ID: 1182752768

View in Genome Browser
Species Human (GRCh38)
Location 22:32654926-32654948
Sequence CAGCTCTTCTAGAGCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 382}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182752766_1182752768 23 Left 1182752766 22:32654880-32654902 CCTTTTGTAGTTACTTGTGTATA 0: 1
1: 0
2: 1
3: 29
4: 332
Right 1182752768 22:32654926-32654948 CAGCTCTTCTAGAGCAGGAAAGG 0: 1
1: 0
2: 3
3: 25
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182752768 Original CRISPR CAGCTCTTCTAGAGCAGGAA AGG Intronic
902397872 1:16142398-16142420 CAGCTCCTGAGGAGCAGGAATGG + Intronic
904875524 1:33651878-33651900 GAGCTTTTCTGTAGCAGGAATGG + Intronic
906135523 1:43497487-43497509 CAGAACTTCTAGACCACGAAAGG - Intergenic
906136777 1:43505590-43505612 CAGCTCTTCTCTAGCATGGATGG - Intergenic
906606969 1:47179593-47179615 GAGCTCCTCAAGGGCAGGAATGG - Intergenic
907003822 1:50890535-50890557 GAGCTCTTGTAGAGCAGGCTTGG + Intronic
908073791 1:60491951-60491973 GAGCTCTTTTAGGGCAGGGATGG - Intergenic
908907945 1:69038003-69038025 CAGCTCATTTATAGCAGGATAGG + Intergenic
910470463 1:87547281-87547303 CAGCTCAGCTATAGCAAGAAAGG - Intergenic
910474397 1:87591477-87591499 CAGCTATTATTGAGAAGGAAAGG - Intergenic
911013372 1:93305463-93305485 GAGCCCTCCTAGAGGAGGAAAGG + Intergenic
911475803 1:98370811-98370833 CTGATCATCTAGAGCAGGGATGG - Intergenic
911960893 1:104301353-104301375 CAGCTCAGCTACAGCAGGATAGG + Intergenic
914388364 1:147194681-147194703 GAGCTCTTTTAGAGCAGGCCTGG + Intronic
914403385 1:147344939-147344961 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
914408798 1:147404337-147404359 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
916203217 1:162291091-162291113 CCAATCTTCTAGAGCAGGAGGGG + Intronic
916726360 1:167527160-167527182 AAGCTCTTCAAGAGCATGGACGG + Intergenic
916895593 1:169158814-169158836 CAGCTGTTCTGGAGCAGGGGAGG + Intronic
917856975 1:179108879-179108901 CAGGGCTTCCAGAGCAGGATAGG - Exonic
920590055 1:207208707-207208729 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
920856451 1:209666476-209666498 ATGCTCTTCTAGAGATGGAAAGG + Intergenic
1062816964 10:507980-508002 CAGCTCTTCCTGACCAGGACAGG - Intronic
1067097905 10:43314511-43314533 CAGGCCTTCCAGAGCAGGATGGG + Intergenic
1070493807 10:77002586-77002608 TAGCTCTTCTAAAGCTGGTATGG + Intronic
1071127053 10:82348241-82348263 CAGCTCTTTTAGGGCAGGCCTGG + Intronic
1071215313 10:83393987-83394009 CAGCTCAGCTACAGCAGGATAGG - Intergenic
1071555838 10:86600710-86600732 CAGCTCCTGTATTGCAGGAAAGG + Intergenic
1072013783 10:91326027-91326049 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1072807383 10:98432861-98432883 AACCACTGCTAGAGCAGGAAAGG - Intronic
1073025492 10:100484331-100484353 CAGCTCTTCTAGAGCAGAACTGG + Intergenic
1074179410 10:111045094-111045116 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
1074473276 10:113746409-113746431 CAGCTGTTCAGGAGCAGGCATGG - Intergenic
1075762835 10:124869928-124869950 CAGCAGTTTCAGAGCAGGAAAGG - Intergenic
1075904866 10:126072335-126072357 CAGCCCTTCTAGAGCACAGAAGG - Intronic
1076580728 10:131508737-131508759 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1077591685 11:3497127-3497149 GAGCTCTTGTAGGGCAGGACTGG + Intergenic
1078033890 11:7782299-7782321 GAGCTCTTGTAGGGCAGGTATGG - Intergenic
1078152706 11:8772941-8772963 CAGCTCTTCTTTAGGAGGAGGGG - Intronic
1078711624 11:13798002-13798024 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1079107227 11:17579282-17579304 CAGGGCTTCTAGGGTAGGAAGGG + Intronic
1079485381 11:20931101-20931123 GAGCTCCTCTAAAGCAGGGAAGG - Intronic
1079529277 11:21429862-21429884 CAGCTCTTTAAAGGCAGGAAAGG + Intronic
1080129097 11:28772272-28772294 CATTTCTTGTAGAGCAGGACTGG + Intergenic
