAGGAGGAGG + Intergenic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075932676 10:126312554-126312576 CAGGGAAAGCTTCAGGGAGGAGG + Intronic
1076004709 10:126939177-126939199 ATAGAAGAGCTTAAGGAAGGGGG - Intronic
1077671900 11:4165360-4165382 CAGGGAAAGCCCAAGGAAAGAGG - Intergenic
1077986405 11:7355562-7355584 CAGTAGAAGCTTATGGAAGAAGG - Intronic
1078399977 11:11017629-11017651 CAGGAAAAGCACAAGGGATGGGG + Intergenic
1078962863 11:16299789-16299811 CAGGAAAGGCCAAAGAAAGGGGG + Intronic
1079743342 11:24092949-24092971 TAGGAAATACTTAAGGAACGAGG + Intergenic
1080224392 11:29944267-29944289 CAGGCACACCTTAAAGAAGGTGG - Intergenic
1080634349 11:34110398-34110420 CAGGAAAAGTTTCACGGAGGAGG - Intronic
1083096558 11:60256850-60256872 CAGGAGTATCTGAAGGAAGGAGG - Intergenic
1083284249 11:61647767-61647789 CAGCAAAAGCATAAGGAACCAGG - Intergenic
1084071322 11:66737794-66737816 CAGAAAGAGGTTGAGGAAGGAGG + Intergenic
1085199238 11:74691774-74691796 CAGGAACCGCTGTAGGAAGGTGG - Intergenic
1085497967 11:76989498-76989520 CAGAAAAGGCTTCAAGAAGGAGG + Intronic
1085704079 11:78770446-78770468 CAGTCAAAGCCCAAGGAAGGAGG - Intronic
1086267357 11:85017170-85017192 AAGGAAAAGATTTAGGAAAGAGG - Intronic
1086620376 11:88881039-88881061 CAGGAAAGCCTAAATGAAGGTGG + Intronic
1086663015 11:89445002-89445024 CAAGCAAAGCTTGAGCAAGGGGG - Intronic
1087299153 11:96412673-96412695 CACAAAAAGCTTTAAGAAGGAGG + Intronic
1089750993 11:120651046-120651068 CAGGGAAAGCTTTGGGAATGGGG + Intronic
1090094978 11:123733830-123733852 CAGGAAAAGTGCAAGGAAGTGGG - Intronic
1090206022 11:124884905-124884927 CAGGAGAAGCTGAAGGACAGTGG + Exonic
1090399636 11:126440888-126440910 CGGGGAAAGCTTTAGGGAGGAGG + Intronic
1090807826 11:130213404-130213426 CAGGAAAGGCTTCAGGCTGGGGG - Intergenic
1091239841 11:134045002-134045024 CAGGGAAGGCTTTGGGAAGGAGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092654032 12:10666014-10666036 CAGGTTTGGCTTAAGGAAGGAGG - Intronic
1093173865 12:15889123-15889145 ATAAAAAAGCTTAAGGAAGGGGG - Intronic
1095524301 12:43106779-43106801 CGGAGAAAGCTTAATGAAGGAGG - Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1098174257 12:67774462-67774484 CAGGAAAAGCTGGAGTCAGGAGG + Intergenic
1098241488 12:68471933-68471955 CAGGAAAAGTCTTAGGAAGAAGG + Intergenic
1098722703 12:73923174-73923196 GAGGAAATGCTTTATGAAGGAGG - Intergenic
1098820124 12:75217141-75217163 AAGTAAAAGCTCAAGGAATGAGG + Intergenic
1100260264 12:92926815-92926837 TAGGAAAAGCTTCAGGGACGGGG - Intronic
1101254377 12:102963355-102963377 CAGGAAAAGCTTCTTGGAGGAGG - Intergenic
1102793844 12:115671698-115671720 CAAGAAAACCTCAAGCAAGGAGG + Intergenic
1104779797 12:131412787-131412809 CACGAACAGCTTCAGGAAGAGGG + Intergenic
1105275269 13:18917190-18917212 TATTAAAAGATTAAGGAAGGAGG + Intergenic
1105461988 13:20600388-20600410 CAAGAAAGGCTTTATGAAGGAGG + Intronic
1106402676 13:29444890-29444912 CAGGCAAAGGCAAAGGAAGGAGG - Intronic
1108596448 13:51954144-51954166 CAGGCAAAGGTTAAGGAAGAAGG + Intronic
1110037405 13:70705711-70705733 CATCAAAAGCTTAAAGAAGAAGG + Intergenic
1110862621 13:80359623-80359645 GAGGACAAGCTTACAGAAGGAGG + Intergenic
1110964823 13:81680128-81680150 CAGGAAAAGAGGAAGGGAGGTGG - Intergenic
1111340121 13:86873466-86873488 CAACAAAAGCATAAGGAAGATGG + Intergenic
