ID: 1182753984

View in Genome Browser
Species Human (GRCh38)
Location 22:32663939-32663961
Sequence CACACTGCACATTTTGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182753984 Original CRISPR CACACTGCACATTTTGAAAA AGG Intronic
903756531 1:25665728-25665750 CATCCTGCTGATTTTGAAAATGG + Intronic
905271996 1:36793385-36793407 CACACTGCATATTTAGCACAGGG - Intergenic
908073276 1:60487364-60487386 AACACTTCACATTTTAAAATTGG - Intergenic
910117167 1:83744375-83744397 CACTTTCCACATTTTTAAAATGG + Intergenic
910749725 1:90615881-90615903 CACACTACAGATTTTATAAAGGG - Intergenic
911215978 1:95195189-95195211 CACACTGGGCATTTGGAGAATGG + Exonic
911240992 1:95466187-95466209 AACACTGAACAATCTGAAAAAGG - Intergenic
911341871 1:96649287-96649309 AACAATGCACATTTCCAAAATGG + Intergenic
911644276 1:100321606-100321628 CACACTTTACAATTTTAAAACGG - Intergenic
911776864 1:101824889-101824911 GACACTTCACACTTAGAAAATGG + Intronic
913672793 1:121113719-121113741 AACACTGCACATGTAGAAATGGG - Intergenic
914024569 1:143901093-143901115 AACACTGCACATGTAGAAATGGG - Intergenic
914663054 1:149809114-149809136 AACACTGCACATGTAGAAATGGG - Intronic
915007930 1:152657378-152657400 CTCACTGCACATTTGGAAATGGG - Intergenic
916375734 1:164151420-164151442 CATACAGCACTTTTTAAAAATGG + Intergenic
916762705 1:167831681-167831703 CACATTTCACATTTTGTAAAAGG - Intronic
916863031 1:168826624-168826646 TACACAGCACATTTGGAAAATGG - Intergenic
920818564 1:209358444-209358466 TACACTGCTAATTTTGAAGATGG - Intergenic
921204836 1:212839819-212839841 CAAACTGTACATTTTAAACATGG + Intronic
922354802 1:224765549-224765571 CACACTGAGAATTTAGAAAATGG + Intergenic
922390019 1:225131429-225131451 CACATTGCTGACTTTGAAAATGG - Intronic
923982461 1:239340683-239340705 GACACTGAACATTTTTAAAGAGG - Intergenic
924121191 1:240799876-240799898 CACACTGCAAACTTTAAGAAAGG - Intronic
1062971878 10:1654517-1654539 CACACTGCACAGGTGGAAAGAGG - Intronic
1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG + Intergenic
1063496679 10:6515653-6515675 TACTCTGGACATTTTCAAAAAGG + Intronic
1063556303 10:7082834-7082856 CACTCTGCATTTTCTGAAAAGGG + Intergenic
1064862472 10:19842710-19842732 CACATTGCAAATTTAGAAGAAGG + Intronic
1064862879 10:19846669-19846691 CACACTGCATATCTTGACATTGG - Intronic
1065800447 10:29346816-29346838 CACAGAGCACATTTTCCAAAGGG + Intergenic
1067007225 10:42675748-42675770 AACTCAGCACATTTTAAAAAGGG - Intergenic
1067455259 10:46414556-46414578 CCCACTGCACACTTTTAAAAGGG + Intergenic
1067631943 10:47970078-47970100 TCCACTGCACACTTTTAAAAGGG - Intergenic
1068009835 10:51434351-51434373 CAAACTGCACCTTAAGAAAATGG + Intronic
1068257808 10:54536654-54536676 GACACTGGACATCTAGAAAAGGG - Intronic
1068267323 10:54669235-54669257 CATATTACACATTTTAAAAAAGG - Intronic
1072094335 10:92161959-92161981 CTGACTCCACATTTTTAAAAAGG + Intronic
1073736809 10:106357417-106357439 CACAACCCACATTTTGAAATGGG + Intergenic
1073804255 10:107079384-107079406 CAAACTACACATATTTAAAATGG + Intronic
1074359262 10:112812247-112812269 CACACTTTGCATTTTCAAAAGGG + Intronic
1074478669 10:113797445-113797467 CAGAGTGCACAGTTTGAAAAAGG + Intergenic
