ID: 1182758447

View in Genome Browser
Species Human (GRCh38)
Location 22:32700315-32700337
Sequence GAGCCACATCCCTTCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182758447_1182758450 -10 Left 1182758447 22:32700315-32700337 CCTCCCTGGAAGGGATGTGGCTC 0: 1
1: 0
2: 0
3: 14
4: 207
Right 1182758450 22:32700328-32700350 GATGTGGCTCCTGCATTATCTGG 0: 1
1: 0
2: 0
3: 8
4: 109
1182758447_1182758452 9 Left 1182758447 22:32700315-32700337 CCTCCCTGGAAGGGATGTGGCTC 0: 1
1: 0
2: 0
3: 14
4: 207
Right 1182758452 22:32700347-32700369 CTGGTCCCAACTCCAGCTCCAGG No data
1182758447_1182758454 14 Left 1182758447 22:32700315-32700337 CCTCCCTGGAAGGGATGTGGCTC 0: 1
1: 0
2: 0
3: 14
4: 207
Right 1182758454 22:32700352-32700374 CCCAACTCCAGCTCCAGGATAGG 0: 1
1: 1
2: 6
3: 42
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182758447 Original CRISPR GAGCCACATCCCTTCCAGGG AGG (reversed) Intronic
900090467 1:918058-918080 GAGCCTCACCCCATCCAAGGCGG - Intergenic
900556607 1:3283900-3283922 GAGCCACATTCCTCCCGCGGAGG - Intronic
900641014 1:3688067-3688089 GACACCCCTCCCTTCCAGGGAGG + Intronic
901671537 1:10858903-10858925 GAAGCACCTCCCTTCCAGGTAGG + Intergenic
902175022 1:14642937-14642959 GTGCCAAATCTCTTCCAGAGTGG - Intronic
903535180 1:24062046-24062068 AAGCCAGATCTCATCCAGGGTGG + Exonic
904158667 1:28505882-28505904 GAGCCCCACCCCTTCCTGGCTGG - Intergenic
904460896 1:30679335-30679357 GAGCCTCACCCCTTCCAAGTTGG + Intergenic
904814902 1:33188533-33188555 GAGTCACAGCACCTCCAGGGTGG + Intergenic
906013601 1:42552846-42552868 GTGCCTCCTCCCTTCCAGGTGGG + Intronic
906147118 1:43566735-43566757 GACCCACTTCCCTTCCCGGGTGG + Intronic
906199057 1:43947570-43947592 GGCCCACCTCCCTGCCAGGGAGG + Exonic
906509815 1:46404651-46404673 AAGCCACATCTCTGCCAGTGAGG - Intronic
908253861 1:62286629-62286651 GAGCCACATCAGCTGCAGGGAGG - Intronic
911275403 1:95853175-95853197 GAGCCCCACCCCTTCCAAGTTGG + Intergenic
917465186 1:175269923-175269945 GAGCTCCAACCCTTCCAGGTTGG - Intergenic
919525257 1:198639987-198640009 GAGCCACCGCCCTTCCTGGGTGG + Intronic
920937354 1:210447958-210447980 CAGCCACATCCCCTTCAAGGTGG - Intronic
1062998404 10:1890677-1890699 GAACCACAGCCCCTCCTGGGTGG - Intergenic
1063684892 10:8227681-8227703 CAGCCACATCCCTTGGAGGAAGG + Intergenic
1064105717 10:12499529-12499551 GATCCGAATCCCTTCCAAGGAGG + Intronic
1066101655 10:32123084-32123106 GAGCCTCATCCCTTCTAAGTTGG - Intergenic
1067543952 10:47178426-47178448 GCTGCACATCCCTTCCAAGGGGG + Intergenic
1069751566 10:70748483-70748505 GAGCCTCGCCCCTTCCTGGGAGG - Intronic
1074882512 10:117669790-117669812 CAGCCACATCCCATGCAGGATGG - Intergenic