1112804513 13:103148690-103148712 CAGGAAAGGTTTTATGAAGGTGG + Intergenic
1113249689 13:108438232-108438254 TAGGAAGAGCTGAAGGAAGCAGG - Intergenic
1114261449 14:21039526-21039548 CAGAAAAAGATGGAGGAAGGGGG - Intronic
1114411679 14:22506470-22506492 GAGGAAAAGCCTCAGGAAGGAGG + Intergenic
1114753969 14:25237667-25237689 CAGGAAAAGAATGAGGAAGCAGG - Intergenic
1114767686 14:25393084-25393106 CAGGAAAAATTTAACCAAGGAGG - Intergenic
1115347730 14:32361217-32361239 CAGGAAAAGCTTCAGAGAGAAGG + Intronic
1115456853 14:33613692-33613714 TAGGAAACGCTTCAGGGAGGAGG - Intronic
1115556018 14:34545786-34545808 TAGGAAAACCTAAAGGAGGGGGG - Intergenic
1115557890 14:34557295-34557317 TAGGAAAACCTAAAGGAGGGGGG + Intergenic
1116375641 14:44196549-44196571 AAGGAAAAGATAGAGGAAGGCGG + Intergenic
1116954549 14:50910771-50910793 CAGGAAAAGTGGAAGGAAGGAGG - Intronic
1118348307 14:64955685-64955707 TAGGAAAATCTGAAGAAAGGAGG - Intronic
1118833231 14:69455055-69455077 AAGGAAAAGCTTAAGAAAATGGG - Intronic
1121519661 14:94577336-94577358 TAGGAAAAGCTTTGTGAAGGTGG - Intronic
1121670823 14:95709635-95709657 CAGGGACAGCTTCAGGCAGGAGG + Intergenic
1121718610 14:96093971-96093993 CAGGAAAAGCATCAGAATGGAGG - Exonic
1125082968 15:35697176-35697198 CAGGAAATGCCTTAGGGAGGAGG - Intergenic
1125106672 15:35979741-35979763 GGGGAAAAGCTTAATGAAGCAGG - Intergenic
1125251294 15:37707931-37707953 CATGAAAAGGGGAAGGAAGGAGG - Intergenic
1125385992 15:39137079-39137101 AGGGAAAAGCTTTAGGAAGAAGG - Intergenic
1125501669 15:40243605-40243627 CAGGAAAGGCTTCACGGAGGAGG + Intronic
1126700869 15:51366435-51366457 AAGGGAAAGGTTTAGGAAGGTGG + Intronic
1126865255 15:52929728-52929750 CAGGAAAAGCTTCATGAAATTGG - Intergenic
1127693607 15:61422050-61422072 CAGGGAAAGCCTAACAAAGGAGG - Intergenic
1128644026 15:69361829-69361851 CAGGGAAGGCTTCATGAAGGGGG + Intronic
1128741704 15:70088355-70088377 AAGGAGAAACTTAAGGAAGGGGG - Intronic
1130311831 15:82763039-82763061 CAAGCAAAGCTTTGGGAAGGAGG + Intronic
1130975745 15:88772820-88772842 CAGGGAATGAGTAAGGAAGGGGG + Intergenic
1131292026 15:91114732-91114754 CAGGGAAAGCTTCAGGAAAAGGG + Intronic
1131656561 15:94466545-94466567 CAGGATAAGAATAAGGAAGGAGG - Intronic
1131881224 15:96864452-96864474 CAGGAGAAGTCTAAGGAAAGAGG - Intergenic
1133828979 16:9304444-9304466 TAGGAAGAGTTTAAGGAAGCAGG - Intergenic
1135963652 16:27018354-27018376 CAGGCAAAGCTAAAGGAAGAAGG + Intergenic
1136106968 16:28036870-28036892 AAAGAAATGCTTAAGGAAAGAGG - Intronic
1136158482 16:28401956-28401978 CAGAAAAGGCTTTAGGGAGGTGG + Intronic
1136204605 16:28713327-28713349 CAGAAAAGGCTTTAGGGAGGTGG - Intronic
1138311832 16:56031409-56031431 CAGAAAATGCTTAATAAAGGAGG + Intergenic
1139579370 16:67863285-67863307 CAGGAAAATCTAAAGCAAGCAGG - Intronic
1140358248 16:74323889-74323911 CAGAAAGAGCTTAACCAAGGAGG + Intergenic
1141109051 16:81257156-81257178 CAGGAGAAGCTTCAGGGAGGAGG - Intronic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1143033609 17:3982011-3982033 CAGGGAGTGCTTCAGGAAGGAGG + Intergenic
1143805780 17:9425007-9425029 CAGGAAAAGATTCATGAATGAGG + Intronic
1143881892 17:10036180-10036202 CAGGAAAAGCGGATGGGAGGAGG - Intronic
1144050695 17:11495062-11495084 CAGGAAAGGCCTGAGCAAGGTGG + Intronic