1074535623 10:114326609-114326631 GACACTGCAAAATCTGAAAATGG + Intronic
1075907773 10:126097183-126097205 CAGACTGTACATTTTTAAGAGGG - Intronic
1075923444 10:126232270-126232292 CACACTGCTGGCTTTGAAAACGG + Intronic
1076219704 10:128723372-128723394 AAGAATGCACATTTTTAAAAAGG + Intergenic
1076579664 10:131498847-131498869 CACACTCCACATCTTGCTAAAGG + Intergenic
1077113302 11:871496-871518 CACACTGCACATTTGGGACCAGG + Intronic
1077724443 11:4660312-4660334 AAGACTCCACGTTTTGAAAAAGG - Intergenic
1077914023 11:6599356-6599378 CACATTCCTCATTTGGAAAATGG - Exonic
1078473073 11:11607567-11607589 CAAAATGCACATTTTGTAGAGGG + Intronic
1078953372 11:16161528-16161550 TCCAATGCACATTCTGAAAAGGG + Intronic
1079832683 11:25288873-25288895 AACAGTGAACAATTTGAAAAAGG - Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1081386919 11:42482826-42482848 CAGCCTTCACATTTGGAAAAAGG - Intergenic
1081392773 11:42548919-42548941 CACAGTGTATACTTTGAAAATGG - Intergenic
1081466582 11:43324616-43324638 CAGACTGCACATTTCTCAAAAGG - Intronic
1081601188 11:44495822-44495844 CATTCTGCACATTTATAAAATGG + Intergenic
1083706771 11:64522053-64522075 CTCATTGCACATTTTGGTAATGG + Intergenic
1083926491 11:65810070-65810092 CACTCTGCCCATTTGGACAAGGG - Intergenic
1084293810 11:68196606-68196628 CACCATGGACATTTTGAGAAAGG - Intronic
1084513211 11:69618862-69618884 GACACTCCACTTTTAGAAAAGGG - Intergenic
1084754550 11:71228192-71228214 CACCTTGCCCAATTTGAAAAAGG + Intronic
1085324687 11:75597542-75597564 AACACTTTACATTTTAAAAAGGG - Intronic
1086093979 11:83032074-83032096 CACACTGGACATATGGAATATGG - Intronic
1087004508 11:93456033-93456055 CTCACTGCACACTCTGCAAAAGG + Intergenic
1087750071 11:101997363-101997385 AAAACTGCACATTTTCAAAGTGG + Intronic
1088903039 11:114133213-114133235 CACCCCCCACATTTTGTAAATGG - Intronic
1089855503 11:121540695-121540717 TACACTGCTCATTTAGAAAATGG - Intronic
1090230574 11:125100235-125100257 AACACTGAAGATTTTGAAGACGG + Intronic
1091570694 12:1682911-1682933 CACACTGGTTATTTTTAAAAGGG + Intergenic
1095378953 12:41566054-41566076 CACACAGCACAATTAGCAAAGGG - Intronic
1095735796 12:45555038-45555060 CATGATGCACATTTTGATAAGGG + Intergenic
1097471364 12:59996863-59996885 CACCCTGTACATTATCAAAATGG + Intergenic
1097547159 12:61018147-61018169 CACCCTGCAGATTTTGGACATGG + Intergenic
1098234937 12:68409347-68409369 CACTATGCACCTTTTTAAAAAGG + Intergenic
1100346631 12:93738105-93738127 CACATGGCCCATTTTGCAAAGGG + Intronic
1100791746 12:98137670-98137692 AACCCTGCACATTTCAAAAAAGG - Intergenic
1101993574 12:109507872-109507894 CACACTGCTCACTTGGTAAATGG - Intronic
1104474914 12:129063293-129063315 AACAATGGAAATTTTGAAAAGGG + Intergenic
1104718314 12:131030933-131030955 CACACTGCACATTGTGACAGAGG - Intronic
1105876266 13:24556692-24556714 CACACTTCACAGTTTACAAAAGG - Intergenic
1105937479 13:25115624-25115646 GAGACTGAACATTTTGAACATGG + Intergenic
1106504862 13:30362335-30362357 CACAGTGTACAGTTTTAAAAAGG - Intergenic
1106645267 13:31627504-31627526 CACACTGCTTAATGTGAAAATGG - Intergenic
1107864358 13:44688863-44688885 GACACTGCTCATTGTGATAAAGG - Intergenic