1075105741 10:119538912-119538934 GAGTCACTTCCCTCCCTGGGTGG - Intronic
1075611577 10:123859055-123859077 GAGCCCCATACCTTCCAGCCTGG + Intronic
1076629046 10:131841809-131841831 GAGACACCTCCCTCCCTGGGAGG + Intergenic
1076720301 10:132389481-132389503 GGGCCTCATTCCTTCCCGGGTGG - Intergenic
1076904212 10:133354356-133354378 GAGCCACATCTCAGCCGGGGTGG + Intergenic
1077853213 11:6095902-6095924 AGGCCACAAGCCTTCCAGGGGGG - Intergenic
1078425867 11:11250895-11250917 GACCCACCTCCCTTCCAGCCTGG - Intergenic
1080337345 11:31213193-31213215 GAGCCACATGCCTTTCTTGGAGG - Intronic
1080384630 11:31803977-31803999 GAGCCACGTCTTTTCCTGGGAGG - Intronic
1081683964 11:45028417-45028439 GGGCCACATGCCTCCCAGGACGG - Intergenic
1083333422 11:61909573-61909595 GACCCACATCCCTGCCAGGCAGG - Intronic
1083472928 11:62896323-62896345 CACCCACATCCCACCCAGGGTGG - Intergenic
1083698098 11:64455998-64456020 GCACCACAGCCCTCCCAGGGAGG + Intergenic
1084050906 11:66599277-66599299 GAGCCACCTCCCTCCGAGAGGGG - Intronic
1084091325 11:66880951-66880973 GAGCCGCAACTCTTCAAGGGAGG + Intronic
1085170044 11:74442104-74442126 TAGCCACATCCCTTGCAGTGTGG + Intergenic
1086408511 11:86520263-86520285 AACCCCCATCCATTCCAGGGAGG - Intronic
1088011123 11:105002108-105002130 GAGCCCCATTCCTTGCAGGCAGG + Exonic
1088904703 11:114146027-114146049 GACCCACAGCCCTTCTAGGTAGG - Intronic
1091679117 12:2513563-2513585 GAGCCAATTCCCTTCCTTGGGGG + Intronic
1092001726 12:5038177-5038199 AAGCAACATCCCTTCTAAGGCGG - Intergenic
1094372498 12:29753396-29753418 GAGCACCATTGCTTCCAGGGAGG - Intronic
1100545054 12:95593684-95593706 AAGTCACACCCTTTCCAGGGTGG - Intergenic
1101400444 12:104382381-104382403 GCTCCACGTCCCTTCCAGGCTGG + Intergenic
1101801898 12:108029613-108029635 GCGCCATCTCCCTTCCAGGGTGG + Intergenic
1102332735 12:112048770-112048792 GAGTAACATCCCTTCCAGAATGG - Intronic
1102412572 12:112732765-112732787 AAGCCACACACCTCCCAGGGTGG - Intronic
1102906087 12:116676174-116676196 CAACCCCATCCCTCCCAGGGTGG - Intergenic
1103930831 12:124449937-124449959 GAGCCACAGCCCTGGCACGGAGG + Intronic
1104934614 12:132357860-132357882 GGGCCACATCACTGCCAGGAAGG - Intergenic
1105547392 13:21360800-21360822 GATCCTCATACCCTCCAGGGTGG - Intergenic
1107234844 13:38155623-38155645 GAGCCCCATCCCTACCATGTTGG - Intergenic
1110782081 13:79478285-79478307 CAGCCACATTCCTTCCAGCTGGG + Intergenic
1112411369 13:99166416-99166438 CAGCAACCACCCTTCCAGGGAGG - Intergenic
1112627389 13:101121144-101121166 GAGCCTGATCCCAGCCAGGGGGG + Intronic
1113778808 13:112963979-112964001 CATCCACAGCCCTTCCAGTGGGG - Intronic