1144080553 17:11760257-11760279 CAGGAAAATCCTAAAGAACGGGG - Intronic
1144166497 17:12616466-12616488 CTGGGAAAGCTTCATGAAGGAGG - Intergenic
1146474526 17:33152410-33152432 CAGGAAAAGCTTCAAGGTGGAGG + Intronic
1146573827 17:33974875-33974897 CAGGAAAAGCTGAGGGATGAGGG - Intronic
1147284867 17:39394180-39394202 CAGGAAAATCCAAAGGAGGGAGG - Intronic
1147403030 17:40192330-40192352 AAAGGAAAGCTTGAGGAAGGGGG - Intronic
1147570941 17:41570574-41570596 CAAGAAAGACTTCAGGAAGGAGG + Intronic
1147887800 17:43696454-43696476 CAGGCAAAGCTTCAGGGAGAGGG - Intergenic
1148799580 17:50214906-50214928 CAGGAGAATCTAGAGGAAGGAGG - Intergenic
1149455642 17:56785935-56785957 CAGGAAAGGCTCTAGGAAGAGGG - Intergenic
1149779532 17:59386420-59386442 TAGGGAAAGCTTAATGAAAGAGG + Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1152740029 17:82014763-82014785 CAGGAAGAGCTTCCGAAAGGAGG - Intronic
1152943495 17:83185386-83185408 CAGGAATGGCTCAAGGATGGAGG + Intergenic
1153637824 18:7128320-7128342 CAGGAAGAGCTCCACGAAGGGGG + Intergenic
1154051348 18:10962299-10962321 CAGGAAAAGCTGCAGGCAAGCGG - Intronic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1154466896 18:14654297-14654319 TATTAAAAGATTAAGGAAGGAGG + Intergenic
1155384689 18:25264835-25264857 CAGAAAAAGCTTCAGGAAGGAGG + Intronic
1157049970 18:44152038-44152060 CAGGAAGAGAATAGGGAAGGTGG + Intergenic
1158097029 18:53784602-53784624 CAGGAAAAGCTTAAAGGAGAAGG + Intergenic
1158501789 18:58008855-58008877 CAGGAAAAGCATATGGGAGTGGG + Intergenic
1158554350 18:58463036-58463058 AAGGAAAAACTTAAAGAATGAGG + Intergenic
1159238956 18:65715184-65715206 CTGGAAAAGATAAAGAAAGGAGG + Intergenic
1160080077 18:75717991-75718013 CAGGAAAAGCGTGAGCAAGAAGG - Intergenic
1160135923 18:76271936-76271958 CAGGAAAGGCTTCACGGAGGAGG + Intergenic
1161502336 19:4623270-4623292 CAGGCAAGGCTTCCGGAAGGAGG - Intergenic
1165200868 19:34143445-34143467 CAGGAAAATCTGAAGCCAGGAGG + Intergenic
1166353005 19:42209472-42209494 CAGGAAAGGCTTCCTGAAGGAGG + Intronic
1167309238 19:48727411-48727433 CAGGAAAAGATTAAGGAAATTGG - Exonic
1168342810 19:55635394-55635416 CAGGAAAAGGTTCCTGAAGGAGG + Intronic
925638052 2:5960802-5960824 CAGGAAAGGCTTATGGACTGGGG - Intergenic
926335025 2:11856692-11856714 AAGGGAGAGCTTGAGGAAGGAGG + Intergenic
926399907 2:12486850-12486872 CAGGTAAGGCTTTGGGAAGGAGG - Intergenic
926632415 2:15148418-15148440 CAAGAAAAGCTTCCGGGAGGAGG + Intergenic
926888571 2:17619724-17619746 GAGGAAATGCATAAGGAGGGAGG - Intronic
928266094 2:29813116-29813138 CAAGAAAAGCTTCATGGAGGAGG + Intronic
928703396 2:33922109-33922131 CAGGATAACCTAAAGGAAGTAGG - Intergenic
929460205 2:42097730-42097752 CATGAAAGGCATGAGGAAGGAGG - Intergenic
930542527 2:52724757-52724779 AAGCAAGAGCTTAAGGCAGGAGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
932036125 2:68248771-68248793 TAGGAAAAGTTTTATGAAGGAGG - Intronic
934032626 2:88061966-88061988 GAAGAAAAGATTAAGGAAGCAGG - Intergenic
935548284 2:104423894-104423916 CAGAAAACGCATAAGGAAGAAGG - Intergenic
935888939 2:107654590-107654612 AATGATAAGCTTAAGGAAGGTGG + Intergenic
938114700 2:128595155-128595177 CAGGAAAAGGCTAAAAAAGGAGG - Intergenic
939272815 2:139961578-139961600 CAGAAAAACCTTAAGGAAAGAGG - Intergenic
939960578 2:148561727-148561749 TAGGAACAGCTTGAGGAAGTGGG - Intergenic
