ID: 1182750490

View in Genome Browser
Species Human (GRCh38)
Location 22:32637973-32637995
Sequence CTGAACTACTAAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182750490_1182750494 22 Left 1182750490 22:32637973-32637995 CCCTCTTCCCTTTAGTAGTTCAG 0: 1
1: 0
2: 1
3: 43
4: 343
Right 1182750494 22:32638018-32638040 GTCCGTGAGTACTTCATGTTAGG 0: 1
1: 0
2: 1
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182750490 Original CRISPR CTGAACTACTAAAGGGAAGA GGG (reversed) Intronic
901346639 1:8550213-8550235 ATGAAGTACTCAAGGGCAGACGG + Intronic
903519215 1:23934758-23934780 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
907091709 1:51731103-51731125 CTGAACTAGAAAAGGTAATACGG - Intronic
907471017 1:54673507-54673529 CTGACAGACTATAGGGAAGAAGG - Intronic
907829784 1:58053746-58053768 CATAACTAGGAAAGGGAAGAAGG - Intronic
908589769 1:65617868-65617890 ATAACCTACTAAAGGGAATAAGG - Intronic
910740445 1:90509929-90509951 CTGAACAATTAAAGGAAAGATGG + Intergenic
911519606 1:98912679-98912701 TTCAATTACTAAAAGGAAGAAGG + Intronic
912664432 1:111566474-111566496 CTGAGCTCCTAAAGGGATGCGGG + Intronic
912901251 1:113651895-113651917 CTGAGCTACTAAAGGAAAGTAGG + Intronic
913063462 1:115228635-115228657 CTGCCCAAATAAAGGGAAGAAGG - Intergenic
913292024 1:117282759-117282781 CTCCTCTACTCAAGGGAAGAAGG + Intergenic
913292072 1:117283197-117283219 CTGAGACACTAAAGGCAAGATGG + Intergenic
914960774 1:152204480-152204502 GTGATCTACTAAAAGGAAGATGG - Intergenic
917097995 1:171418804-171418826 CTGAACTCCAAAAGGGAGGAGGG + Intergenic
917530767 1:175833060-175833082 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
917602579 1:176592452-176592474 TTGAAATACTAAATAGAAGATGG - Intronic
918187754 1:182142989-182143011 CTGAATTCCTAAGGGGAGGAAGG + Intergenic
919643033 1:200064173-200064195 CTTAACTTGTAAAGTGAAGACGG - Intronic
920692899 1:208160191-208160213 TTGTACTAATGAAGGGAAGAAGG - Intronic
921876957 1:220208310-220208332 TTGAACTATTAAAGGAAACAAGG - Intronic
922035969 1:221848474-221848496 CTGAATTACAAGAAGGAAGACGG + Intergenic
922337385 1:224628784-224628806 CTGAATTCCAAAAGGGAGGAGGG - Intronic
922691524 1:227696005-227696027 CTGGACTTCCAAAGGAAAGATGG - Intergenic
922865988 1:228861962-228861984 CAGGATTACGAAAGGGAAGAGGG + Intergenic
923128057 1:231049476-231049498 CTGTAGTACTAAAGGGTATATGG - Intergenic
1063733575 10:8725982-8726004 CTGGACTTCAAAAGGGAAGAGGG + Intergenic
1064799745 10:19055836-19055858 GGGGACTACTGAAGGGAAGAGGG + Intronic
1065012510 10:21432371-21432393 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1065131763 10:22628892-22628914 CTGAATTCCAAAAGGGAAAATGG + Intronic
1065460938 10:25963611-25963633 GTGAACTGCCAAAGGGAAGAAGG - Intronic
1065602143 10:27379907-27379929 CTGGACTACTAGAGGGTGGAGGG - Intergenic
1065838848 10:29683448-29683470 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1066114665 10:32228972-32228994 ATAAACTACTAAATGGAAAATGG - Intergenic
1066700646 10:38124280-38124302 CTGAACTTATAGAGGGTAGAAGG + Exonic
1067154579 10:43767126-43767148 GTGGACTACTAGAGGGAGGAAGG + Intergenic
1068714505 10:60173659-60173681 CAGAAACACTAAAAGGAAGAGGG + Intronic
1069543218 10:69311220-69311242 CTGAATTCCAAAAGGGATGAAGG + Intronic
1069645696 10:69994520-69994542 TTTAACCACTAAAAGGAAGAAGG + Intergenic
1070369667 10:75770513-75770535 AAGAACTGCTATAGGGAAGAAGG - Intronic
1071959463 10:90796080-90796102 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1071970450 10:90900709-90900731 ATGAACTATAAAAGGGAAGAAGG - Intronic