1080363682 11:31545952-31545974 CAGCTCTTTTAGGGCAGGCCTGG - Intronic
1081172208 11:39882853-39882875 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1083400385 11:62419237-62419259 CAGCAGCTCCAGAGCAGGAATGG - Intronic
1083522862 11:63332251-63332273 CAGTTCTTGTAGGGCAGGCATGG + Intronic
1084318351 11:68358881-68358903 GAGCTCCACTAGTGCAGGAATGG - Intronic
1084825306 11:71725653-71725675 GAGCTCTTGTAGGGCAGGACTGG - Intergenic
1085967654 11:81548226-81548248 CTGCACTTCTAGAGCAGGGGTGG - Intergenic
1086030031 11:82343575-82343597 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
1086732625 11:90269237-90269259 GAGCTCTTCTAAAGCAGGCCTGG + Intergenic
1088442220 11:109883667-109883689 CAGCTTTTCTAAAGCAGCACAGG + Intergenic
1089168845 11:116498750-116498772 AAGCTCTTAGAGAGCAGGAAAGG - Intergenic
1089824695 11:121264704-121264726 CAGCTCAGCCACAGCAGGAAAGG - Intergenic
1090663151 11:128895812-128895834 CTGCTCTTATGGAGCAGGGAAGG + Intronic
1090724889 11:129516264-129516286 GAGCTCTTATAAAGCAGGACTGG + Intergenic
1090794700 11:130124756-130124778 CAGCTTTCCTGGAGCTGGAAGGG - Intronic
1093233126 12:16573664-16573686 CAGCTCGAGCAGAGCAGGAAGGG - Intronic
1094792409 12:33930204-33930226 GAGCTCTTGTAGAGCAGGCCTGG - Intergenic
1095373303 12:41495945-41495967 CAGCTCTGCAAGAGCACAAAGGG - Intronic
1095573666 12:43710318-43710340 CAGCTCAGCTACAGCAGGATAGG - Intergenic
1096611637 12:52805852-52805874 CAGGTCTTCTGGAGCAGGAGTGG - Intergenic
1096959366 12:55562304-55562326 GAGCTCTTTTAGAGCAGGCGTGG - Intergenic
1097583138 12:61482702-61482724 GAGCTCTTGTAAAGCAGGACTGG - Intergenic
1098068832 12:66649865-66649887 CTGCTCTTCCACAGAAGGAAAGG - Intronic
1098142961 12:67469469-67469491 CAGCTCAGCTACAGCAGGATAGG - Intergenic
1099268566 12:80479344-80479366 GAGCTCTTTTAGAGCAGGCCTGG - Intronic
1099795633 12:87395873-87395895 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1100360872 12:93878327-93878349 CAGCTCAGCCACAGCAGGAAAGG - Intronic
1100752033 12:97708925-97708947 GAGCTCTTTTAGGGCAGGACTGG + Intergenic
1100753242 12:97722455-97722477 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
1100753612 12:97725673-97725695 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
1101243095 12:102857792-102857814 GAGCTCTTGTAGGGCAGGCATGG - Intronic
1102970457 12:117162068-117162090 CAGCTCTTGGGGAGGAGGAAAGG + Intronic
1104461843 12:128962612-128962634 CCGCTCTTCAACAGCAGCAAGGG - Intronic
1105350986 13:19615915-19615937 GAGCTCTTGTAGAGCAGGCCTGG + Intergenic
1107316957 13:39143138-39143160 GAGTTCTTCTAGAGAAGCAAGGG + Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1107910755 13:45103727-45103749 CAGCTCATTTAGAGCTGTAAAGG - Intergenic
1108400303 13:50034857-50034879 TATCTCTTCTAGAGCAATAATGG - Intergenic
1110001675 13:70210673-70210695 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
1110512146 13:76363149-76363171 CAGCCCTGCTACAGGAGGAAAGG + Intergenic
1111917299 13:94374032-94374054 GAGCTCTTTTAGGGCAGGACTGG - Intronic
1112011028 13:95293993-95294015 GAGCTCTTTGAGAACAGGAATGG - Intronic
1112805477 13:103160066-103160088 CAGTTCTTCTCAAGCAGAAAAGG + Intergenic
1114801690 14:25783031-25783053 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1115127550 14:30014429-30014451 CAGCTCTACTGTAGGAGGAATGG + Intronic
1115620352 14:35134630-35134652 CAGCTCAGCTACAGCAGGATGGG - Intronic
1115827656 14:37295272-37295294 GAGCTCTTGTAGAGCAGGCATGG - Intronic
1115962270 14:38849008-38849030 CTGCACTTTTATAGCAGGAAGGG + Intergenic
1117597841 14:57342263-57342285 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1118539098 14:66802794-66802816 CAGCTCAGCCAGAGCAGGATAGG - Intronic
1120675556 14:87417729-87417751 GAGCTCTTCTAGGGCAGGCCTGG + Intergenic
1120778082 14:88459888-88459910 GAGCTCTTGTAGAGCAGGCCTGG + Intronic