940910631 2:159206536-159206558 CAAGAACAGCTTGATGAAGGTGG - Intronic
941044943 2:160664482-160664504 CAGGAAAGGCTTCTGGGAGGAGG + Intergenic
941219921 2:162765057-162765079 CAGGAGAAGGGTAAGGAAGGAGG + Intronic
943002615 2:182347834-182347856 CAGAAATAGCTTCATGAAGGAGG + Intronic
943575933 2:189631076-189631098 GAGGAAAAACAAAAGGAAGGAGG + Intergenic
943787537 2:191895258-191895280 AAGGAAAAGACGAAGGAAGGAGG + Intergenic
944469970 2:200042437-200042459 GAGGAAAAGCTTCAGGAACCAGG - Intergenic
944979215 2:205094905-205094927 TAGAAAAAACTTAAGGAAGTTGG - Intronic
945135710 2:206625624-206625646 CAGGAAAGGCTTCACGAAGGAGG - Intergenic
945329999 2:208528640-208528662 CTGGAAATGATTAAGGAAGCAGG + Intronic
946059116 2:216926660-216926682 CAGGGAAAGCTTTCTGAAGGAGG - Intergenic
947079988 2:226385393-226385415 AATGAAAAGGTCAAGGAAGGAGG - Intergenic
947435975 2:230072557-230072579 CAGGCAAAGTTTTATGAAGGAGG + Intergenic
948545247 2:238723471-238723493 GGGGAAGAGTTTAAGGAAGGGGG + Intergenic
948581662 2:238991317-238991339 CAGGAAAAGAGCAAGGAAGAGGG - Intergenic
1168804007 20:662337-662359 CAGGGGAAGGTTCAGGAAGGTGG + Exonic
1169389447 20:5177747-5177769 CAGGAAACACCTCAGGAAGGGGG - Intronic
1169947134 20:11001208-11001230 GAGGAAAAGTTTCAGGAAGGAGG - Intergenic
1170506811 20:17035152-17035174 CAGTAAAAGTTTAAGGTTGGGGG - Intergenic
1170913464 20:20598766-20598788 CAGGCAAAGCCTCAGAAAGGTGG + Intronic
1170944107 20:20874625-20874647 CAGGTAAAGGTGAAGGGAGGAGG + Intergenic
1172625963 20:36347036-36347058 CAGGCAAAGCTTCAGGAAGGAGG - Intronic
1173016575 20:39231288-39231310 CAGGGAAAGCTTCTGGGAGGAGG + Intergenic
1173186008 20:40840801-40840823 AAGGAAAAACAGAAGGAAGGAGG + Intergenic
1173310978 20:41895602-41895624 CAGGAATAGCTCAGGGAAGTGGG + Intergenic
1173598671 20:44277365-44277387 CAGGAGAAGATTGAGGCAGGGGG + Intronic
1174124846 20:48296896-48296918 GAGGAAACGCTTCAGGGAGGAGG - Intergenic
1174671425 20:52311344-52311366 CAGGAGCAGGTTAAGGAAGTCGG + Intergenic
1175401105 20:58700392-58700414 CAGGAAAAGCTTCACAGAGGAGG + Intronic
1175426070 20:58867878-58867900 CAGGGACAGCTTGAGAAAGGAGG + Intronic
1175633056 20:60558129-60558151 AAGGAAAAAATAAAGGAAGGAGG - Intergenic
1176807621 21:13503371-13503393 TATTAAAAGATTAAGGAAGGAGG - Intergenic
1177681688 21:24379448-24379470 CAGAAAAAGGTTAAGGGAGAAGG - Intergenic
1177897445 21:26871512-26871534 CAGTGAAAGCTTGAGGAAAGTGG + Intergenic
1178045382 21:28687788-28687810 CAGGAAAAGCTTAAGGATGGAGG + Intergenic
1178490455 21:33047673-33047695 CAGGGAAGGCTTCAGGAAGGAGG + Intergenic
1179003578 21:37487130-37487152 GAAGAAAAGCATAAGGAATGTGG - Intronic
1179103184 21:38374995-38375017 CAGGAAAGGCTTATTGAAGGAGG - Intergenic
1180110668 21:45647505-45647527 CAGGGAAAGCTTTAGAGAGGAGG + Intronic
1181849937 22:25742852-25742874 CAGACAGAGCTCAAGGAAGGTGG - Intronic
1181948462 22:26537216-26537238 CAAGAAAAGGTTAGAGAAGGTGG - Intronic
1181999248 22:26906777-26906799 CAGTTAAAGCTTATGGAAGAAGG + Intergenic
1182748847 22:32626000-32626022 CAGGAAAGGCTTAAGGAAGGAGG + Intronic
1182748851 22:32626026-32626048 CAGGAAAAGCTTAAGGAAGGAGG + Intronic
1182753241 22:32658228-32658250 CAGGAGAAACCAAAGGAAGGTGG + Intronic
1183188862 22:36308698-36308720 CAGGAAAAGCCAAGGCAAGGGGG + Intronic