1072588145 10:96800537-96800559 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1072642683 10:97224212-97224234 CTAAACAAATAAAGGAAAGAAGG + Exonic
1072723065 10:97792567-97792589 CTGACATTCTAAAGGGAAGCTGG + Intergenic
1073229494 10:101956412-101956434 CTGAATTCCTAAAGGCAAAAAGG + Intronic
1073360491 10:102894584-102894606 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1074414428 10:113254837-113254859 CTGAAAAACTAAAGCCAAGAGGG + Intergenic
1076127743 10:127988665-127988687 GGGAACTCCAAAAGGGAAGAGGG + Intronic
1076270844 10:129150748-129150770 CTGAAATCCAAAAGGGAGGAGGG - Intergenic
1076977336 11:184251-184273 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1077164212 11:1127838-1127860 CTGAAATACTGAAAGGAGGAAGG + Intergenic
1079742548 11:24081123-24081145 ATGCACTACTAAAGGCAAGAGGG - Intergenic
1080881700 11:36327320-36327342 CTGAAATTCCAAAGGGAGGAGGG - Intronic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1083129266 11:60608506-60608528 CTGATCTACTAAGGGAAAAATGG - Intergenic
1083389772 11:62339351-62339373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1083513831 11:63237179-63237201 GTGGACTACTAGAGGGAGGAAGG + Intronic
1084095704 11:66909732-66909754 CTGAACTAGTGATGGGAGGAGGG + Intronic
1086313992 11:85569980-85570002 GCAAACTACTAGAGGGAAGAGGG + Intronic
1086396857 11:86424110-86424132 CTGAAATACAAAAGCTAAGAAGG + Intergenic
1088313764 11:108486918-108486940 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1088458359 11:110056658-110056680 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1089633542 11:119797883-119797905 CTGACTTCCCAAAGGGAAGATGG - Intergenic
1089714662 11:120346763-120346785 CTGGAGTAATAAAGGGAACAAGG - Intronic
1090046493 11:123339739-123339761 GGGAACTACTAGAGGGAGGAGGG + Intergenic
1090096961 11:123751911-123751933 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1090185281 11:124735004-124735026 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1090377174 11:126298996-126299018 CTGCCCTACTAAAGGAGAGAAGG - Intronic
1090698080 11:129268938-129268960 CTGAGCTACTCAAGGGGTGAGGG - Intronic
1091104254 11:132903554-132903576 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1091989901 12:4946869-4946891 CTGCACTAGTGATGGGAAGAAGG - Intergenic
1093623747 12:21322710-21322732 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1094262283 12:28514855-28514877 GTGACCTACTAGAGGGTAGAGGG + Intronic
1095132167 12:38556405-38556427 CTCAACCACTAAAGGCAAGGTGG - Intergenic
1096556725 12:52408403-52408425 CTGCACTGCCAAAGTGAAGACGG - Intergenic
1098831110 12:75364186-75364208 CTGAATTACAAAAGGGAGGAAGG + Intronic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1101477746 12:105066503-105066525 GGGAACTACTGAAGGGTAGAGGG + Intronic
1102353359 12:112211600-112211622 ATGAGCTACCCAAGGGAAGATGG + Intronic
1104277297 12:127341417-127341439 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1104287815 12:127441189-127441211 CTGAACTCCTAGAAGGAAAATGG + Intergenic
1105604878 13:21919090-21919112 CCAAAGTCCTAAAGGGAAGAGGG - Intergenic
1105774247 13:23642181-23642203 CTCAAGTACTAAAGTTAAGAAGG - Intronic
1106114695 13:26807106-26807128 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1106183348 13:27386817-27386839 ATGAACTGCTAATGGCAAGATGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106726215 13:32488396-32488418 GTGGACTACTAGAGGGTAGAGGG + Intronic
1106764737 13:32902574-32902596 CACAACTAGTAAAGGGAACAAGG - Intergenic
1106841895 13:33692765-33692787 CTGAATTCCAAAAGAGAAGAGGG + Intergenic
