ID: 1182750393

View in Genome Browser
Species Human (GRCh38)
Location 22:32637143-32637165
Sequence CTGGTAAGATTTAGAATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182750393_1182750396 16 Left 1182750393 22:32637143-32637165 CCTGCAATTCTAAATCTTACCAG 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1182750396 22:32637182-32637204 TGTAATAGAGAACCAATGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182750393 Original CRISPR CTGGTAAGATTTAGAATTGC AGG (reversed) Intronic
900720288 1:4171614-4171636 CTGGGAGGAGTTAGGATTGCTGG + Intergenic
904964845 1:34363718-34363740 CTGGCAAGATCTGGAATTGGAGG + Intergenic
907565448 1:55429716-55429738 CTAGCAAGATTTAGAAGTGCTGG + Intergenic
916269628 1:162926720-162926742 CTGGGAAGAGATAGAATTGTTGG + Intergenic
916298983 1:163252947-163252969 CTGATATGAGTTAGAATTACAGG - Intronic
916726082 1:167525550-167525572 CTGGTAACATTCAGGATGGCAGG + Intergenic
918925276 1:190777089-190777111 CTAGTGAGATTTAGAAAGGCAGG - Intergenic
920645395 1:207799740-207799762 CTGGTAAAATTTAGATAAGCAGG + Intergenic
920980628 1:210831058-210831080 TTGGTCAGACTTAGAATTGAGGG - Intronic
924164721 1:241269572-241269594 CTGGTAAGATTTAGAAAGCAGGG + Intronic
924471236 1:244344290-244344312 CTGGCAACATCTAGATTTGCTGG - Intergenic
924815237 1:247435759-247435781 CTGGGAAGATGTAGTATTGGTGG + Intronic
1070152802 10:73815311-73815333 ATGGTAAGACTTGGAAGTGCAGG - Intronic
1071281370 10:84107260-84107282 ATGGTAAGATTTACAACTCCAGG + Intergenic
1072823437 10:98581747-98581769 CTGGCAACGTTTAGAATTGTTGG - Intronic
1074611894 10:115029678-115029700 CTGGTCAGATGTGGAATTGTGGG + Intergenic
1077652607 11:3987050-3987072 CTGGTAAGATTAGAAGTTGCTGG + Intronic
1080426249 11:32157380-32157402 GTGGAAAAATTCAGAATTGCTGG - Intergenic
1085763024 11:79258588-79258610 CTGATAGGATTTAGAGATGCAGG - Intronic
1087937487 11:104051552-104051574 CTGGGAAGATTTAAAATTTAAGG + Intronic
1088581092 11:111317683-111317705 CAGGTAAGCTTTAGCATTCCAGG - Intergenic
1089161179 11:116438647-116438669 CTGCAAAGATATAGAAATGCTGG - Intergenic
1090585761 11:128210723-128210745 CTGGAGAGATTTAGAACTGCTGG + Intergenic
1092584788 12:9888188-9888210 CACATAATATTTAGAATTGCAGG + Intronic
1093047544 12:14466279-14466301 CTGCTTAGAGTTAAAATTGCTGG + Intronic
1093433937 12:19114205-19114227 ATGGTGAAATGTAGAATTGCTGG + Intergenic
1093867964 12:24251337-24251359 CTGATAAGATTCAGCATGGCAGG + Intergenic
1098598374 12:72299358-72299380 ATGGCAAGATTAAGACTTGCTGG + Intronic
1098637652 12:72803781-72803803 TTTGTAGGATATAGAATTGCTGG + Intergenic
1098640407 12:72832181-72832203 CTGCCAAGACTCAGAATTGCTGG - Intergenic
1099377585 12:81911007-81911029 CTGTTAAGATTTAGACTTTCAGG - Intergenic
1099898684 12:88681046-88681068 CTGGTCTGATTTAGGATTTCTGG + Intergenic