1113917707 13:113884211-113884233 GAGCCCCATCCCCTCCAAGGCGG + Intergenic
1114645202 14:24252243-24252265 GAGCCACAGACTGTCCAGGGAGG + Intronic
1119682923 14:76606479-76606501 CAGCCAGATCTCTTCCTGGGAGG + Intergenic
1121229282 14:92344777-92344799 GGGCCACTTTCTTTCCAGGGAGG + Intronic
1121305609 14:92904670-92904692 GTGCAACAGCCCTTTCAGGGAGG - Intergenic
1121570720 14:94944774-94944796 AAGCCATAACCCTGCCAGGGTGG - Intergenic
1122119307 14:99543391-99543413 AAGGCACATCCCTTCCTGTGAGG + Intronic
1122145244 14:99684764-99684786 CAGCCACAGCCCTTTCAGGTAGG + Intronic
1122156556 14:99753556-99753578 GAGGCCCCTCCCTGCCAGGGAGG - Intronic
1124625737 15:31306615-31306637 GAGCCACCGCCTTTCCCGGGAGG + Intergenic
1125717969 15:41830482-41830504 GAGCCCCACCCCTTCCAAGTTGG + Intronic
1128388401 15:67166455-67166477 AAGCCCCACCCCCTCCAGGGAGG - Intronic
1129478938 15:75807829-75807851 GAGCCCCATCCTTTCCTCGGGGG + Intergenic
1129660963 15:77552685-77552707 GGGCCAGATCCTCTCCAGGGAGG - Intergenic
1131500457 15:92959532-92959554 GCGCCACTTCCCTTCCAGCCTGG - Intronic
1132657759 16:1048470-1048492 CAGCCAGGTCCCATCCAGGGTGG + Intergenic
1132806798 16:1778703-1778725 GACCCCCATCCTTTCCTGGGTGG - Intronic
1132931214 16:2460083-2460105 GAGCCACGCCCCTTCCGGGAGGG - Exonic
1135929270 16:26722939-26722961 ATGCCACATTCCTTCCAGAGTGG + Intergenic
1139748019 16:69089986-69090008 GAGCCAAATCCCACCAAGGGAGG - Intergenic
1140787172 16:78353763-78353785 GAGCCACATCACCTGCAGGCAGG + Intronic
1142358025 16:89613290-89613312 GTGCCACCTCCCAGCCAGGGGGG - Intronic
1142611569 17:1111404-1111426 GAGTCACTTCCCCTCCAGGGGGG - Intronic
1143030137 17:3963339-3963361 TCCCCACATCCCTTCCAGGCAGG - Intronic
1144548328 17:16217222-16217244 GAGCCACATTGCTTCCATGATGG - Exonic
1147427823 17:40354681-40354703 GGGCAACACCCCTTCTAGGGAGG + Intronic
1147650346 17:42058451-42058473 GGGCCACAGCCATTCCAGGGAGG - Intronic
1147772610 17:42878320-42878342 GAGCCACGTGCCTCCCAGCGGGG + Intergenic
1148997665 17:51725410-51725432 GAGCCACTTACTTTTCAGGGAGG + Intronic
1151696610 17:75721294-75721316 GAGCCGCAGCCCTTTCCGGGGGG + Intergenic
1152546391 17:81002145-81002167 GGGCCCCATCCCGTCCAGGATGG - Intronic
1152743518 17:82029001-82029023 GAGACACCTGCCTTTCAGGGTGG + Intronic
1153669104 18:7393410-7393432 GAGCCCCATCACTTCCACGAAGG - Intergenic
1154133356 18:11755167-11755189 GGGCCACAGCCCTTGCAGGCAGG - Intronic
1154336662 18:13471401-13471423 ATGCTACATCCCTTCCAGTGGGG - Intronic
1156391250 18:36652597-36652619 GAGCAGCATCCCTTCCAGTGGGG - Exonic
1161066294 19:2240039-2240061 GCGCCACTTCTCATCCAGGGAGG + Intronic
1162098169 19:8323089-8323111 CTCCCACATCCCTTCCAGTGGGG + Exonic