1108248422 13:48540865-48540887 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1108496731 13:51033028-51033050 GTGAACTACTCAAGGGTAGAGGG - Intergenic
1108968760 13:56344938-56344960 CTGAACTACTAGAGTGTGGAGGG + Intergenic
1110376951 13:74804714-74804736 CTGAACCACCAAAGGCAAGGTGG + Intergenic
1110641554 13:77830280-77830302 CTAAACCACTTAAGGAAAGAGGG - Intergenic
1111683784 13:91476730-91476752 ATGACCTACTAAAGGGCAAATGG + Intronic
1113842226 13:113366593-113366615 CTGAATTCCTGAAGGGAGGAGGG - Intergenic
1114080089 14:19196271-19196293 CTGAATTCTGAAAGGGAAGAGGG - Intergenic
1114237904 14:20838174-20838196 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1114441617 14:22752795-22752817 CTGAATTCCAAAAGGGAAGAGGG + Intergenic
1114445805 14:22787044-22787066 TTGAACTAATAAAATGAAGAAGG - Intronic
1114940671 14:27606603-27606625 CTGAACTCCAAAAGGGAGAAGGG - Intergenic
1115808785 14:37082221-37082243 CTGGACTACTAGAGGGTAGGGGG + Intronic
1116812497 14:49552887-49552909 CTAAACTCCAAAAGGGAGGAGGG - Intergenic
1116872966 14:50085038-50085060 CAAATCTACTCAAGGGAAGAGGG + Intronic
1118344127 14:64922657-64922679 CTTAACTACTAAAAGGGAAAAGG - Intronic
1118704357 14:68466795-68466817 GTTATTTACTAAAGGGAAGAAGG + Intronic
1119176290 14:72569756-72569778 CTGAGCTAAGCAAGGGAAGATGG - Intergenic
1119537656 14:75416058-75416080 CTTGACTACTTAAGAGAAGAAGG - Intergenic
1119793509 14:77376074-77376096 TTGAAATACGAAAGGGTAGAGGG - Intronic
1120397483 14:83986141-83986163 ATGACCTACTTCAGGGAAGAAGG - Intergenic
1120446651 14:84606683-84606705 TTGAACTGGTAAAAGGAAGAAGG - Intergenic
1124075945 15:26444309-26444331 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1126674817 15:51151732-51151754 AAGAACTACTAGAGGGAGGAGGG + Intergenic
1127435086 15:58949433-58949455 CTGAAATACTGAAGCGAAGAAGG + Intronic
1128234029 15:66054889-66054911 ATGAAATACAAAAGGGAAGAAGG + Intronic
1129075969 15:72996438-72996460 CTGAGCTACAGAAGGGAATAGGG + Intergenic
1131406017 15:92165284-92165306 GTTAACTACTAAAGGGGAGATGG + Exonic
1135626233 16:23997216-23997238 CTGGACTACTAAGGGGAAATTGG + Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136281489 16:29214445-29214467 CTGAACTATTAAAAGAAAGCTGG + Intergenic
1137943421 16:52710859-52710881 CTGGACCGCTCAAGGGAAGACGG + Intergenic
1138236825 16:55390588-55390610 CTGATCTATTAAAGTGAAGATGG - Intronic
1138600472 16:58051246-58051268 CTGAATTCCAAAAGGGAAAAGGG + Intergenic
1140280865 16:73554449-73554471 CTGAAGTGCTGAAGGCAAGATGG - Intergenic
1141241168 16:82266599-82266621 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1142085858 16:88180372-88180394 CTGAACTATTAAAAGAAAGCTGG + Intergenic
1142442916 16:90112431-90112453 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1142464787 17:128961-128983 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1142934302 17:3314845-3314867 GTGAACTACTAAAAAGAGGAGGG - Intergenic
1143322595 17:6077818-6077840 CTGTATAACTGAAGGGAAGAGGG - Intronic
1143336757 17:6177259-6177281 CAGAAAGACTCAAGGGAAGAAGG + Intergenic
1143985905 17:10913820-10913842 CTGAACTACTTGAAGGAAAAGGG + Intergenic
1145223363 17:21107304-21107326 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1148978559 17:51550727-51550749 CTGAATCACTAAAGGGAGGAAGG + Intergenic
1149091717 17:52790920-52790942 ATTAACTGCTACAGGGAAGAAGG - Intergenic
1149236237 17:54594018-54594040 CTCAACCACCAAAGGGAAGGTGG - Intergenic
1149351478 17:55792403-55792425 CTGAAATATTAAAAGTAAGAAGG + Intronic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1150543595 17:66129824-66129846 CTGAAATACAAAAGGGAAAAAGG + Intronic