1101022148 12:100564502-100564524 CTGGTTATTTTTAGAATTCCAGG - Intergenic
1102361774 12:112294240-112294262 CTGGAAGGAATTAGATTTGCTGG - Intronic
1102987046 12:117286576-117286598 CTGGAAAGATTTAGCAGTCCTGG - Intronic
1103545989 12:121701926-121701948 CTGGTAACTTGTAGAATTACAGG + Intergenic
1105941601 13:25152794-25152816 CGAGTAAGATTTGGAATTGGAGG - Intergenic
1107675394 13:42791117-42791139 CTGATATTATTTAGAATTGCTGG - Exonic
1108619167 13:52164394-52164416 CTGGAAAGCTTTTGAATAGCTGG + Intergenic
1108639937 13:52373818-52373840 CTGGAAAGCTTTTGAATAGCTGG + Intergenic
1109282152 13:60369312-60369334 GTGGTAACACTGAGAATTGCAGG - Intergenic
1109408197 13:61928171-61928193 CTGCTAAAAGTCAGAATTGCAGG - Intergenic
1111773488 13:92628626-92628648 CTGGTACGATTTAAAATGGTGGG + Intronic
1112918946 13:104586347-104586369 CAGGAAAGATTTAGGAATGCTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116484293 14:45428101-45428123 CTGGGAAAAATTAGAATTCCAGG - Intergenic
1117762827 14:59050020-59050042 CTGGTAAGATTTACAAGAGCTGG - Intergenic
1118434162 14:65754232-65754254 CAGGTAAGATTCAGAACTGTAGG - Intergenic
1119138697 14:72245065-72245087 CTGATATCGTTTAGAATTGCTGG - Intronic
1119453605 14:74734918-74734940 CTTGTAAGAATTAGAATCGAGGG - Exonic
1120132173 14:80820726-80820748 CTGGTACAATTTAGAAAAGCTGG - Intronic
1120243598 14:81979637-81979659 TTGTAAAGATTTAGAATTTCAGG - Intergenic
1122024760 14:98867688-98867710 CTGGAAAGAATCAGATTTGCAGG - Intergenic
1125988473 15:44079993-44080015 TTGGGAAGATTTAAAAGTGCTGG + Intronic
1126892852 15:53224427-53224449 CTGGTAAGTTCTAGGCTTGCTGG + Intergenic
1127096763 15:55519296-55519318 CTTGTGAGATATAAAATTGCAGG + Intergenic
1127329615 15:57925695-57925717 CTGCTAAGATTTAAAACTGTAGG + Intergenic
1129554181 15:76487745-76487767 CTGATATGAATAAGAATTGCAGG - Intronic
1130034757 15:80348265-80348287 CTGGTAATATCTAGTAATGCTGG - Intronic
1135490594 16:22906064-22906086 CTGGAGAGTTTTAAAATTGCAGG + Intronic
1139080038 16:63506284-63506306 CTGTTAAGATTCACAACTGCTGG - Intergenic
1139574820 16:67834307-67834329 CTGGTTAGATTTGCATTTGCAGG + Intronic
1139774387 16:69306633-69306655 CTGGTTAGATTTATAATTTCTGG + Exonic
1143812776 17:9485889-9485911 CTGGTCAGATTTAGAACTCCCGG - Intronic
1144333481 17:14247542-14247564 CTAATAACATTTAGAAATGCGGG - Intergenic
1144428873 17:15172173-15172195 CTGGTACCATCTAGAATTTCAGG + Intergenic
1149693411 17:58597509-58597531 CTGATATTATTTAGAATAGCTGG - Intronic
1151155126 17:72118658-72118680 CTGCTGAGATTTATATTTGCAGG - Intergenic
1153632098 18:7080427-7080449 CTGGCAAGATTGAGAATGGCAGG + Exonic
1155061281 18:22231104-22231126 CTGGTAAGCAGGAGAATTGCTGG + Intergenic
1155406822 18:25497778-25497800 CTTGAAAGATTCAGAATTGATGG - Intergenic
1156171059 18:34486110-34486132 CTGGTTAGACTGAGGATTGCTGG + Intergenic