1108568243 13:51723334-51723356 TTCACTGCTTATTTTGAAAATGG + Intronic
1109046141 13:57413402-57413424 CACAGTGAACAATGTGAAAAAGG + Intergenic
1109867720 13:68287215-68287237 CATCCAGCACATTTTGGAAATGG - Intergenic
1111207543 13:85032050-85032072 TACACTGCTAACTTTGAAAAGGG - Intergenic
1111286039 13:86093140-86093162 CAAAATGCACTTTTTGAAACAGG - Intergenic
1111715010 13:91868938-91868960 AACATTTCACTTTTTGAAAAAGG + Intronic
1111795587 13:92915167-92915189 CACATTTCACTTTATGAAAAAGG + Intergenic
1112204182 13:97307871-97307893 CACTGTGGACATTTTGAAGAGGG - Intronic
1112540867 13:100311306-100311328 CATACTCCACATTTGAAAAATGG + Intronic
1113172011 13:107515139-107515161 TACACTGCACTTTTGCAAAAGGG - Intronic
1113265090 13:108607989-108608011 TACACTGCCTATTTTTAAAATGG - Intronic
1113499190 13:110759963-110759985 CAGTCTGCACATTTTCAGAATGG - Intergenic
1114318733 14:21529130-21529152 CTCACTGCACATCCTGAAAAGGG + Intronic
1116186887 14:41608911-41608933 CACACTTCACAATCTGGAAAGGG - Intronic
1116968312 14:51038235-51038257 CACATTGCTGGTTTTGAAAATGG + Intronic
1120063045 14:80007150-80007172 CACGCTGCTCCATTTGAAAACGG + Intergenic
1120381298 14:83783193-83783215 ATCACTGCACATTTTGTACATGG + Intergenic
1122667489 14:103342449-103342471 CACTGTGCACTTTGTGAAAAGGG - Exonic
1122730781 14:103795988-103796010 CCCATTGCCCATTTTAAAAATGG - Intronic
1122811853 14:104293153-104293175 AGCACAGAACATTTTGAAAATGG - Intergenic
1124443188 15:29704766-29704788 CAAACAAAACATTTTGAAAATGG - Intronic
1124835195 15:33190003-33190025 AGCAATGCACACTTTGAAAATGG + Intronic
1125032547 15:35087044-35087066 CAAATTGCACATTCTGCAAATGG + Intergenic
1126028759 15:44475315-44475337 CACACTGCATTGGTTGAAAAGGG - Intronic
1127159609 15:56167846-56167868 CACACTGTAAGTTTTTAAAATGG + Intronic
1127939406 15:63679000-63679022 CACACTGTAAATGTTAAAAAAGG + Intronic
1129223778 15:74153280-74153302 CAAACTGCAGTTTTTGAAAATGG + Intergenic
1129654409 15:77514531-77514553 CACACTTCACTTTTTGAAACAGG - Intergenic
1130394566 15:83490772-83490794 GACACTGCTCATTGGGAAAATGG - Intronic
1130877828 15:88029579-88029601 CACATTACACATTTTTAAATGGG + Intronic
1130933349 15:88448653-88448675 CCCACTGAAGCTTTTGAAAAGGG - Intergenic
1131778965 15:95833407-95833429 GTGACTGAACATTTTGAAAATGG + Intergenic
1131830801 15:96353586-96353608 CACATTGGTCATTTTAAAAAGGG - Intergenic
1133753750 16:8745807-8745829 GACACTGTAGATTTTAAAAAAGG - Intronic
1134131477 16:11653242-11653264 CACACTGCAGAGTTTGAACCAGG - Intergenic
1136358273 16:29760928-29760950 CCCAGTGCACATTGTGAGAAAGG + Intergenic
1136911533 16:34148110-34148132 CAGACTGCATACTGTGAAAAGGG - Intergenic
1137374405 16:47940448-47940470 CTCACTGTACACTTTGAAGAAGG + Intergenic
1138749594 16:59402566-59402588 CACATTGCACAATTGGACAATGG + Intergenic
1145049298 17:19647419-19647441 CACATTGCACAAATAGAAAAAGG + Intergenic
1146597390 17:34182345-34182367 CAAACTGCTCATTTTGTAGATGG - Intergenic
1148927877 17:51103516-51103538 CACAGTGAACATTTTGAATTTGG - Intronic
1149544714 17:57494939-57494961 TACATTGCACAATTAGAAAACGG + Intronic
1149810699 17:59667944-59667966 CACAGTTAACATTTTGAAACTGG - Intronic