1150590606 17:66558925-66558947 CTGCCCTACTAAAGGCAAAACGG + Intronic
1151198805 17:72452673-72452695 CTGAGCAACCACAGGGAAGAAGG + Intergenic
1152746329 17:82041442-82041464 CACAACTACCAAAGGGAAGCGGG + Intergenic
1152749612 17:82056614-82056636 CTGAAATACTGCAGGGCAGAGGG - Exonic
1152823902 17:82451691-82451713 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1153353454 18:4108133-4108155 ATGACCTACTTCAGGGAAGAAGG - Intronic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1154373932 18:13793239-13793261 CTGAAATCCAAAAGGGAGGAGGG - Intergenic
1155514058 18:26606266-26606288 CTGAATTTCAAAAGGGAGGAGGG + Intronic
1155804331 18:30146792-30146814 CAGAACTACTAAAAGAAAGGTGG + Intergenic
1156127926 18:33930334-33930356 CTGGACTAATAAAGGTAAGATGG + Intronic
1156963964 18:43067767-43067789 CTGAATTCCAAAAGGGAGGAAGG + Intronic
1157170928 18:45404439-45404461 CTTCATTACTAATGGGAAGAAGG - Intronic
1157938884 18:51904038-51904060 CTGAACCACTGAATGAAAGAGGG - Intergenic
1159611063 18:70526182-70526204 CTGAACCACTGGAGAGAAGACGG + Intergenic
1162256335 19:9493046-9493068 CTCAACTACCAAAGGGAAACTGG + Intronic
1162438174 19:10675877-10675899 ATCAACTACTAAAGGGCAAAAGG + Intronic
1163060877 19:14760760-14760782 CTCAACTCCAAAAGGGAGGAGGG - Intronic
1164501962 19:28827708-28827730 CTGAGCTACGAAAGGCAAGTAGG - Intergenic
1164763571 19:30745999-30746021 CTGAACAGCCAAAGAGAAGATGG - Intergenic
1165874391 19:38995628-38995650 CACTACAACTAAAGGGAAGAAGG + Intronic
1167201101 19:48066137-48066159 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1167980158 19:53269310-53269332 CTGAGCTACTAAAGAGAAATGGG - Intergenic
1168227600 19:55007507-55007529 TTGAAAAACTAAAGGGAATAAGG + Intergenic
925489077 2:4371883-4371905 CTGAAACACTAAGGGGACGATGG - Intergenic
925644325 2:6020658-6020680 CTGCCCTTCTAATGGGAAGACGG + Intergenic
925811113 2:7701808-7701830 CTGAACTCCAAAAGGGAGGGGGG - Intergenic
926298178 2:11583240-11583262 CTGAACGACCAAAGGGGACAGGG - Intronic
927628145 2:24745785-24745807 CAGAACTATAAAAGGGAACATGG - Intronic
928722449 2:34135253-34135275 CTTAAGTACTAACGCGAAGAGGG - Intergenic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
929906695 2:46052151-46052173 CTCAACTACTGGAAGGAAGAAGG - Intronic
930034880 2:47079097-47079119 CTGAAGTATTAAGGGGAACAGGG - Intronic
931092161 2:58897863-58897885 CAGAACTGCCAAACGGAAGAAGG - Intergenic
931446007 2:62327877-62327899 CTGAGCTACAGAAGGGAACAGGG + Intergenic
931654559 2:64499205-64499227 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
935242036 2:101187266-101187288 CTGAACTTCATAAGGGAGGAGGG + Intronic
935564550 2:104592040-104592062 CTCAACCATTAAAGGCAAGATGG - Intergenic
935999442 2:108811767-108811789 AGGGACTACAAAAGGGAAGAGGG - Intronic
936114782 2:109692996-109693018 CTGAATTCCAAAAGGGCAGACGG - Intergenic
936768694 2:115885470-115885492 CTCAACTACTAAAGGAAACAAGG - Intergenic
937770545 2:125715633-125715655 GTGAACTACTAGAGGGGAGAGGG + Intergenic
938201982 2:129379689-129379711 CTGGCCCACTAAAGGGAAGTGGG + Intergenic
938227920 2:129633546-129633568 CTGAACAAATAAAGGTAAAATGG - Intergenic
938613020 2:132968885-132968907 CTGAAGAACTAAAAAGAAGAGGG + Intronic
938966457 2:136392995-136393017 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
939326426 2:140695769-140695791 GTGAACTTCCAAAGGGTAGAAGG + Intronic
939519939 2:143217503-143217525 CTGAACTCTTCAAGGGAAGGTGG - Intronic
939645774 2:144697107-144697129 GGGAACTACTAGAGGCAAGAGGG - Intergenic