1183322159 22:37171573-37171595 TGGGAAAATCTGAAGGAAGGAGG + Intronic
1183814649 22:40289536-40289558 CAGGAAGTGCTTCAGAAAGGAGG - Intronic
1184221960 22:43106588-43106610 CAGGGAAAGCTTCATGGAGGAGG - Intergenic
1184262464 22:43326888-43326910 GAGCAAAAGCTTCAGGGAGGAGG - Intronic
1184653639 22:45930635-45930657 CAGGAGCAGCCTGAGGAAGGTGG - Intronic
1184699768 22:46162760-46162782 CAAGGAAGGCTTCAGGAAGGAGG - Intronic
1185027929 22:48426158-48426180 CAGGAAGTGTGTAAGGAAGGTGG - Intergenic
1185282931 22:49983425-49983447 CAGTAAAAGCTGAAGCGAGGGGG + Intergenic
949392157 3:3574189-3574211 GAGGAAAAACATCAGGAAGGTGG + Intergenic
950041999 3:9925750-9925772 GGGGAAAAGCTTTGGGAAGGAGG - Intronic
950200543 3:11039879-11039901 CAGGAAAAGCCTCTGTAAGGAGG - Intergenic
950351195 3:12354970-12354992 CAGGAAAATATTAATGAAAGTGG - Intronic
951161231 3:19425315-19425337 CAGAAAGAGTTTAAAGAAGGAGG - Intronic
951914426 3:27784931-27784953 AAGGGAAAACTTAGGGAAGGTGG - Intergenic
953094487 3:39761544-39761566 CAGAAAAGGGCTAAGGAAGGCGG + Intergenic
953148783 3:40305136-40305158 TGGGAAAAGAGTAAGGAAGGTGG - Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
954755542 3:52837419-52837441 AAGTTAAAGCTTGAGGAAGGAGG + Exonic
955318602 3:57958844-57958866 CAGAAAAAGAATGAGGAAGGAGG - Intergenic
956797252 3:72728212-72728234 CAGGAAAACCCAAAGCAAGGCGG + Intergenic
956893024 3:73631054-73631076 TAGCAAAAGCTTGGGGAAGGGGG + Intergenic
957506250 3:81125174-81125196 CAGGAAAAGGGTAAGCAAGAGGG + Intergenic
957722886 3:84027002-84027024 CATGAAAAGCTTAAAGAATAAGG - Intergenic
958762199 3:98322560-98322582 TAGCAAAATCTTAAGAAAGGAGG + Intergenic
959940385 3:112075125-112075147 CAGGGCATGCTTCAGGAAGGAGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960125128 3:113990060-113990082 GAGCAAACTCTTAAGGAAGGAGG + Intronic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
961576654 3:127842343-127842365 CAGGAAAATGTCAGGGAAGGGGG - Intergenic
961668998 3:128514253-128514275 CAGAAAACTCTTAAGGAATGGGG - Intergenic
963317655 3:143777259-143777281 CATGGAAAGCTTAAGACAGGAGG + Intronic
964383328 3:156120493-156120515 CAGGATAAGGTTAAGAGAGGTGG + Intronic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
965115047 3:164477795-164477817 CAGGAACAGCCTAAAGAAGGGGG + Intergenic
965199551 3:165639397-165639419 CAGGAAAAACTTAGTGAAGCAGG + Intergenic
965258445 3:166446756-166446778 CAGGAAAAGCTTATGGAATAGGG - Intergenic
965441595 3:168721719-168721741 GAGGAAAAGTGTAAGGAATGTGG - Intergenic
965818359 3:172659832-172659854 GAGGAAGAGCTGAAGGAAAGGGG - Intronic
965984435 3:174734877-174734899 TATGTAAAGCTTAAGGAAGATGG + Intronic
966755355 3:183365384-183365406 AAGGCAAAGCTTAAGGGATGGGG + Intronic
967046104 3:185738457-185738479 CAGGAAGGGCTTCAGGGAGGTGG + Intronic
967141823 3:186567910-186567932 CTGAAAAAGCTTCATGAAGGTGG - Intronic
968785919 4:2622375-2622397 CAGGACAGGCATAAGGAAGCAGG - Intronic
969217418 4:5733421-5733443 CAGGAAAAGCATATGGTAGGTGG + Exonic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
970452204 4:16180745-16180767 CTGGAAGAGCTTAAGGATGTAGG - Intronic
970789880 4:19844631-19844653 GAGGAAAAGCTCAAGCAATGTGG - Intergenic
972839007 4:42909164-42909186 CAGCAATAACTTAAGGAATGAGG - Intronic
