ID: 1182750490

View in Genome Browser
Species Human (GRCh38)
Location 22:32637973-32637995
Sequence CTGAACTACTAAAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182750490_1182750494 22 Left 1182750490 22:32637973-32637995 CCCTCTTCCCTTTAGTAGTTCAG No data
Right 1182750494 22:32638018-32638040 GTCCGTGAGTACTTCATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182750490 Original CRISPR CTGAACTACTAAAGGGAAGA GGG (reversed) Intronic
No off target data available for this crispr