941852557 2:170198530-170198552 CTGAACTGCTGAATGGTAGAAGG - Intronic
942605040 2:177681747-177681769 CTGAATTCCAAAAGGGAGGAAGG - Intronic
943079656 2:183242966-183242988 CTGAATGACTAAAGGGAGCACGG + Intergenic
943370434 2:187009638-187009660 CTGAACTAATAAAATGAAGAAGG - Intergenic
943657250 2:190522611-190522633 CTGAATTCCAAAAGGGAGGAGGG - Intronic
943748054 2:191482911-191482933 CTGAGCTACAAGAGGAAAGATGG + Intergenic
944088028 2:195871686-195871708 TTAAACTACTTAAGGGAAGGCGG + Intronic
944335813 2:198532935-198532957 TTGAGCTATCAAAGGGAAGAAGG - Intronic
944626002 2:201569469-201569491 CTCAACTACCAAAGGCAAGGTGG - Intronic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
945394681 2:209304199-209304221 CTGAAAAACTAAATGGAATAAGG - Intergenic
946955496 2:224925432-224925454 CTGACCTACTAATATGAAGATGG + Intronic
948494057 2:238334330-238334352 CAGAACTACTGAAATGAAGATGG - Intronic
1168819759 20:764951-764973 CTGAGCTACAAAAGGGAATAGGG - Intronic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1170991722 20:21307711-21307733 AGGAACTACAAAAGGGCAGAAGG - Intronic
1171293793 20:23998781-23998803 CTGACCTACTGTGGGGAAGAGGG + Intergenic
1171724836 20:28606895-28606917 CGGGACTACTAGAGGGGAGAAGG + Intergenic
1171753227 20:29076155-29076177 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1171789027 20:29501405-29501427 CAGGACTACTAGAGGGGAGAAGG + Intergenic
1171858501 20:30373093-30373115 CAGGACTACTAGAGGGGAGAAGG - Intergenic
1173469027 20:43308323-43308345 CTGAACTTCTTAAGGGGAGGAGG + Intergenic
1174839278 20:53886362-53886384 TTGAATTACAAAAGGGAGGAGGG - Intergenic
1174888591 20:54364034-54364056 CTGAATTTCAAAAGGGAGGAGGG - Intergenic
1177193014 21:17872653-17872675 CTCAACCACCAAAGGCAAGATGG - Intergenic
1178513101 21:33223542-33223564 CTGAATTCCACAAGGGAAGAGGG + Intergenic
1178570597 21:33732298-33732320 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178814461 21:35915296-35915318 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178897385 21:36570351-36570373 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1178928394 21:36794796-36794818 CTGAGCTCCTGAAAGGAAGATGG + Intronic
1180500685 22:15926429-15926451 CTGAATTCTGAAAGGGAAGAGGG + Intergenic
1181344011 22:22203832-22203854 CTGAACTACTAGAGGGAGGCTGG + Intergenic
1182455440 22:30447532-30447554 CTGAATTCCGAAAGGGAGGAGGG + Intergenic
1182750490 22:32637973-32637995 CTGAACTACTAAAGGGAAGAGGG - Intronic
1183487306 22:38095848-38095870 CTAAATTAATAAAGGGAAAAGGG + Intronic
949976687 3:9467298-9467320 CTTAAGTGCTAAGGGGAAGAAGG + Intronic
950906007 3:16538894-16538916 CAGAACTCAGAAAGGGAAGAAGG + Intergenic
951304463 3:21041323-21041345 CTGAACAGTTAAAGGGCAGACGG + Intergenic
951509190 3:23482585-23482607 CTGATGGACTAAAGGAAAGAAGG + Intronic
951571286 3:24065872-24065894 CTCAACTGCCAAAGGCAAGATGG - Intergenic
952688004 3:36171956-36171978 CTGAATTACAAAAAGGAGGAGGG + Intergenic
953422333 3:42764229-42764251 CTGAATTCCAAAAGGGAGGAGGG + Intronic
953842809 3:46403461-46403483 ATGAACTACTAAAGGGGGTAAGG + Intergenic
954895321 3:53970261-53970283 CTGGACTGCTCCAGGGAAGATGG - Intergenic
954923502 3:54212601-54212623 CTGAATTCCAAAAGGGAGGAGGG + Intronic
957363155 3:79184922-79184944 CTCCACTACTCAAGGAAAGAAGG - Intronic
958712677 3:97737139-97737161 CTGGACTTCTTTAGGGAAGATGG - Intronic
960366062 3:116774128-116774150 CTGCTATATTAAAGGGAAGAAGG + Intronic
960541030 3:118863366-118863388 CTGAACTAATAAAGGCAGCAGGG - Intergenic