1157206275 18:45703044-45703066 CTGCTGGGTTTTAGAATTGCAGG - Intergenic
1157448948 18:47771422-47771444 CTGGTCAGAAATAGAATTGTTGG - Intergenic
1157641078 18:49215379-49215401 CTGGTAGTATTGAGAATTGCTGG + Intronic
1159076076 18:63683427-63683449 TTTGTAAGATTGAGAAATGCAGG + Intronic
1159793655 18:72816111-72816133 CTGGAGAGATAGAGAATTGCAGG - Intronic
1160011243 18:75108369-75108391 GGGGGAAGAATTAGAATTGCAGG + Intergenic
925028308 2:626849-626871 CTGTGAAGTTTTAGAATCGCTGG - Intergenic
926386351 2:12339214-12339236 CTGGTGGGATTTAGAATCCCAGG + Intergenic
928843745 2:35643628-35643650 CTGGAAAGATTGAGAGTTGAAGG + Intergenic
931028912 2:58148047-58148069 CTCCTGAGATGTAGAATTGCTGG + Intronic
931155765 2:59627144-59627166 CTGGTGACATTTAGAGTTGAGGG - Intergenic
931404769 2:61965153-61965175 CTGTTGATATTTAGAATAGCAGG + Intronic
932849341 2:75169604-75169626 ATGGTAAAATTTTGAATTCCAGG - Intronic
935246648 2:101224669-101224691 CGGGAAAGATTTAGGAGTGCTGG + Intronic
936565779 2:113581568-113581590 CTGGTGTGATTTAGAACTGGGGG + Intergenic
937155016 2:119712751-119712773 CTGGCATTGTTTAGAATTGCTGG - Intergenic
937279488 2:120707551-120707573 AGGGTAAGTTATAGAATTGCTGG + Intergenic
940188720 2:151015501-151015523 CTGGTAAAATTGAGAAATACTGG - Intronic
947959014 2:234219040-234219062 CTGGTTACATTTAGAATTCCAGG + Intergenic
1168775699 20:445627-445649 CTCTTTAGTTTTAGAATTGCTGG - Intronic
1171568400 20:26219487-26219509 CTGGTAAGGATTAGATTTGAAGG + Intergenic
1177592341 21:23186253-23186275 TTTGTAAGATATAGCATTGCTGG + Intergenic
1179394784 21:41028861-41028883 CTTGTAACATTAAGTATTGCTGG + Intergenic
1182750393 22:32637143-32637165 CTGGTAAGATTTAGAATTGCAGG - Intronic
1184589063 22:45468969-45468991 GTGGTAAGCTTCAGTATTGCGGG + Intergenic
1184821206 22:46910387-46910409 CCAGTAAGATTTAGGATTGTAGG + Intronic
951647410 3:24907959-24907981 CCAGTAAGATTTAGAATTGCAGG - Intergenic
955079596 3:55646223-55646245 CAGGTTGGATTAAGAATTGCAGG - Intronic
955646569 3:61144555-61144577 CTAGGAAGGTATAGAATTGCTGG + Intronic
957110446 3:75948864-75948886 CTGGTAAGGATTAGATTTGAAGG - Intronic
957964896 3:87309814-87309836 GTGGTAAGAGATAGGATTGCTGG + Intergenic
959488566 3:106958173-106958195 CTGAGAAGTTTTAGAAATGCAGG - Intergenic
959822966 3:110758387-110758409 CTAGTAGGATCTAGAATTGTAGG + Intergenic
959936315 3:112033005-112033027 CTGACATTATTTAGAATTGCTGG + Intergenic
960504211 3:118473193-118473215 GTGGTCAGAATTAGAATTGTTGG - Intergenic
961410888 3:126719593-126719615 ATGGTAAGGTTTACAGTTGCTGG + Intronic
962091491 3:132248778-132248800 CTGACATCATTTAGAATTGCTGG + Intronic
962406948 3:135108743-135108765 CTGGGAAGATCTAGAGCTGCAGG - Intronic
963515379 3:146301723-146301745 CTGGTTAGATTCAGAAGTGCTGG - Intergenic
963756429 3:149239350-149239372 CCCATAAGATTTAGATTTGCAGG + Intergenic