1123225074 15:17015567-17015589 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1125331641 15:38588439-38588461 TAGCTCTGCTAAAGCAGGAAAGG + Intergenic
1126516710 15:49547247-49547269 GAGCTCTTCTAGGGCAGGCCTGG - Intronic
1126583620 15:50262644-50262666 CTGCTTTTCAAGAGCAAGAAGGG - Intronic
1126696043 15:51326310-51326332 AAGCTCTTCTAGAAAAAGAAAGG + Intronic
1129253225 15:74319898-74319920 CATCTCTGCTGCAGCAGGAAGGG + Intronic
1129678640 15:77645720-77645742 CAGCTCTTCTAAAGCGGGTCTGG - Intronic
1135174786 16:20218302-20218324 GAGCTGGGCTAGAGCAGGAAAGG - Intergenic
1137359752 16:47803236-47803258 CAGCTCTTTTCAAGCAAGAAAGG + Intergenic
1137876359 16:52000077-52000099 CAGCTCTTATAGACAAGGAGAGG + Intergenic
1137969790 16:52973752-52973774 GAGCTCTTGTAGAGCAGGCCTGG + Intergenic
1138324902 16:56156467-56156489 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
1138722520 16:59098361-59098383 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
1139588933 16:67922457-67922479 CAGTGCTTCTAGAGAAGGGATGG - Intronic
1142319488 16:89371841-89371863 GAGCTCTTCCACAGGAGGAAAGG + Intronic
1143109670 17:4545986-4546008 CAGCCCTTCTAAACCAGGCAAGG + Intronic
1143222853 17:5276886-5276908 CAGATTCTCAAGAGCAGGAAGGG - Intergenic
1144240896 17:13310440-13310462 CAGTTCTTCTTCAGCAGTAAGGG + Intergenic
1145901985 17:28495469-28495491 CTGTTCTTCAAGAGCAGGAAAGG + Intronic
1149059684 17:52408012-52408034 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1149160539 17:53687336-53687358 CAGGTCTGCAACAGCAGGAATGG + Intergenic
1149303977 17:55331109-55331131 CAGCACGTCTGGAACAGGAAGGG - Intergenic
1152381700 17:79945521-79945543 GAGCTGTTTTAGGGCAGGAAGGG + Intronic
1152732669 17:81980269-81980291 CAGGTCTTCAAGGGCAGGCATGG - Intronic
1153188951 18:2516968-2516990 AAGCACTTCCAGAGGAGGAACGG + Intergenic
1154261085 18:12833464-12833486 CAGGTCTTAGGGAGCAGGAAAGG + Intronic
1155878518 18:31116016-31116038 CAGATGTTCTAGATCAGCAAGGG + Intergenic
1156188730 18:34694203-34694225 AAGCTCTTCTAGGGAAGTAAAGG - Intronic
1156608419 18:38696845-38696867 CAACACTGCTAGAGCAGAAATGG + Intergenic
1157205695 18:45696416-45696438 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1159094253 18:63884670-63884692 CAGATCTTATAGAGGAGGAAAGG - Intronic
1159418939 18:68190274-68190296 CAGGACTACTAGAGCAGTAAGGG - Intergenic
1161939966 19:7396000-7396022 GGGCTCTACTAGAGCGGGAAGGG - Intronic
1162355420 19:10180562-10180584 TAGCCCTCCTACAGCAGGAAAGG + Exonic
1162562268 19:11423572-11423594 CAGTTCTCCTAGAGCTGGCATGG + Intronic
1162677228 19:12308212-12308234 CTGCTCTTGAAGTGCAGGAATGG + Intergenic
1163589202 19:18181699-18181721 CAGATCCTGTAGAGTAGGAAAGG - Intergenic
1163880967 19:19922117-19922139 GAGCTCTTGTAGAGCAGGCCTGG + Intronic
1164248440 19:23455922-23455944 CAGCTCTTGTAGCGCAGGCCTGG + Intergenic
1166239630 19:41481050-41481072 CAGCTGGTCTGGAGCAGGAGGGG + Intergenic
1166563458 19:43748611-43748633 CAGCTTTGCCAGAGCAGGAGGGG - Intronic
1202658563 1_KI270708v1_random:47703-47725 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
925537514 2:4933384-4933406 AATCTCTCCTAGAGGAGGAAAGG - Intergenic
925766509 2:7241481-7241503 CAGATCTTCCAGAGCAGGGCAGG + Intergenic
926600863 2:14844205-14844227 CAGCTCAGCCACAGCAGGAAAGG + Intergenic
927244067 2:20942697-20942719 CAGCTCTGCTGGAGAAGGAAGGG - Intergenic
928374662 2:30764811-30764833 GAGCTCTTAGAGGGCAGGAATGG - Intronic
928758965 2:34559488-34559510 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
928877884 2:36062484-36062506 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
929112259 2:38414798-38414820 AAGTTCTTCAAGATCAGGAATGG - Intergenic
929983437 2:46701376-46701398 CGTTTCTTCTAGAGCTGGAAGGG + Intronic
930114420 2:47706610-47706632 CAGAACCTCTAGAGCAGGAAGGG - Intronic
