ID: 1182751663

View in Genome Browser
Species Human (GRCh38)
Location 22:32646418-32646440
Sequence GCATCTGAGTCCCCCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182751659_1182751663 4 Left 1182751659 22:32646391-32646413 CCTTAGAAAAATCCACTTACATT No data
Right 1182751663 22:32646418-32646440 GCATCTGAGTCCCCCTGGGAAGG No data
1182751660_1182751663 -8 Left 1182751660 22:32646403-32646425 CCACTTACATTTCTTGCATCTGA No data
Right 1182751663 22:32646418-32646440 GCATCTGAGTCCCCCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182751663 Original CRISPR GCATCTGAGTCCCCCTGGGA AGG Intronic