963760453 3:149283043-149283065 CTGGTAATTTTAACAATTGCTGG + Intergenic
970050371 4:11907238-11907260 CTGATGAGACTCAGAATTGCTGG + Intergenic
971736124 4:30454836-30454858 CAGGAAAGAATTAGAATGGCAGG + Intergenic
971737682 4:30477509-30477531 CTGATGTTATTTAGAATTGCTGG + Intergenic
974227279 4:59062764-59062786 CTGTTATGATTTAGAATTTAGGG - Intergenic
975087782 4:70364380-70364402 GTGGTTAGATTTAGAATTCAGGG + Intronic
975717693 4:77220928-77220950 CTGAGAAGATTTAGAATTGAAGG + Intronic
976704225 4:88005166-88005188 CTGTGAAGATTCAGAATTTCAGG + Intergenic
978755477 4:112297416-112297438 CTGCTCAGAGTTAGATTTGCTGG + Exonic
980327461 4:131366598-131366620 CTGATAAGAATAAGAAATGCTGG + Intergenic
980573951 4:134661508-134661530 CTGGGAAATTTTAGAAATGCTGG + Intergenic
982766426 4:159354044-159354066 TTGGTAAGTTTTAAAATTGGGGG + Exonic
982899510 4:160980730-160980752 CAGGAAAGATCTAGAAATGCGGG + Intergenic
984941919 4:184940128-184940150 CTGGGAAACTTTAGAACTGCTGG - Intergenic
985079610 4:186251490-186251512 CGGGTAAATTTTAGAATGGCAGG - Exonic
985573760 5:664298-664320 CTGGGAAGATTCAGAATGTCCGG - Exonic
986261805 5:6154029-6154051 ATGGCAAGATTTAGAAATCCAGG - Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
991299351 5:65113879-65113901 CTGGGAAGCTTTAGTATTCCAGG - Intergenic
993639611 5:90386468-90386490 CTAGTAACATTCATAATTGCAGG + Intergenic
994427483 5:99609824-99609846 CTGTTAACATGTAGAATTGGAGG - Intergenic
996256199 5:121406058-121406080 ATTCTAAGATGTAGAATTGCTGG + Intergenic
997352853 5:133243532-133243554 CAGCAAAGATTTGGAATTGCTGG + Intronic
998615072 5:143731055-143731077 CTGGCATTGTTTAGAATTGCTGG + Intergenic
1001691021 5:173632547-173632569 TTGGGAAGATCTAGAATTGGAGG + Intergenic
1002667874 5:180839920-180839942 CTGGTAAGATTTTGAATCCCTGG + Intergenic
1003647379 6:7924764-7924786 CTGGTAAGACTGAAAATTGAGGG + Intronic
1004556589 6:16704554-16704576 TTGGTAAGATTTTCAAGTGCTGG - Intronic
1005819910 6:29589210-29589232 ATGGTAGGAATTAGAATTGGAGG - Intronic
1005896003 6:30179418-30179440 CTTGAAAGATGTAGAATGGCTGG - Intergenic
1008538732 6:52528122-52528144 CTGGAAAGCTTTAGAAAAGCTGG - Intronic
1011384682 6:86782237-86782259 CAGCTAGGATTTAGAATTACTGG + Intergenic
1012936420 6:105372521-105372543 CTGGGAAAATTTAGAAGTGAAGG + Intronic
1015017110 6:128426873-128426895 CTGGTAAGACTTAAGATTTCAGG + Intronic
1017614299 6:156228467-156228489 CTGATAAAATGTAGAATTCCTGG + Intergenic
1017645007 6:156531936-156531958 CTGGAATGTTTGAGAATTGCCGG - Intergenic
1021445551 7:20730112-20730134 CAGGTAAGATTTAGGAATACTGG - Intronic
1021733787 7:23622814-23622836 CTTGTAAGATTTAGAATGGAGGG - Intronic
1021846515 7:24768303-24768325 ATGGTAAGATTTAGCATAGGGGG + Intergenic
1023749980 7:43362987-43363009 CAGGTAAGAATTTGAATTCCAGG - Intronic