963367266 3:144352173-144352195 CTGAGCAGCAAAAGGGAAGACGG - Intergenic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
964984539 3:162723486-162723508 CTGAAAAACTAAACGGAATAAGG + Intergenic
965063712 3:163816050-163816072 GAGGACTACTAAAAGGAAGAGGG + Intergenic
965764710 3:172118304-172118326 TTGAACTACTGAATGCAAGACGG - Intronic
966237072 3:177713717-177713739 CTGAATCATTAAAGGGAAGGGGG - Intergenic
966701442 3:182857007-182857029 CTTACCTAATAAAGAGAAGAGGG + Intronic
966929241 3:184665087-184665109 GGGAACTAATAAAGGGCAGAAGG + Intronic
967192446 3:186996614-186996636 CTGAAGTAGCAAAGGCAAGAAGG + Intronic
968363188 3:198163391-198163413 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
970986680 4:22166909-22166931 GTGGACTACTAGAGGGTAGAGGG - Intergenic
972155142 4:36151696-36151718 CTGAATTACTAAAGGTAAAGTGG + Intronic
972367481 4:38390056-38390078 CTGCTCTTCTAAAGGGAATAGGG - Intergenic
972865434 4:43226550-43226572 GTGGACTACTAGAGGGGAGAGGG + Intergenic
974441225 4:61920735-61920757 CTAATCTTCTAAAAGGAAGAAGG + Intronic
974476755 4:62391845-62391867 CTGACCTATTAAAGGAAAGAAGG - Intergenic
974679401 4:65141695-65141717 CTGGACTACTGAAGGGAATTTGG - Intergenic
974705034 4:65503102-65503124 AGGCACTACTAGAGGGAAGAAGG + Intronic
975098631 4:70486850-70486872 CTGGACTACTAAGGGGAAGTTGG - Intergenic
976302058 4:83524662-83524684 CTGAGCTACTGAAGGGAATACGG - Intergenic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
977472859 4:97463900-97463922 CTGATCTACTAAATGTAATATGG - Intronic
977861231 4:101962590-101962612 CAGAACTAGTAAAAGAAAGAAGG - Intronic
978423044 4:108554253-108554275 CTGAATTCCAAAAGGGAGGACGG - Intergenic
978628435 4:110714679-110714701 GTGGACTACTAAAGTGAGGAGGG + Intergenic
979583973 4:122392544-122392566 GTGGACTACTAAAGGGTGGAGGG + Intronic
979805814 4:124969638-124969660 GTGGACTACTAGAGAGAAGAGGG - Intergenic
982001144 4:151022378-151022400 CTGAACAAATAAAAGGAATATGG - Intergenic
982449322 4:155533246-155533268 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
982819594 4:159928931-159928953 GTGGACTACTAGAGGGGAGAGGG - Intergenic
983308062 4:166019292-166019314 GTGGACTACTAGAGGGGAGAGGG + Intronic
983934495 4:173491776-173491798 CTAAACTACTTAAGGTAAGATGG - Intergenic
985196787 4:187438893-187438915 GGGGACTAATAAAGGGAAGAAGG + Intergenic
985436637 4:189936814-189936836 CGGGACTACTAGAGGGGAGAAGG - Intergenic
985504207 5:269678-269700 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
987542289 5:19271160-19271182 CTGAATTCCAAAAGGGAGGAAGG + Intergenic
989118883 5:37983576-37983598 CTGAATTCCTAAAAGGAACAGGG - Intergenic
989564045 5:42883802-42883824 CTGAATTCTAAAAGGGAAGAGGG - Intronic
990831891 5:59968416-59968438 ATGGACTACTAGAGGGTAGAGGG + Intronic
992036211 5:72780336-72780358 TTGAACTAAGAAATGGAAGAGGG + Intergenic
992058857 5:73021462-73021484 CTAAAGTACTAAAGGAAAAAAGG - Intronic
992583667 5:78209243-78209265 CTGAATTCCAAAAGGGAGGAGGG - Intronic
994853053 5:105081406-105081428 GTGAACTATTAAATGGAGGAAGG + Intergenic
995580713 5:113599042-113599064 CTTAACAACTAATGGTAAGACGG + Intergenic
995657281 5:114440657-114440679 CTGCACTACTCAGGGGAAGTGGG + Intronic
997174446 5:131760076-131760098 GTGGACTACTAGAGGGAAGAGGG + Intronic
998603271 5:143606606-143606628 CTGAAGTATGAAAGGGAATATGG - Intergenic
1000763416 5:165254814-165254836 CTGAAATAATAAAGGGAGGAAGG - Intergenic
1001282629 5:170398116-170398138 CTGAAATCCAAAAGGGAGGAGGG + Intronic
1001388225 5:171357538-171357560 CTTAACTACCAAAGGCAAGGTGG + Intergenic
1001697486 5:173682799-173682821 TTGCACAACTCAAGGGAAGAAGG - Intergenic