973532879 4:51850802-51850824 CAGGAAAGGCTTCACTAAGGAGG + Intronic
974281194 4:59796105-59796127 TATTAAAAGATTAAGGAAGGAGG - Intergenic
974339435 4:60596013-60596035 AAGGAAAAGATTGGGGAAGGTGG - Intergenic
976372785 4:84309420-84309442 CATGAAAATCTTAAGGTAAGAGG - Intergenic
978344575 4:107753711-107753733 CAAGAAAAGTTTAAGGACTGTGG + Intergenic
979768997 4:124499218-124499240 CAGGAAAAGATTAGGAAAGTGGG - Intergenic
979805627 4:124967119-124967141 TAGGAAAAGCCTAAGGCATGGGG - Intergenic
981054857 4:140350160-140350182 CAGGGAAAGCTTCCTGAAGGTGG - Intronic
981223430 4:142263774-142263796 CAGGAAAGGCTTCAGTGAGGAGG + Intronic
982768417 4:159373657-159373679 CTGGAATAGCTTTAGGAATGTGG + Intergenic
982944509 4:161602905-161602927 CAGGAAACTCTTCAGGAAGAAGG + Intronic
983195281 4:164799549-164799571 GAACAAAAGGTTAAGGAAGGAGG - Intergenic
983402491 4:167282554-167282576 AAGGAAAAACTGAAAGAAGGAGG + Intergenic
983454097 4:167940851-167940873 CAGGAAAAGATTCCGGAAGAAGG - Intergenic
983790569 4:171792771-171792793 CAGGAAGAGGTGAGGGAAGGAGG + Intergenic
985152181 4:186959030-186959052 CAGGTTGAGTTTAAGGAAGGGGG - Intergenic
985479165 5:96771-96793 AAAGAAAAGCATAGGGAAGGGGG + Intergenic
986384858 5:7222706-7222728 CAGGAAAAGATAAAGGAAGTAGG - Intergenic
986848857 5:11786536-11786558 CAGGAAAGGCTGAAGCAAGATGG + Intronic
987067501 5:14303817-14303839 TAGGAAAGGCTTAAGGAGGCAGG - Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988587985 5:32524357-32524379 CATTAACAGCTGAAGGAAGGAGG + Intergenic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
990793779 5:59516314-59516336 AAGGAAAAGCTAAAGAAAGAGGG - Intronic
991124098 5:63050225-63050247 CAGTGAGAGCATAAGGAAGGAGG - Intergenic
992026109 5:72670284-72670306 CAGGACAAGGCTAAAGAAGGTGG - Intergenic
992268925 5:75046234-75046256 CTGGAAAGGCTAAAGGAAGAAGG + Intergenic
992350334 5:75921615-75921637 CAGGAAAAACATCAAGAAGGGGG - Intergenic
992565948 5:77995335-77995357 CAGAAAAAGCTAAAGGGATGGGG - Intergenic
993074085 5:83205182-83205204 CAGGAAAAGCATAAGCAATGAGG + Intronic
993180196 5:84542744-84542766 AAGGAAAAGATTAATGAAAGAGG - Intergenic
993846211 5:92946924-92946946 CAGAGAAGGCTTAAGGGAGGAGG + Intergenic
994915701 5:105975920-105975942 AGGGAAAAGGTTGAGGAAGGTGG - Intergenic
995450483 5:112294546-112294568 CGGGGAAAGCTTCAGGAAGCAGG + Intronic
996563196 5:124852312-124852334 CAGGAACAGATTAAGGCATGAGG + Intergenic
997091724 5:130865913-130865935 CAGGAAAAGCTCTAGAAAGGGGG + Intergenic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
999056888 5:148587534-148587556 GAGGAAAAGCCTGAGAAAGGTGG - Intronic
999110621 5:149117683-149117705 CAGGAAAATCTTAAGAGAAGAGG - Intergenic
999913760 5:156235097-156235119 CCAGAAAAGGTTAAGGAAGGGGG - Intronic
1003366795 6:5482743-5482765 TAGGAAAAGCTTCAAGGAGGGGG + Intronic
1003579692 6:7328409-7328431 CAGGAAAAGCTTCAGAGAGGAGG + Intronic
1003857740 6:10293234-10293256 CAAGCAAGGCTTTAGGAAGGAGG + Intergenic
1004192620 6:13477412-13477434 CAGGAAAAGATTGAGGGAGAAGG - Intronic
1004285760 6:14318980-14319002 CAGGGAAAAGTTAAGGAAGCTGG - Intergenic
1004748948 6:18541049-18541071 CAGGAAAGGCTTAATGGAGTAGG + Intergenic
1005396937 6:25392514-25392536 AAGGAAAAGCTGAAGGAAGTAGG - Intronic
1009515178 6:64607012-64607034 GGGGAAAAGCTTAAAGCAGGTGG + Intronic