931210642 2:60190856-60190878 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932014382 2:68009621-68009643 CAGCCTTTCTAGATCATGAATGG + Intergenic
932284879 2:70523741-70523763 CAGCTCTCCTAAATCAGTAATGG - Intronic
932660344 2:73646378-73646400 GAGCTCTTGTAGGGCAGGCATGG + Intergenic
933185030 2:79269128-79269150 GAGCTCTTATACAGCATGAAAGG + Intronic
933197774 2:79411713-79411735 GAGCTCTTTTAGAGCAGGCCTGG - Intronic
933590469 2:84226700-84226722 GAGCTCTTTTAGGGCAGGCATGG - Intergenic
937715799 2:125030794-125030816 GAGCTCTTGTAGAGCAGGCCTGG + Intergenic
938167318 2:129042317-129042339 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
938202323 2:129383848-129383870 CACCTCTTCTAGAAAATGAAAGG - Intergenic
939019753 2:136945062-136945084 GAGCTCTTGTAGGGCAGGCATGG + Intronic
939653020 2:144787236-144787258 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
940796639 2:158087667-158087689 CAGCTCTTATAGAGCTGGCTTGG + Intronic
940808004 2:158209498-158209520 CAGGTCTTCCACAGCAGCAAAGG - Intronic
941260095 2:163286811-163286833 CATCCCTTCTAAAGCAAGAAGGG - Intergenic
942742692 2:179197777-179197799 GAGCTCTTCTAGGGCAGGCCTGG - Intronic
944446890 2:199801189-199801211 CAGCTCTTCCAGTGCAGGAACGG - Intronic
944657277 2:201888732-201888754 CAGCTCCTCAAAAGCAGGGAGGG - Intronic
945771225 2:214045196-214045218 CAGCTCTGCCAGAGTAGGATAGG + Intronic
946202636 2:218079849-218079871 CAGGTCTTCTAGAGCAGGCTGGG - Intronic
947897704 2:233691122-233691144 CAGTTCATCTAGAGGAAGAATGG - Intronic
948423508 2:237874576-237874598 CGGCTCTTCCAAAGCAGGAGGGG + Intronic
948489671 2:238304411-238304433 CTGATCCTCAAGAGCAGGAAGGG - Intergenic
948712046 2:239831335-239831357 CAGCTGGTCTAAAGCTGGAAAGG + Intergenic
948908582 2:240991718-240991740 CAGCTCCTCCAAAGCAGAAACGG - Intronic
1168901754 20:1370829-1370851 CAGCTCTCAAAGAACAGGAAAGG + Intronic
1169012224 20:2260170-2260192 CAGATATTCCAGAGCAGGGAGGG + Intergenic
1170600334 20:17836710-17836732 CAGCACTTGGAGAGCTGGAAAGG + Intergenic
1171454800 20:25262445-25262467 GAGCTCTTTTAGAGCAGGCCTGG - Intronic
1174188998 20:48726742-48726764 AAGCTTCTCTAGACCAGGAATGG - Intronic
1174928234 20:54784338-54784360 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1177138226 21:17329315-17329337 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
1179383389 21:40919968-40919990 CAGGGCTTCTATGGCAGGAAAGG + Intergenic
1180326033 22:11431221-11431243 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1181088355 22:20455412-20455434 CAGCTTTTCCTGAGCAGGAGAGG - Intronic
1181342131 22:22189795-22189817 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
1181806889 22:25380312-25380334 GAGCTCCACTAGTGCAGGAATGG + Intronic
1182752768 22:32654926-32654948 CAGCTCTTCTAGAGCAGGAAAGG + Intronic
949712820 3:6891406-6891428 GAGCTCTTTTAGAGCAGGCCTGG + Intronic
949717369 3:6949229-6949251 GAGCTCTTTTAGAGCAGGCCTGG + Intronic
949871141 3:8590114-8590136 CAGCTGTTCCAGATCAGGAAGGG + Intergenic
950597026 3:13993876-13993898 GAGCTCTTCTAGGGCAGGCCTGG + Intronic
951086472 3:18517912-18517934 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
951135595 3:19101503-19101525 GAGCTCTTCTAGGGCAGGCCTGG + Intergenic
951423074 3:22510564-22510586 TAGCTCAGCTAGAGCAGGATAGG + Intergenic
951592492 3:24281405-24281427 GAGCTCTTCTAGGGCAGGCCTGG - Intronic
952612502 3:35227765-35227787 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
954327630 3:49872229-49872251 TAGCTCTTCCAGGGCAGGGACGG + Intergenic
954973489 3:54671644-54671666 CAGCTGCTCCAGGGCAGGAATGG + Intronic
955135646 3:56214960-56214982 GAGCTCTTTTAGGGCAGGCATGG - Intronic
956320459 3:67990807-67990829 AAGCTACTCAAGAGCAGGAAAGG + Intergenic
956476067 3:69621546-69621568 CAGCTCAGCTACAGCAGGATAGG + Intergenic
957565596 3:81880079-81880101 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