1150008542 17:61485093-61485115 CACACTTCACAGTTGTAAAATGG - Intronic
1152102819 17:78312928-78312950 CACACTGCACAATTCCAAGAGGG - Intergenic
1152274313 17:79346268-79346290 CTCACACCATATTTTGAAAATGG - Intronic
1152368598 17:79871341-79871363 CCCTCCGCACATTTTGAACAAGG + Intergenic
1153398818 18:4658588-4658610 CACAGTCAACATTTTGACAAGGG + Intergenic
1153403659 18:4710026-4710048 ATTAATGCACATTTTGAAAATGG + Intergenic
1154026523 18:10712588-10712610 CACAATCAACATTTTGAAAGGGG - Intronic
1156701652 18:39833284-39833306 CTGACTGCACATTTTAAAAATGG - Intergenic
1156946662 18:42841351-42841373 GAAACTACACATTTTCAAAAAGG - Intronic
1157002235 18:43540992-43541014 CAAAATGCACATTTTTCAAAGGG + Intergenic
1157227577 18:45880876-45880898 CACACTGGACATATTGTAACTGG - Intronic
1158336925 18:56422185-56422207 CACTCTGCACATGGTAAAAATGG + Intergenic
1158382131 18:56943370-56943392 CCCAGAGCACATTTTAAAAAAGG - Intronic
1159339277 18:67113964-67113986 AACAGTGCAAAATTTGAAAAAGG - Intergenic
1159576301 18:70182191-70182213 CAAACTGCATATTTTAAAATGGG - Intronic
1159702286 18:71643486-71643508 TACATTGCATATTTTGAATATGG + Intergenic
1160373295 18:78391649-78391671 CAGACTGCTAATTTGGAAAAAGG - Intergenic
1164662341 19:29987055-29987077 CACACTACACATTTTGCAGTTGG + Intronic
1164849717 19:31471611-31471633 CACACTGAGGATTTTAAAAAAGG + Intergenic
1165524579 19:36342979-36343001 CACTCTCATCATTTTGAAAAAGG + Intronic
1167625937 19:50589253-50589275 TACACTGCTGACTTTGAAAATGG + Intergenic
1168200184 19:54809387-54809409 CACACTGCACAGTCTGAGCATGG - Intronic
925109632 2:1322870-1322892 CACCCTCCACCTTTTGAAAGAGG + Intronic
926681006 2:15664371-15664393 CTCACTGCAGATTTTTCAAACGG - Intergenic
927012353 2:18918037-18918059 TAAATTGCACAATTTGAAAATGG - Intergenic
928525271 2:32133714-32133736 CAAACTTTACATTTTGAAGACGG - Intronic
928909363 2:36403222-36403244 CACAGTGAACATTTTGCAAAAGG + Intronic
929080226 2:38115092-38115114 AAAACTGCACATTTGTAAAATGG + Intergenic
929748890 2:44689427-44689449 AACACGGCACAGTTTTAAAAGGG + Intronic
929981463 2:46684066-46684088 TACACTCCACATTTTTGAAAAGG - Intergenic
930755936 2:54972772-54972794 CACAGTGCACAAACTGAAAAGGG + Exonic
930979182 2:57501245-57501267 CACATGGGACATTTTTAAAAGGG - Intergenic
931228490 2:60353902-60353924 CACACTGAACAAATTAAAAATGG + Intergenic
932202764 2:69846567-69846589 CTCACTGAACTTTTTGAAAAAGG + Intronic
932426465 2:71639149-71639171 TACACTGCCCATTTTTAAATTGG + Intronic
934508831 2:94919729-94919751 CCCATAGCACATTTTAAAAAGGG - Intergenic
934842105 2:97632420-97632442 AACAGTGAACAATTTGAAAAAGG - Intergenic
935344938 2:102099202-102099224 CACTATTCACATTTTGAAATAGG - Intronic
937193087 2:120123590-120123612 ACCACTGTACATTTTGAGAATGG - Intronic
938606255 2:132895731-132895753 CAGACTGCACATCTGTAAAATGG - Intronic
939563717 2:143762060-143762082 CAAACTGCAATTCTTGAAAAAGG - Intronic
940018571 2:149132653-149132675 CAAACTGCACATCTGTAAAATGG - Intronic
940942163 2:159574168-159574190 CACACAGCACAATTTTAAAATGG + Intronic
941172880 2:162161365-162161387 CAGACAGCACAATTTCAAAATGG - Intergenic