1012352980 6:98276489-98276511 CAGTAAAAGCCCAAGGAAGGGGG - Intergenic
1012526647 6:100185703-100185725 GATGAAGAGTTTAAGGAAGGTGG + Intergenic
1013973800 6:116052624-116052646 CAGGAAAGGCTTGGGGAAGGAGG + Intronic
1015710390 6:136132855-136132877 CAGGACACTCTTAAGGAAGCAGG - Intronic
1015930495 6:138354661-138354683 CCAGAAAATTTTAAGGAAGGTGG - Intergenic
1016909316 6:149181661-149181683 CAGAAACTGCTTAAGGAAGTTGG - Intergenic
1018108203 6:160509111-160509133 CAGGAGAAGATTAAGCAAAGAGG - Intergenic
1018445593 6:163855330-163855352 CAAGAGAAGCATAAGGAAAGAGG - Intergenic
1018500462 6:164405064-164405086 AAGGAAAACGTTAATGAAGGAGG - Intergenic
1018550768 6:164996138-164996160 CAGCAAAAACATAAGGAAGAGGG + Intergenic
1019904902 7:4054572-4054594 AAGGAAGAGCTGGAGGAAGGTGG - Intronic
1020342218 7:7124418-7124440 CAAGACAAGCTTGAGGAAGGGGG - Intergenic
1020665231 7:11032892-11032914 CAGGTAATGGTTAAGGAAGATGG + Intronic
1021175424 7:17444376-17444398 CAGGAAAACCTTCAGGAAGATGG - Intergenic
1021197329 7:17688105-17688127 CAGGAAAAGCTTTAAAAATGGGG - Intergenic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1021929926 7:25569966-25569988 CAGGAAAAACTCTATGAAGGAGG - Intergenic
1022117514 7:27275324-27275346 CAGGAAAAGGTGGAGGAATGGGG - Intergenic
1023484890 7:40675701-40675723 CTGGAAAAGCATCAGGAACGGGG + Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1026905733 7:74061811-74061833 CAGGGCAAGCTTAGGGATGGTGG - Intronic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1027502379 7:78969197-78969219 CAGTAAAAGATTAGGGTAGGAGG + Intronic
1027610967 7:80360127-80360149 GAGGAAAAGCTGAAGGATGCTGG - Intergenic
1028533124 7:91861274-91861296 CAAAAAAAGTTTAAGGAAGGTGG + Intronic
1030309308 7:108053533-108053555 CAGGAAAGGCTTCAGGGAGGAGG + Intronic
1030499148 7:110337542-110337564 CAGGTAAAGCTTAATGAGGTAGG - Intergenic
1032575096 7:133045025-133045047 CAGGAAAAGCTTTAGGTAGAGGG - Intronic
1033007174 7:137578748-137578770 CAGGAAAAGGTGGAAGAAGGTGG + Intronic
1033319911 7:140330116-140330138 CGGGAAAAGCTTCATGGAGGTGG + Intronic
1034269933 7:149798511-149798533 CAGCAAACGCTTCAGAAAGGGGG - Intergenic
1035109980 7:156473367-156473389 CAGAAAAACTGTAAGGAAGGTGG + Intergenic
1036480011 8:9131305-9131327 CAGGAGATGCTTCAGGGAGGGGG + Intergenic
1037129604 8:15391524-15391546 TAAGAAAAGCATAAGGGAGGAGG + Intergenic
1037912708 8:22753654-22753676 CAGGAAGGGCTTCAGCAAGGTGG - Intronic
1038524709 8:28262987-28263009 CAGGAAGACCTGAAGGAAAGGGG + Intergenic
1038592310 8:28851060-28851082 AAGTAAAAGCTTAATGAAGAAGG + Intronic
1038599216 8:28922007-28922029 CAGGAAAAGCTACAGGGAGGAGG + Intronic
1039572451 8:38598624-38598646 CAGGAAATGCTTCAGGGAAGAGG - Intergenic
1039724385 8:40199868-40199890 GAGGAAATTCTTTAGGAAGGAGG - Intergenic
1039789580 8:40864255-40864277 CAGGAAACTCTCAAGGAAAGAGG - Intronic
1043184499 8:77129378-77129400 CAGGGACAGCTTAAGGAATGGGG - Intergenic
1043566303 8:81552355-81552377 CAGGAAACACTTAAGGAAGAAGG + Intergenic
1044167224 8:89001621-89001643 CAAGAAAAGCTTAGAGATGGCGG + Intergenic
1044350216 8:91155959-91155981 CAGCAAAAGATTAAGGAATAAGG - Intronic
1044672222 8:94693930-94693952 AGTGAAAAGCTGAAGGAAGGTGG + Intronic
1044691734 8:94887156-94887178 AAGGAAAATCTTAAGAAAGGAGG + Intronic