957942171 3:87019061-87019083 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
958167953 3:89901354-89901376 GAGCTCTTGTAGAGCAGGCCTGG - Intergenic
961147008 3:124602581-124602603 CAGCTCTTCTAAAGGAGTGAGGG + Intronic
961347650 3:126274460-126274482 CAGCTCTCCCACAGCAGGATGGG + Intergenic
961895499 3:130164612-130164634 GAGCTCTTGTAGGGCAGGACTGG + Intergenic
962161305 3:133003683-133003705 GAGCTCTTTTAGAGCAGGTCTGG + Intergenic
963070298 3:141299712-141299734 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
964672148 3:159238563-159238585 CAGCTCTTCAAGGTCAGGGATGG - Intronic
965275085 3:166671804-166671826 TAGTTCTTCTAGAGCAAGATTGG + Intergenic
965311268 3:167131297-167131319 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
965975367 3:174614025-174614047 TAGCTCTGCTATAGCAGGATAGG - Intronic
966121812 3:176529844-176529866 CAGCTCAGCTACAGCAGGATAGG + Intergenic
966348507 3:179004650-179004672 CAGCTCAGCTACAGCAGGAAAGG + Intergenic
966674715 3:182572523-182572545 CACCTTCTCCAGAGCAGGAAAGG + Intergenic
966742718 3:183249356-183249378 CAGCTCTACTGGACCAGGGAGGG + Intronic
967219524 3:187236914-187236936 CTGCCTTTCTAGAGAAGGAAGGG - Intronic
967268605 3:187714295-187714317 CAGCTCTTCTCGAAAAGGTAAGG - Intronic
967323937 3:188220387-188220409 GAGCTCTTCAAGGGCAGGGAGGG + Intronic
967499788 3:190184526-190184548 GAGCTCTTGGAGAGCAGGGATGG + Intergenic
968297802 3:197591090-197591112 CAGTTCTGTTAGAGCAGGAAGGG - Intergenic
968852531 4:3093274-3093296 CAGCTCTCATAGAGCAGGTAGGG + Intronic
969807377 4:9619870-9619892 GAGCTCTTGTAGGGCAGGACTGG - Intergenic
970348386 4:15175836-15175858 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
970358361 4:15280477-15280499 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
973311376 4:48713047-48713069 GAGCTCTTCTAGGGCAGGCCTGG - Intronic
973871171 4:55168278-55168300 CAGCTCTTGTAGGGCAGGCCTGG + Intergenic
973883735 4:55299096-55299118 GAGCTCTTGTAGGGCAGGCATGG - Intergenic
974114734 4:57566494-57566516 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
974944804 4:68513983-68514005 GAGCTCTTTTAGGGCAGGACTGG + Intergenic
975255900 4:72235044-72235066 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
976122946 4:81802916-81802938 TAACTATTCAAGAGCAGGAATGG - Intronic
976451918 4:85199964-85199986 CAGCTTTTCAACAGCAGGATGGG - Intergenic
976893909 4:90084379-90084401 CAGCCCATCTAGAACAGCAAAGG + Intergenic
976925778 4:90493733-90493755 GAGCTCTTTTAGGGCAGGAGCGG - Intronic
978757253 4:112315802-112315824 AAGTTCTTCTAAATCAGGAATGG + Exonic
979074586 4:116256084-116256106 GAGCTCTTGTAGAGCAGGCCTGG + Intergenic
979948640 4:126865031-126865053 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
980587128 4:134831617-134831639 GAGCTCTTGTAGAGCAGGCCTGG - Intergenic
980859038 4:138477317-138477339 CAGATCATATAGAGCAGTAAAGG - Intergenic
981493988 4:145371169-145371191 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
982553777 4:156835527-156835549 CAGATCTTCTAGTGCTAGAAGGG + Intronic
985840223 5:2300284-2300306 CAGCTCTTCTAAGGCATGGAAGG + Intergenic
986657632 5:10030927-10030949 CAGCTCAGCTAGAGCAGAATAGG - Intergenic
989940844 5:50147706-50147728 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
989941646 5:50157954-50157976 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
990017361 5:51080648-51080670 CAACTCATCTAGATCTGGAAGGG + Intergenic
990071568 5:51789323-51789345 GAGCTCTTCTAGGGCAGGCCTGG + Intergenic
990873970 5:60463623-60463645 AAGCTCTGCTAGAGCAGTACAGG + Intronic
990882696 5:60557438-60557460 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
991496152 5:67228355-67228377 GAGCTCTTCTAGGGCAGGCCTGG + Intergenic
991950646 5:71944110-71944132 CTGCTCTTCAAGAGAAGGAAAGG + Intergenic