1002347074 5:178555582-178555604 CTGCACTAATAAAGCGAAAAAGG - Intronic
1003277840 6:4667393-4667415 CTGAATTTCTAATGGGTAGAAGG + Intergenic
1003394409 6:5740955-5740977 TGGATCTACTAAAGGGAAAATGG + Intronic
1004200879 6:13546803-13546825 CTGAATTACAAAAGGGAGGAGGG - Intergenic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006993786 6:38238893-38238915 CTGAATTCTAAAAGGGAAGAGGG + Intronic
1007249375 6:40485377-40485399 TTGAACTACTGAAGGGATTATGG - Intronic
1008730264 6:54473579-54473601 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1010457166 6:76069969-76069991 TGGGACTACTAGAGGGAAGAGGG + Intronic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1011188971 6:84710832-84710854 CTGGATTACTAAAGGATAGAGGG - Intronic
1011948014 6:92931477-92931499 CTAAACTAATAAAGCTAAGATGG + Intergenic
1012205797 6:96458911-96458933 CTGAATTCCAAAAGGGACGAGGG + Intergenic
1012435813 6:99214314-99214336 GGGGACTACTAGAGGGAAGAGGG + Intergenic
1013479278 6:110539285-110539307 GTGGACTACTAGAGGGAGGAGGG - Intergenic
1016052679 6:139546643-139546665 TAGAACTACTCAAGGGGAGAAGG + Intergenic
1016284316 6:142455816-142455838 CTCAAATACAAAAGAGAAGATGG + Intergenic
1017580660 6:155861034-155861056 GTGGACTACTAAAGGAGAGAGGG - Intergenic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1018433229 6:163739948-163739970 CAGAACTACTAAGAGAAAGAAGG - Intergenic
1019252492 7:25320-25342 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1019829216 7:3309934-3309956 CTGAACTACTTAAGAAAAAAAGG + Intronic
1019868163 7:3732480-3732502 CCGAACTATTAAAGAGATGATGG - Intronic
1020808436 7:12820908-12820930 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1022455368 7:30553925-30553947 ATAAACTGATAAAGGGAAGAAGG - Intergenic
1022985448 7:35649861-35649883 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1023305983 7:38827445-38827467 CTGAACTTTTCAAGGCAAGAGGG - Intronic
1023775435 7:43601638-43601660 ATTAACTACTAAAGAGGAGAAGG - Intronic
1024191603 7:47017175-47017197 CTGAATAACAAAAGGGAAGATGG + Intergenic
1024726640 7:52204411-52204433 CCCAGCTACTCAAGGGAAGATGG - Intergenic
1024790838 7:52963476-52963498 CTGAACAGCAAAAGGGAAGCGGG + Intergenic
1026606435 7:71819996-71820018 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1027479723 7:78680797-78680819 CTGAAAGACTATATGGAAGAAGG - Intronic
1029064983 7:97840439-97840461 ATGATCTACTCCAGGGAAGAAGG - Intergenic
1031487922 7:122352001-122352023 CTGAACTACTCAAGGGGACAAGG + Intronic
1031806178 7:126309134-126309156 CTGGACAACTAATGGAAAGATGG + Intergenic
1032593830 7:133218915-133218937 AGGAACTACTAGAGGGAGGAGGG - Intergenic
1032878602 7:136064887-136064909 TTGAACAACTTAAGGGAAGAAGG + Intergenic
1036278912 8:7381732-7381754 GTGAACTACTAGAGGGTGGAGGG + Intronic
1036342608 8:7930134-7930156 GTGAACTACTAGAGGGTGGAGGG - Intronic
1036455087 8:8899565-8899587 CTGAACTCCTGAAGGGTAAAGGG - Intergenic
1037098358 8:15013523-15013545 CTGAAGGAATAAAGGGAAGGAGG - Intronic
1038739506 8:30204578-30204600 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1039223930 8:35366716-35366738 CTAAATTACTCAGGGGAAGAAGG - Intronic
1039722202 8:40176245-40176267 CTGAATTCCAAAAGGGAGGAAGG - Intergenic
1039910256 8:41820842-41820864 CTGAGCTACACAAAGGAAGAGGG + Intronic
1040949968 8:52928361-52928383 CTTAACTACTTGAGGCAAGAAGG - Intergenic
1041185716 8:55298872-55298894 CTGAATTATTAAAGGGTAAATGG - Intronic
1041990490 8:63984119-63984141 CTAAAGTATTAAAGGAAAGAAGG - Intergenic