1045097757 8:98816164-98816186 CAGGAAAAGGAAAAGGATGGAGG + Intronic
1045947272 8:107810781-107810803 CAGTCAAAGCTGAAGAAAGGAGG - Intergenic
1046300427 8:112278974-112278996 CAGGATACGCTTCAGGAAGAAGG - Intronic
1046864809 8:119135724-119135746 CAGGAAAAGGTAAAGCATGGCGG + Intergenic
1047318043 8:123752722-123752744 CAGGAAAGGCTTCCAGAAGGAGG + Intergenic
1047480223 8:125275162-125275184 CAGGAAAAGGATATGGAAGGGGG - Intronic
1047782519 8:128121888-128121910 AATGACAAGCTGAAGGAAGGAGG - Intergenic
1048427374 8:134335346-134335368 CAGTAACAGCATAGGGAAGGGGG + Intergenic
1049066437 8:140320047-140320069 AAGGAAAAACCTAAGGAAGAAGG + Intronic
1051318377 9:15869272-15869294 AAAGAAAAGGTTAAAGAAGGAGG + Intronic
1054723654 9:68628369-68628391 CAGGTAAAGCTAAAGAAAGTGGG - Intergenic
1055465179 9:76558515-76558537 TAGTAAAGGCTTAGGGAAGGTGG - Intergenic
1056306372 9:85294737-85294759 CAGGAAAAGTCTAAGGCAGGAGG - Intergenic
1056807045 9:89736934-89736956 CAGCAAAACCCTAAAGAAGGTGG - Intergenic
1057111954 9:92480499-92480521 CTGGAAAAGCCTAGGTAAGGAGG + Intronic
1057396939 9:94689032-94689054 CAGGAAATACACAAGGAAGGTGG - Intergenic
1057852332 9:98575232-98575254 CAGGAAAGGCTTCCTGAAGGAGG + Intronic
1058223730 9:102334974-102334996 TGGGATAAGCTAAAGGAAGGAGG - Intergenic
1058276789 9:103052598-103052620 AAAGAAAAACTTAATGAAGGAGG - Intergenic
1058503388 9:105645684-105645706 TAGAAAAAGCTCCAGGAAGGAGG + Intergenic
1058554028 9:106147219-106147241 CAGGAAAAGCTTCAGAAAGTGGG - Intergenic
1059146325 9:111903167-111903189 CAGGTAAAGGTTAAACAAGGAGG - Intronic
1059506347 9:114803108-114803130 CAGGAAAAGCTTTCTGGAGGAGG - Intronic
1059548711 9:115205751-115205773 AATGAACAGCTTAAGGAAGAGGG - Intronic
1059732905 9:117074374-117074396 CAGGGAAAGCTTCAGAAAGGTGG + Intronic
1060149755 9:121281074-121281096 CAGGAAGAGCTGGAGGAAAGGGG + Intronic
1060384901 9:123216162-123216184 CAGGCAAAGGATTAGGAAGGGGG - Intronic
1061209266 9:129181421-129181443 CAGGAAAACCTTGCTGAAGGAGG + Intergenic
1062080483 9:134620941-134620963 CAGGAAAAGCCCAGGGCAGGTGG - Intergenic
1185975118 X:4711488-4711510 CAGGACAACCTGAAGCAAGGCGG + Intergenic
1186206734 X:7208661-7208683 AAGGAAAAATATAAGGAAGGAGG - Intergenic
1187186593 X:16992563-16992585 CAATAAAAACATAAGGAAGGTGG - Intronic
1187833603 X:23408134-23408156 CAGTAAAAGAATAAGGGAGGAGG - Intergenic
1188399004 X:29721181-29721203 AAGGAAAAGCTTCATGGAGGAGG - Intronic
1191176673 X:57510253-57510275 CAGGAAAAGAAAAAGGAAAGAGG + Intergenic
1192432275 X:71120510-71120532 CCGGAAAGGCTTTAGGAAGGTGG + Intronic
1192433934 X:71130819-71130841 GAGGAAAAGCTAAAGGAATAAGG + Intronic
1192730999 X:73802598-73802620 CAAGAGAGACTTAAGGAAGGTGG + Intergenic
1192834295 X:74782749-74782771 CAGGAAAGGCTTTAAGGAGGAGG - Intronic
1193369754 X:80680575-80680597 CTGGAAAACCTTAAGGAAGGTGG + Intronic
1196396049 X:115262749-115262771 CAGGAAAAGCTTTCTGGAGGAGG + Intergenic
1197456650 X:126684340-126684362 CAGTAGAAGCATAAGGAAAGGGG + Intergenic
1197747024 X:129938455-129938477 CAGGGAAGGCTTCTGGAAGGGGG - Intergenic
1199218338 X:145287195-145287217 AATGAAAAGAGTAAGGAAGGAGG + Intergenic
1199784915 X:151096428-151096450 CAGGGAAAGCTTCATGAAGAAGG - Intergenic
1201578607 Y:15487806-15487828 AAGGAAAAATATAAGGAAGGAGG - Intergenic