992350010 5:75919212-75919234 CAGATTGTCTAGAGCAAGAAAGG + Intergenic
992514432 5:77476641-77476663 GAGCTCTTTTAGAGCAGGCCTGG - Intronic
992708820 5:79427940-79427962 TAGCTCTTATAGAGAGGGAATGG - Intronic
994284303 5:97945973-97945995 GAGCTCTTCTAGATGAGGAAAGG - Intergenic
994862519 5:105216365-105216387 AAGCTCTTTCAGGGCAGGAAGGG - Intergenic
995385038 5:111579686-111579708 GAGCTCTTTTAGGGCAGGACTGG + Intergenic
996089513 5:119337182-119337204 GAGCTCTGCTATAACAGGAAGGG - Intronic
996760822 5:126984333-126984355 CACCCCTTCTACAGCAGGACAGG + Intronic
996788785 5:127270050-127270072 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
997552380 5:134764718-134764740 CAGCTCTCCTGGAGCAGAATTGG - Intronic
997577725 5:134995657-134995679 CAGCTCTTCCAGTGAATGAATGG + Intronic
998409962 5:141902261-141902283 CAGCACTTCTAGAGAAGGACTGG + Intergenic
999319656 5:150605573-150605595 CAGCTTCACTGGAGCAGGAATGG + Intronic
1000404760 5:160875352-160875374 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1000581238 5:163037190-163037212 AAGCTATCCTAGACCAGGAATGG - Intergenic
1001119691 5:168969757-168969779 CAGCTCCTGGAGAGCGGGAAGGG + Intronic
1001543810 5:172557756-172557778 AGGCTCTTCTAGGGCAGGATGGG - Intergenic
1001881536 5:175248893-175248915 AAGCTCTGTAAGAGCAGGAATGG - Intergenic
1001898250 5:175399601-175399623 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1002184645 5:177448329-177448351 CAGGTCTCACAGAGCAGGAAGGG - Intronic
1002686006 5:181009999-181010021 GAGCTCTTGTAGGGCAGGATTGG - Intergenic
1006365023 6:33610209-33610231 CAGCTGTAATGGAGCAGGAAGGG - Intergenic
1006572291 6:35015655-35015677 CTGCTCTTCTGGAGCTGGGAGGG + Intronic
1007322543 6:41038143-41038165 TATTTCTTCTAGAGAAGGAAAGG - Intronic
1007380543 6:41487871-41487893 CAGCTCTACGAGAGCAGTCAAGG - Intergenic
1007543601 6:42672829-42672851 AAGCTCTTTGAGAGCAGGAGGGG + Intronic
1007736848 6:43987284-43987306 GAGGTGTTCTAGAGAAGGAAGGG + Intergenic
1008016964 6:46531634-46531656 CTACTCTTCTAGTGCAGCAAAGG - Intergenic
1008177664 6:48288450-48288472 CAGCTCAGCTACAGCAGGATAGG - Intergenic
1008254350 6:49277730-49277752 GAGCTCTTATAGAGCAGGCCTGG - Intergenic
1009000047 6:57702365-57702387 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1009476249 6:64095928-64095950 GAGCTCTTTTAGAGCAGGCCTGG + Intronic
1009495593 6:64342533-64342555 GAGCTCTTTTAGGGCAGGACTGG - Intronic
1009614091 6:65982865-65982887 GAGCTCTTGTAGAGCAGGCCTGG + Intergenic
1010139969 6:72602621-72602643 CAGCTCTGCTACAGTAGGATAGG - Intergenic
1010484462 6:76392470-76392492 CAGCTCTTTTAGGGCAGGCCTGG - Intergenic
1010594220 6:77744937-77744959 GAGCTCTTTTAGGGCAGGCATGG - Intronic
1010633340 6:78227116-78227138 GAGCTCTTTTAGGGCAGGCATGG - Intergenic
1010851728 6:80784977-80784999 GAGCTCTTTTAGAGCAGGTCTGG - Intergenic
1011408090 6:87037366-87037388 GAGCTCTTGTAGAGCAGGCCTGG + Intergenic
1011432553 6:87302995-87303017 GAGCTCTTGTAGAGCAGGCCTGG - Intronic
1012653950 6:101792381-101792403 GAGCTCTTTTAGAGCAGGCCTGG + Intronic
1012776066 6:103495341-103495363 GAGCTCTTCTAGGGCAGGCCTGG + Intergenic
1013421507 6:109971202-109971224 CAGATCTCCTTAAGCAGGAATGG - Intergenic
1013629193 6:111968903-111968925 CAGCTCTTCTCATGCAGAAATGG - Intergenic
1013661257 6:112299239-112299261 CAGCTCTCCAAGGGCAGGGATGG - Intergenic
1015076999 6:129171348-129171370 GAGCTCTTTTAGGGCAGGACTGG + Intronic
1016196250 6:141345905-141345927 CAGCTTATCTAGAGAGGGAAAGG - Intergenic
1016296561 6:142578957-142578979 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1016567424 6:145472066-145472088 CAGCTCAACTACAGCAGGGAAGG + Intergenic
1016899587 6:149088503-149088525 CAGTTCTTCTTGAGCAAGAAAGG - Intergenic
1018409602 6:163530576-163530598 TAACTCTTCTTGAGCTGGAATGG + Intronic
1018620854 6:165728182-165728204 CAGCCCTGCCAGAGCAGGTAGGG + Intronic