941282344 2:163568709-163568731 CACACTACAGATTCTGTAAATGG + Intergenic
941321554 2:164061992-164062014 AACACTGAACATTGAGAAAAGGG - Intergenic
942603254 2:177663168-177663190 CACACTGCACTTTTTGAGTGCGG - Intronic
943515265 2:188877806-188877828 CATACTCTACATTTTGACAATGG - Intergenic
943989931 2:194675508-194675530 AACAATGCACATTTTGAGATAGG + Intergenic
948555544 2:238807513-238807535 CAAACTGCTCATTTTCATAATGG + Intergenic
1169165462 20:3419524-3419546 TGCTCTGCACATTTAGAAAATGG + Intergenic
1169572404 20:6920855-6920877 CTCACTGAACTTTTTTAAAAAGG - Intergenic
1170909215 20:20547419-20547441 CACACTGCACTCTGTGCAAAAGG - Intronic
1171906861 20:30906385-30906407 CAGACTGCATACTGTGAAAAGGG - Intergenic
1172831121 20:37835820-37835842 CACACTTCATTTTTTAAAAATGG - Intronic
1173588659 20:44206319-44206341 TACACAGAACATTTTGCAAAGGG + Intronic
1174157609 20:48526650-48526672 CACACTGAATTTTTTAAAAAAGG + Intergenic
1174611047 20:51799399-51799421 AACACTTCACATTTTAAAAAAGG + Intronic
1175782786 20:61694201-61694223 CACCCTGCACGTTTAGGAAACGG - Intronic
1175887111 20:62298496-62298518 CGCTCTGGCCATTTTGAAAAGGG + Intergenic
1177279623 21:18964272-18964294 CACTGTACACCTTTTGAAAAAGG - Intergenic
1177311253 21:19396591-19396613 CATACTGAAAATTTTTAAAAAGG - Intergenic
1177405387 21:20660729-20660751 CAAACTTCAAATTTTAAAAATGG + Intergenic
1177673509 21:24266397-24266419 CACAAGGCAAATTTTGAAGAAGG + Intergenic
1177700331 21:24631512-24631534 TTAACTGCACATTTTGGAAAAGG - Intergenic
1178437660 21:32573988-32574010 CCCACTGAAGATGTTGAAAAGGG + Intergenic
1178745406 21:35244978-35245000 CAAGTTGAACATTTTGAAAAGGG + Intronic
1178787293 21:35665392-35665414 TACTCTGCATATTTTGAAGATGG + Intronic
1181954215 22:26576573-26576595 CACACTGGAAATTTGGAGAATGG + Intronic
1182396109 22:30037041-30037063 CATACAGCACATAGTGAAAAAGG + Intergenic
1182753984 22:32663939-32663961 CACACTGCACATTTTGAAAAAGG + Intronic
1185036653 22:48481743-48481765 CAAACTGCATATGTTTAAAATGG - Intergenic
949134170 3:542398-542420 AATACTGGACATTTTGAACAAGG + Intergenic
949240216 3:1862519-1862541 GACAATGCACAACTTGAAAAAGG - Intergenic
951445435 3:22774428-22774450 AACAAGGCATATTTTGAAAATGG - Intergenic
951642708 3:24854028-24854050 CACAATTCCCATTTTCAAAAAGG - Intergenic
952043396 3:29287211-29287233 TCCACTCCACATTTTAAAAATGG - Intronic
952299170 3:32088779-32088801 CCCACAGCACCTATTGAAAATGG - Intergenic
953293818 3:41692775-41692797 CCTACTGAACTTTTTGAAAATGG + Intronic
953443709 3:42943570-42943592 AACTCTGCACATTTTAAAATTGG + Intronic
956281207 3:67558947-67558969 CACACTGCTTATCTTGAATAGGG - Intronic
958587990 3:96116536-96116558 CACACTAGACATTGTGAAAAAGG + Intergenic
958984512 3:100764562-100764584 CACAGTGAACATTTAGAAACTGG + Intronic
959576490 3:107939911-107939933 CACACTGGACATTTTAAGACTGG + Intergenic
960266653 3:115627796-115627818 CACACTTCACAAATTGAAAAGGG - Intronic
960758031 3:121040022-121040044 TACACTGCATATGTTGAAGAAGG - Intronic
962506535 3:136051879-136051901 CAAACTTCACATTTTAAACATGG - Intronic
963507924 3:146210618-146210640 TACATTGTACATTTTAAAAAAGG - Intronic
963685031 3:148422302-148422324 AACACTGCAAACTCTGAAAATGG + Intergenic