1042933487 8:74035610-74035632 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1043716040 8:83488109-83488131 CTGAATTTCAAAAGGGAAAAGGG + Intergenic
1043751845 8:83946788-83946810 CTAAACTCTTAAAGGGAAGGGGG + Intergenic
1045237293 8:100364510-100364532 CTGAACTACTAAAGGACAGCTGG - Intronic
1045311877 8:101010068-101010090 CTGTACTGCTAAAGGGAGTAGGG + Intergenic
1045533523 8:103006085-103006107 CTGAATTCCAAAAGGGAGGATGG + Intergenic
1045881849 8:107050317-107050339 ATGCACCACTTAAGGGAAGAAGG - Intergenic
1046384642 8:113493603-113493625 CTCAACTACCAAAGGTAAGGTGG + Intergenic
1047152460 8:122279497-122279519 CTGAACAACAAAAGGGCATAAGG + Intergenic
1047253421 8:123197687-123197709 TTGCATCACTAAAGGGAAGAAGG + Intronic
1047649603 8:126905608-126905630 CTGAACTACAAAAAAGTAGACGG + Intergenic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1051749758 9:20328670-20328692 CCAAACTCCTAAAGGGAGGAAGG + Intergenic
1052074672 9:24126384-24126406 CTGAACTTCTCAGGGGAAGGGGG + Intergenic
1053724765 9:40988280-40988302 CGGGACTACTAGAGGGGAGAAGG - Intergenic
1054341207 9:63863719-63863741 CGGGACTACTAGAGGGGAGAAGG + Intergenic
1055449526 9:76418378-76418400 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1056995344 9:91452116-91452138 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1057167334 9:92939522-92939544 CTGAACTACAACAAGAAAGACGG - Intergenic
1057236897 9:93368264-93368286 CTCAACCACCAAAGGCAAGACGG - Intergenic
1057957125 9:99419246-99419268 CTGAAATACAAAAGGAAATAAGG + Intergenic
1058125494 9:101189464-101189486 CTGAATTCCAAAAGGGAGGAGGG + Intronic
1058784914 9:108377557-108377579 CTGAACTCCAAAAAGGAGGATGG + Intergenic
1059198621 9:112394356-112394378 CTGAACTACCTATGGAAAGAAGG + Intronic
1060161195 9:121366753-121366775 CTGGGCTACTACAGTGAAGAAGG + Intronic
1060866884 9:127007593-127007615 ATGAACTGGTAAAGGGGAGAAGG + Intronic
1062747875 9:138227051-138227073 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1203450042 Un_GL000219v1:103710-103732 CGGGACTACTAGAGGGGAGAAGG + Intergenic
1188164809 X:26848780-26848802 CTGAACTACAAAGAGGAAGCTGG - Intergenic
1188876209 X:35433555-35433577 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1189293260 X:39900912-39900934 CTGAAATGCTAAAGAGAAGCTGG + Intergenic
1189758752 X:44299286-44299308 CTGAATTCCAAAAGGGAGGAGGG - Intronic
1190362868 X:49665805-49665827 CTGGACTCTGAAAGGGAAGAGGG + Intergenic
1190809738 X:53871639-53871661 CTCAACCACGAAAGGCAAGATGG + Intergenic
1192325598 X:70129330-70129352 CTGAACTACAGAAAGGAATAGGG + Intergenic
1193847490 X:86492605-86492627 GGGGACTACTAGAGGGAAGAGGG - Intronic
1193959208 X:87902625-87902647 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1194164738 X:90501495-90501517 TTAAAGTTCTAAAGGGAAGATGG + Intergenic
1194237631 X:91403888-91403910 GTGTACTACTAGAGGGGAGAGGG + Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1195496446 X:105540514-105540536 GGGGACTACTAGAGGGAAGAGGG + Intronic
1196247989 X:113423488-113423510 CTGAGCTACAAAAAGGAATAGGG - Intergenic
1197351370 X:125387551-125387573 CTGAATTCCAAAAGGGAGGAGGG + Intergenic
1197534556 X:127671717-127671739 CTCAACTACCAAAGGTAAGATGG + Intergenic
1197576450 X:128218075-128218097 GTGGACTACTAGAGGGAGGATGG + Intergenic
1198701976 X:139406588-139406610 CTGAACTTCTTAAGTGAAGCTGG - Intergenic
1198826963 X:140708982-140709004 ATGAACTTATAAAGGGAGGATGG + Intergenic
1198934639 X:141893966-141893988 CTAAAATACTAAATGGAAGAGGG + Intronic
1200444904 Y:3248642-3248664 CTGAATTCCAAAAGGGAGGAGGG - Intergenic
1200510998 Y:4079289-4079311 TTAAAGTTCTAAAGGGAAGATGG + Intergenic