1018664640 6:166124202-166124224 CAGCTCTTCACTAGCAGTAAAGG + Intergenic
1019207054 6:170370493-170370515 CAGATCTTCCAGAGCACGACTGG - Intronic
1021640928 7:22735499-22735521 CAGCTCAGCTACAGCAGGATAGG + Intergenic
1023363498 7:39439854-39439876 GAGCTCTTGCAGAGCAGGTATGG + Intronic
1024017351 7:45329203-45329225 GAGCTGTTCCAGAGCAGGACAGG + Intergenic
1024271797 7:47648157-47648179 GAGCTCTTCCAGAGCAGGGATGG - Intergenic
1024552456 7:50575007-50575029 CAGCTCTTGTAGGGCAGGCCTGG + Intergenic
1024620352 7:51151794-51151816 CATTTCTTCAAGAGCAGAAAGGG + Intronic
1024718000 7:52102449-52102471 GAGCTCTTGTAGGGCAGGACTGG - Intergenic
1024881585 7:54091559-54091581 CACCCATTCTAAAGCAGGAAAGG - Intergenic
1025213859 7:57038364-57038386 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1025658094 7:63538453-63538475 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1025863002 7:65350547-65350569 CAGCTTTTCAAAAGCAGAAAAGG - Intergenic
1026586665 7:71661197-71661219 CAGCTCTCCCAGGGCAGGAAGGG + Intronic
1034003484 7:147442847-147442869 CAGCTCTTCTATAGCAGGATAGG - Intronic
1034113145 7:148557778-148557800 CACCTCCTCTAGAGCAGGGTAGG - Intergenic
1034256545 7:149727836-149727858 CAGCCCTTCCAGACCAGGAAGGG - Intronic
1034310364 7:150082492-150082514 CAGGTCATCTACAGCAGGATAGG + Intergenic
1034703715 7:153121205-153121227 GAGCTCTTCTAGGGCAGGCCTGG + Intergenic
1034796481 7:154018161-154018183 CAGGTCATCTACAGCAGGATAGG - Intronic
1034820599 7:154213055-154213077 CAGCCCTTCGAGAGCAGCAGAGG - Intronic
1035547353 8:493431-493453 CAGCTCCGCCAGAGCACGAAGGG + Intronic
1035900517 8:3454486-3454508 GAGCTCTTTTAGGGCAGGACTGG + Intronic
1036050327 8:5188968-5188990 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
1037183515 8:16034455-16034477 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
1038651004 8:29403136-29403158 TAGATCTTCTAGAGCAGAGAAGG + Intergenic
1040405592 8:47099133-47099155 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1040473236 8:47753929-47753951 GAGCTCTTGTAGGGCAGGACTGG - Intergenic
1040476466 8:47782456-47782478 CAGCTCTTCCAGGTCATGAATGG - Exonic
1040582174 8:48707138-48707160 CAGCTATTCCAGGGCAGGACTGG - Intergenic
1040591582 8:48798079-48798101 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
1040628099 8:49175409-49175431 CAGCTCAGCTACAGCAGGATAGG + Intergenic
1040673578 8:49722002-49722024 CTGCTTTTCTAGATCAGAAATGG - Intergenic
1040686504 8:49879296-49879318 GAGCTCTTTTAGGGCAGGCATGG + Intergenic
1041018133 8:53611337-53611359 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1041744215 8:61189341-61189363 GAGCTCTTGTAGAGCAGGCCTGG - Intronic
1042030429 8:64470185-64470207 CAGCTCTTTTATAGGAGGAGAGG - Intergenic
1042750315 8:72151621-72151643 GAGCTCTTTTAGGGCAGGACTGG + Intergenic
1043065033 8:75558572-75558594 CAGCTCATCTAGAACACGATTGG - Exonic
1043177788 8:77043810-77043832 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
1043316314 8:78926702-78926724 GAGCTCTTCTAGGGCAGGCCTGG + Intergenic
1044207875 8:89512280-89512302 GAGCTCTTTTAGAGCAGGTCTGG - Intergenic
1045360457 8:101427717-101427739 GAGCTCTTTTAGTGCAGGACTGG - Intergenic
1045794377 8:106025268-106025290 AAGCTCTTGTAGGGCAGGACTGG - Intergenic
1046968287 8:120192219-120192241 GAGCTCTTTTAGGGCAGGCATGG + Intronic
1046982366 8:120350204-120350226 GAGCTCTTTTAGGGCAGGCATGG - Intronic
1047081412 8:121465524-121465546 GGGCTCTACTAGAGAAGGAAGGG + Intergenic
1047128123 8:121985862-121985884 CAGCTCTTTAAGAGCAGAAATGG + Intergenic
1048098697 8:131323249-131323271 GAGCTCTTCTAGGGCAGGCATGG + Intergenic
1048298288 8:133232548-133232570 CAGCTTCTCTAAAGCAGGAAGGG + Intergenic
1050601623 9:7258539-7258561 CAGCTCTTCTCCAGGAGGTAGGG + Intergenic
1051556561 9:18390167-18390189 CAGCTAATATAGGGCAGGAAGGG + Intergenic