963830923 3:150008097-150008119 CACACTAGAGAGTTTGAAAATGG - Intronic
963948661 3:151174096-151174118 CACACTTCAGATTTTCAAACTGG - Intronic
964381551 3:156103051-156103073 AACACTGCAGAGTTTAAAAAAGG + Intronic
965368917 3:167836285-167836307 CATTCTGAACATTTTGAAACTGG - Intergenic
967066305 3:185919989-185920011 CAAATTACACATTTTGACAAGGG + Intronic
967120886 3:186381865-186381887 CACACCTCACATTTTGAAGGAGG + Intergenic
969077621 4:4592833-4592855 TACACTGCTCACTTTGGAAATGG - Intergenic
969338106 4:6523407-6523429 GCCACTGCCCATTTTGAAATTGG - Intronic
969437470 4:7196661-7196683 CACAGAGCAGATTTGGAAAATGG - Intronic
970580248 4:17468298-17468320 CCCTCTGCACACTTTGGAAATGG - Intronic
971838131 4:31796040-31796062 AACAGTGAACAATTTGAAAAAGG - Intergenic
972213679 4:36870118-36870140 CATACTGTACATTCAGAAAAGGG + Intergenic
972493279 4:39608753-39608775 CAAACTGTACACTTTAAAAATGG + Intronic
974880072 4:67744695-67744717 CACACTGCAGTTTTTCACAATGG - Exonic
975038807 4:69718535-69718557 CACACTGCATATTTGGCTAAAGG + Intergenic
975521475 4:75306216-75306238 CACAGTGCACATTTTTGAAAAGG + Intergenic
976988594 4:91334654-91334676 CACTTAGCACATTTTGCAAAGGG + Intronic
977078586 4:92491916-92491938 TACAATGCACAGTTTGGAAAAGG - Intronic
978779434 4:112534839-112534861 CACAATTCAAATTTTGAATAAGG + Intergenic
981560151 4:146039528-146039550 CACACTGCACTGGTTTAAAATGG - Intergenic
982682112 4:158443822-158443844 CAGACTCCACATTTTAAAAAAGG - Intronic
984492714 4:180456403-180456425 AACACTGCTCATTGGGAAAATGG - Intergenic
984494417 4:180476362-180476384 CACATTTCACATTTTGATTAAGG - Intergenic
984782972 4:183542558-183542580 CAGACTGCATATTTTCAGAAGGG - Intergenic
986173578 5:5333177-5333199 TACAGGGCTCATTTTGAAAATGG - Intergenic
987168545 5:15226882-15226904 CATACAACCCATTTTGAAAATGG - Intergenic
987413585 5:17639337-17639359 TCCATTGCCCATTTTGAAAATGG + Intergenic
987971393 5:24949683-24949705 CACACTGTAAATGATGAAAAAGG - Intergenic
990631327 5:57673799-57673821 ATCACAGCACATTTTTAAAAAGG - Intergenic
991155027 5:63424071-63424093 CACATTGAACAATTTGAAAATGG + Intergenic
991905084 5:71501588-71501610 TACATTGGACATTTTGAGAATGG + Exonic
992090417 5:73311668-73311690 GACACTGCACATCATGAAACAGG - Intergenic
993112227 5:83671861-83671883 CACTGTCCACATTTTTAAAAAGG - Intronic
993534166 5:89060878-89060900 CACATTGAACATGTTGAAACTGG + Intergenic
995814650 5:116153831-116153853 CACTCTTCACATTTGGCAAATGG - Intronic
996035575 5:118754847-118754869 AACAGTGCACTTTATGAAAAGGG - Intergenic
997875937 5:137546912-137546934 CAAACTTAACATTTTGATAAAGG + Intronic
1000305205 5:159988176-159988198 CACACTGCTGACTTTGAAGATGG + Intergenic
1002397536 5:178969769-178969791 CACTCTGCCCAGTTTGAGAAGGG + Intergenic
1004711859 6:18178711-18178733 AACAGTGCACAACTTGAAAATGG - Intronic
1005493907 6:26372067-26372089 AATACTGCACAGTTTGTAAAAGG + Intronic
1007679384 6:43624038-43624060 CACACTGGACAATGTGAAGATGG + Exonic
1008652978 6:53582354-53582376 CACACTGAACAATTGCAAAAAGG - Intronic
1008869039 6:56250113-56250135 CACATGGCATATTTTGGAAATGG - Intronic
1009467615 6:63991437-63991459 CTCACTGAACATTTTCAAAATGG - Intronic