1024778055 7:52811475-52811497 GTGGTAATATTTAGAATTGAAGG - Intergenic
1024841215 7:53589944-53589966 CCGATAAAATTTTGAATTGCTGG + Intergenic
1027949779 7:84800334-84800356 TTGGTAAAAATTAGAATTCCTGG + Intergenic
1029829007 7:103235609-103235631 CTGATAAGATTGAAAATTCCAGG + Intergenic
1030398601 7:109019555-109019577 CTGGAAAGATTTTTAATTGAGGG + Intergenic
1032280041 7:130492582-130492604 GTGGTGAGATTTAGGATTTCTGG + Intronic
1036069519 8:5425167-5425189 CTGGGAAGCTTTAGTAATGCTGG + Intergenic
1036086972 8:5623143-5623165 CTGGAAAGATTTAGAAGTGAGGG + Intergenic
1038106015 8:24435026-24435048 CTGGTAGAGTTTAGAATTGAGGG + Intergenic
1038374659 8:27027288-27027310 CTCGTAAAATTTAGAACTGAAGG + Intergenic
1039315307 8:36365449-36365471 ATGTAAAGACTTAGAATTGCTGG - Intergenic
1040621966 8:49101454-49101476 CTGGTGGGATTGACAATTGCGGG - Intergenic
1042042836 8:64612163-64612185 GAGGTAGGATTTAGAACTGCGGG - Intronic
1042101253 8:65277942-65277964 CTAACATGATTTAGAATTGCTGG + Intergenic
1043290778 8:78597442-78597464 CTGAAAATATTTAGAATTGCTGG + Intronic
1045092950 8:98765979-98766001 CTGACAAGATTTAGAATTATTGG - Intronic
1048481404 8:134797635-134797657 CTGCTAAGATTTTGAATCACAGG + Intergenic
1054713444 9:68534180-68534202 CTGGTAAGATTTTGCATGGAGGG + Intergenic
1055020675 9:71666215-71666237 ATGGTAAGATTTGCAATTGATGG + Intergenic
1057561940 9:96134894-96134916 TTGGTTAGATTTACAAATGCAGG - Intergenic
1058639439 9:107068651-107068673 CTTGTAAGGTCTAGAACTGCAGG - Intergenic
1058736010 9:107894747-107894769 CTGTGAGGATTTAGAATTTCTGG + Intergenic
1060433005 9:123566487-123566509 GTGGCAAGAGTTAGAATTCCAGG + Intronic
1062652583 9:137585827-137585849 CTGGTAAGGTTTAGTGTTTCGGG - Intronic
1186305049 X:8247342-8247364 CTGTGAAGATACAGAATTGCAGG + Intergenic
1186326307 X:8481102-8481124 CTGGAAAGTTTCAGAAGTGCAGG - Intergenic
1188397189 X:29699599-29699621 CTGGGAAAATTTGGAATTTCTGG - Intronic
1188907996 X:35811230-35811252 GTGATAAGATTTAGGAGTGCTGG + Intergenic
1188934509 X:36157390-36157412 TTGCTAAGATTTAGCATTACTGG + Intergenic
1192474964 X:71432632-71432654 CTGGAAAGATTGGGAATTGAGGG + Intronic
1193967598 X:88007586-88007608 CTGGAAAAATTTAGAAGAGCAGG - Intergenic
1194336006 X:92646870-92646892 TTGCTAAGATTTAAAATTCCTGG + Intergenic
1194368223 X:93035704-93035726 AGGGTAAAATCTAGAATTGCGGG - Intergenic
1195501091 X:105600763-105600785 CTACTAAGAAGTAGAATTGCTGG + Intronic
1196038109 X:111169411-111169433 CTTGTAAGAATTAGAACTGAAGG - Intronic
1198268693 X:135033666-135033688 CTGGTAAGATCTCCATTTGCAGG - Intergenic
1198884341 X:141317627-141317649 CAGGTAAGCTTTAGTAATGCTGG - Intergenic
1199532226 X:148862677-148862699 CTGGCAAGAACTAGAATTTCTGG + Intronic
1200644438 Y:5763619-5763641 TTGCTAAGATTTAAAATTCCTGG + Intergenic
1202098666 Y:21281871-21281893 CTGGAAAGATGCAGAATTCCTGG + Intergenic