1051879220 9:21823287-21823309 GAGCTCTTTTAGGGCAGGCATGG + Intronic
1052109788 9:24567120-24567142 CAGACCTTGTAGAGCAGAAATGG + Intergenic
1052214681 9:25951551-25951573 CAGCTCAGCTACAGCAGGATAGG - Intergenic
1052445301 9:28553966-28553988 CAGCTCTTTTAGGGCAGGCCTGG - Intronic
1052710917 9:32054413-32054435 GAGCTCTTTTAGGGCAGGACCGG - Intergenic
1052726013 9:32229206-32229228 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1054759942 9:68995439-68995461 GTGCTCTTCTAGATCAGAAAGGG + Intronic
1056088548 9:83181490-83181512 CAGATCTTCAAGAGTAGGCAGGG + Intergenic
1057744226 9:97738870-97738892 CATCTCCCTTAGAGCAGGAAAGG - Intergenic
1057878107 9:98772920-98772942 CACCTCTTCTAGGGCAGAATGGG + Intronic
1058134602 9:101292772-101292794 GAGCTCTTTTAGAGCAGGCCTGG - Intronic
1059551633 9:115234874-115234896 CAGGAGTTCAAGAGCAGGAAAGG - Intronic
1061437957 9:130578820-130578842 CAGATCTTCTACAGCAAGGAAGG - Intergenic
1203769846 EBV:44068-44090 CAGCTCTCCCAGTGCAGTAAAGG - Intergenic
1186702705 X:12108391-12108413 GAGCTCTTGTAGAGCAGGCCTGG - Intergenic
1188584738 X:31759754-31759776 CAGTTGCTCTAGAGAAGGAATGG + Intronic
1188864606 X:35299808-35299830 CAGCTCAGCTACAGTAGGAATGG + Intergenic
1188980100 X:36719968-36719990 CCGCTCTTCTGGAACGGGAAAGG - Intergenic
1189284627 X:39842599-39842621 CAGCTCTTCAGGAGGAGAAAGGG + Intergenic
1191070158 X:56392653-56392675 GAGCTCTTGTAGGGCAGGACTGG + Intergenic
1192001731 X:67158735-67158757 CAGCTCTGGTACAGCAGGATAGG + Intergenic
1193015116 X:76724205-76724227 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1193177383 X:78410586-78410608 GAGCTCTTTTAGAGCAGGCCTGG - Intergenic
1193243210 X:79197240-79197262 GAGCTCTTGTAAGGCAGGAATGG - Intergenic
1193289359 X:79753577-79753599 CAGCTCAGCTACAGCAGGATAGG - Intergenic
1193367526 X:80652529-80652551 AAGCTCTTGTAGAGCAGGCCTGG - Intergenic
1193461247 X:81793030-81793052 GAGCTCTTTTAGGGCAGGAGTGG - Intergenic
1193474090 X:81942181-81942203 GAGCTCTTTTAGGGCAGGAGTGG - Intergenic
1193821517 X:86171168-86171190 CAGCTCAGCTACAGCAGGATAGG - Intronic
1193918237 X:87393989-87394011 CAGCTCTTCTGAACCAGAAATGG + Intergenic
1194271667 X:91823848-91823870 CAGCTCTTTTAGGGCAGGCCTGG + Intronic
1195847767 X:109247174-109247196 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1196359380 X:114834879-114834901 GAGCTCTTTTAGGGCAGGACTGG + Intronic
1196588695 X:117460470-117460492 CAGCTCAGCGAGAGCAGGATAGG + Intergenic
1197476637 X:126933337-126933359 CAGCTCAGCTACAGCAGGATAGG - Intergenic
1197677577 X:129346938-129346960 CAGCTCAACTACAGCAGGACAGG + Intergenic
1199280908 X:145998098-145998120 CAGCTTTTCTAGACCACTAAGGG - Intergenic
1200460200 Y:3445380-3445402 GAGCTCTTTTAGGGCAGGACTGG - Intergenic
1200588913 Y:5045285-5045307 CAGCTCTTTTAGGGCAGGCCTGG + Intronic
1200833340 Y:7709298-7709320 GAGCTCTTTTAGAGCAGGTCTGG + Intergenic
1200879294 Y:8195420-8195442 GAGCTCTTCTAGGGCAGGCCTGG - Intergenic
1200889646 Y:8309865-8309887 GAGCTCTTCTAGGGCAGGCCTGG + Intergenic
1201246706 Y:12011551-12011573 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1201248815 Y:12034779-12034801 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1201449719 Y:14098454-14098476 CAGCTCTTTTAGGGCAGGCCTGG + Intergenic
1201545442 Y:15157074-15157096 GAGCTCTTTTAGGGCAGGACTGG + Intergenic
1201619907 Y:15945138-15945160 GAGCTCTTGTAGGGCAGGACTGG + Intergenic
1201689812 Y:16751213-16751235 GAGCTCTTGTAAGGCAGGAAAGG + Intergenic
1201709438 Y:16973835-16973857 GAGCTCTTTTAGAGCAGGCCTGG + Intergenic
1201782255 Y:17736446-17736468 GAGCTCTTCTAAGGCAGGCATGG + Intergenic
1201819298 Y:18169542-18169564 GAGCTCTTCTAAGGCAGGCATGG - Intergenic
1202342006 Y:23879799-23879821 GAGCTCTTCTAAAGCAGGCATGG + Intergenic
1202528763 Y:25790286-25790308 GAGCTCTTCTAAAGCAGGCATGG - Intergenic