1009744675 6:67797726-67797748 TACATTGCACATTTTTAAAGTGG + Intergenic
1009925613 6:70117123-70117145 CACTCTGCACATTGTGAATCAGG - Intronic
1010115709 6:72307401-72307423 CACACTACACATTTTTAAAAGGG - Intronic
1011128468 6:84031548-84031570 CACATTGTACTTTGTGAAAAAGG - Intergenic
1011182235 6:84633974-84633996 CACAGTGCAGGCTTTGAAAAAGG - Intergenic
1011899039 6:92269262-92269284 CACACTGCTCAAGTAGAAAAAGG - Intergenic
1012091284 6:94901401-94901423 CACATTGGAAATTTTGAACATGG - Intergenic
1012335593 6:98052442-98052464 CATAATGCACAATTTTAAAAGGG - Intergenic
1014254716 6:119149359-119149381 CACAGTGCTCATTTTTAAAAGGG - Intronic
1014705333 6:124739662-124739684 CACCATACACATCTTGAAAAAGG + Intronic
1016358129 6:143239721-143239743 CAAAATCCACATTTTGAACACGG - Intronic
1016513318 6:144867415-144867437 CTCATTGAACATTTTGAAAAAGG - Intergenic
1016887891 6:148975492-148975514 CACACTGGACACTTTGATCATGG - Intronic
1017613442 6:156215913-156215935 CACATTGTACATCTTGAATATGG + Intergenic
1017745157 6:157440222-157440244 CACACAGCCCAATTTAAAAATGG + Intronic
1018336279 6:162793142-162793164 CTCACAGCATTTTTTGAAAATGG - Intronic
1020556384 7:9675111-9675133 CACATCTCCCATTTTGAAAAAGG - Intergenic
1020618296 7:10487664-10487686 CACACTGCATAGTTAGAAAATGG - Intergenic
1021341925 7:19475269-19475291 CACTCAGCATATTTTTAAAAAGG - Intergenic
1023128353 7:36977249-36977271 TACACTGAAAATTTTTAAAAAGG + Intronic
1023315588 7:38932759-38932781 CTCACTGCATATTTTGATGAGGG + Intergenic
1024007065 7:45232358-45232380 CATGCTGCAGATTTTGAACAAGG + Intergenic
1024806675 7:53149549-53149571 CACTCTACAGATTTTGACAAAGG - Intergenic
1026277002 7:68888620-68888642 CACACTTTACTTTTTGGAAATGG - Intergenic
1027927459 7:84485032-84485054 CACATTGCTCATTTGTAAAATGG + Intronic
1028312734 7:89359388-89359410 CACACAACACATTTAGAGAAAGG + Intergenic
1028955542 7:96685063-96685085 CACACTTCCCATTTTGAGAGAGG - Intronic
1029819266 7:103130097-103130119 CACACAGCACATTTTATAAGTGG + Intronic
1030343522 7:108407825-108407847 CAAACTGCACATACTTAAAATGG - Intronic
1030921462 7:115393845-115393867 CACAATGATCATTTTAAAAAGGG + Intergenic
1032194944 7:129783049-129783071 CATTCTGCCCATTTTGCAAATGG - Intergenic
1032909299 7:136411273-136411295 CACACTTCATATTTTTAAATGGG + Intergenic
1034104783 7:148481045-148481067 CAAACTTCAAATTTTAAAAAAGG - Intergenic
1034330814 7:150280654-150280676 CTCACTGCACACATTGAAAAAGG + Intronic
1035406401 7:158601107-158601129 CAGACTGAACATTTTCCAAATGG - Intergenic
1036455972 8:8908230-8908252 GAAACTGCACATGTTGAATAAGG - Intergenic
1036769749 8:11570911-11570933 CGCACTCCACATTTTACAAAGGG + Intergenic
1037839718 8:22235313-22235335 CACCCTCCACCTTTTTAAAATGG - Intergenic
1038013940 8:23497484-23497506 TCCACTGCACACTTTGCAAAAGG + Intergenic
1038177841 8:25197455-25197477 CAAACGGCACATTTGGGAAAAGG - Intronic
1038449068 8:27627346-27627368 CAAAATGCCCATTTAGAAAATGG - Intergenic
1039290092 8:36085268-36085290 CACACTGCACATTTTGCACTAGG - Intergenic
1039455459 8:37702984-37703006 TGCACAGCACATTATGAAAATGG - Intergenic
1040362898 8:46684256-46684278 CACACTGCAGAGTTGGCAAAGGG + Intergenic
1041396001 8:57391860-57391882 AACACTGCTGACTTTGAAAATGG + Intergenic
1043488171 8:80719504-80719526 ACCGGTGCACATTTTGAAAAGGG - Intronic
1044166944 8:88996599-88996621 CACACTGCTCACTTTGCACAAGG - Intergenic
1044340563 8:91041514-91041536 CACACTGCATAGTTCCAAAAAGG - Intergenic
1044896773 8:96900927-96900949 CTCATTGCACATTTAGAAATAGG + Intronic
1045549998 8:103163116-103163138 CTTACTCCACATTTTGGAAATGG + Intronic
1045772212 8:105756241-105756263 AAAACAGCACATTTTCAAAAGGG - Intronic
1045844527 8:106617904-106617926 CTCACTGAACATTTTAGAAACGG - Intronic
1046084060 8:109409910-109409932 CAAATTGCAAATTTTGAAGAAGG + Exonic
1046132542 8:109984971-109984993 CTCACTGCCCATTTGGAGAAGGG - Intergenic
1046501619 8:115085081-115085103 CACACTGCTGACTTTGAAGAAGG + Intergenic
1047632622 8:126724890-126724912 CACAAAGCCGATTTTGAAAAAGG - Intergenic
1047911037 8:129529504-129529526 CAAACTGTACATTGTCAAAAAGG + Intergenic
1048009031 8:130442101-130442123 CAAACTGCATATTTTGAGATAGG - Intronic
1053604852 9:39647263-39647285 AACACTTCTCTTTTTGAAAAAGG + Intergenic
1053862727 9:42403613-42403635 AACACTTCTCTTTTTGAAAAAGG + Intergenic
1054248689 9:62695152-62695174 AACACTTCTCTTTTTGAAAAAGG - Intergenic
1054562802 9:66729678-66729700 AACACTTCTCTTTTTGAAAAAGG - Intergenic
1055067512 9:72133441-72133463 CACATTGCTGATTTTTAAAATGG - Intronic
1055311576 9:74987733-74987755 CAAACTGTACATTTGTAAAAAGG + Intronic
1056112423 9:83408879-83408901 CACACAGCTCAATTTGGAAATGG + Intronic
1058316422 9:103572581-103572603 AATAATGCACATTTTGAACAAGG + Intergenic
1058819083 9:108712597-108712619 CACAAAGCACATATTGAAGATGG + Intergenic
1059978998 9:119748493-119748515 CACACTACATATTTTAACAAAGG - Intergenic
1060162119 9:121373449-121373471 CAAATTGCATATTGTGAAAAAGG + Intergenic
1060907168 9:127317035-127317057 CACACTACACAGTTAGCAAAAGG - Intronic
1186089292 X:6027142-6027164 CACACTGCTCCCTTTGAAGAGGG + Intronic
1186989462 X:15051797-15051819 TACACACCAGATTTTGAAAATGG - Intergenic
1187332217 X:18351298-18351320 AAACCTGGACATTTTGAAAATGG - Intronic
1189370385 X:40423385-40423407 CACTCAGCACATTCTGAGAAAGG + Intergenic
1190418377 X:50203415-50203437 CACAATGACCATTTAGAAAATGG + Intronic
1191979206 X:66907399-66907421 AACACTGCACTTTTGTAAAAAGG - Intergenic
1193511847 X:82411691-82411713 CAGACTGGACATATTGTAAAGGG - Intergenic
1194050770 X:89065715-89065737 CATATTGCACATTTATAAAAAGG - Intergenic
1194727672 X:97417289-97417311 TACACTCCTCAATTTGAAAAGGG + Intronic
1195482993 X:105369606-105369628 CAGACTGCTCATTTTGAACCTGG + Intronic
1195746047 X:108119606-108119628 CACACTGCTCATTTTATAGATGG + Intronic
1198450861 X:136766475-136766497 CCCACTACACATTAAGAAAAGGG + Intronic
1199693226 X:150324977-150324999 CACCCTGCACATTTTGGACTTGG - Intergenic
1200707005 Y:6451722-6451744 CACACAGCCCATTTTGGGAATGG - Intergenic
1201027107 Y:9712986-9713008 CACACAGCCCATTTTGGGAATGG + Intergenic
1201074906 Y:10179533-10179555 CAGACTGCATACTGTGAAAAGGG - Intergenic
1202306066 Y:23472366-23472388 AATACAGCACATTTTAAAAAGGG - Intergenic
1202564743 Y:26198223-26198245 AATACAGCACATTTTAAAAAGGG + Intergenic