1163276252 19:16286231-16286253 GATCCTGTTCCCTTCCAGGGAGG + Intergenic
1163491572 19:17620052-17620074 TAGACACATGCCTTCCAGGCTGG - Intronic
1163618461 19:18343321-18343343 GATCCACATCTCTTCCTGGATGG + Intronic
1165441639 19:35831613-35831635 GAGACCCTTCCCTGCCAGGGTGG - Intronic
1167262086 19:48464460-48464482 GAGCCAGTTCTCTTCCAGCGTGG + Exonic
1202684306 1_KI270712v1_random:35289-35311 GAGCCACATTCATTCCATAGAGG + Intergenic
927056316 2:19368814-19368836 GAGCCACACTCCTGCCAGTGTGG - Intergenic
932399401 2:71469373-71469395 AAGCCAGATCCCTTCCGGTGGGG + Intronic
932756632 2:74414348-74414370 GAGCAACATCCCATCCAGACAGG - Exonic
934862422 2:97775348-97775370 GGGCCACACTCCCTCCAGGGCGG + Intronic
934903160 2:98176942-98176964 GCCCCACATGCCTTTCAGGGGGG - Intronic
935167897 2:100585609-100585631 TACCCCCTTCCCTTCCAGGGAGG - Intergenic
937264023 2:120604895-120604917 GAGCACCATCGCTGCCAGGGTGG + Intergenic
941440426 2:165528871-165528893 GAGCCCCATTCCTTCCAAGCTGG + Intronic
946053064 2:216880154-216880176 AAGCCTCATTCCTTCCAGGAGGG - Intergenic
947822941 2:233084708-233084730 GAGCCACATCCTTTGCCCGGCGG - Intronic
947876518 2:233471263-233471285 CACCCACATCACTTCCAGTGAGG - Exonic
1169479853 20:5969779-5969801 GAGCAGCCTCTCTTCCAGGGTGG - Intronic
1170605685 20:17873800-17873822 CTGCGCCATCCCTTCCAGGGAGG - Intergenic
1174131923 20:48351070-48351092 GGGCCTGATCACTTCCAGGGAGG - Intergenic
1175463212 20:59170775-59170797 AAATCACATCTCTTCCAGGGAGG - Intergenic
1175928223 20:62481103-62481125 GCCCCACAGCCCTGCCAGGGTGG - Intergenic
1176199157 20:63852478-63852500 GATCCACCTCCCCTCCAGGATGG + Intergenic
1176248148 20:64107139-64107161 GATCCACATCTCTTCCCAGGAGG - Exonic
1176375838 21:6086539-6086561 GAGCCACTTCCACTCCTGGGTGG - Intergenic
1176381712 21:6117090-6117112 GAGCCACATCAGCGCCAGGGCGG - Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1179082421 21:38184188-38184210 GAGCCACATGGTTTCCAGGCTGG + Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1179741760 21:43421149-43421171 GAGCCACATCAGCGCCAGGGCGG + Intronic
1179747636 21:43451705-43451727 GAGCCACTTCCACTCCTGGGTGG + Intergenic
1182758447 22:32700315-32700337 GAGCCACATCCCTTCCAGGGAGG - Intronic
1183120510 22:35726863-35726885 GAGACACATCCCTTTCTGGACGG + Exonic
1183351261 22:37336029-37336051 CACCCCCATCTCTTCCAGGGTGG + Intergenic
1183367704 22:37416062-37416084 GAGGCACATGCCTCCCAGGGTGG - Intronic
1183640752 22:39090949-39090971 GAGTCACATCCCTTCTACCGGGG + Intergenic
1184688877 22:46108562-46108584 GACCCACATCCCTTCCTGCCTGG + Intronic
1185065849 22:48631318-48631340 CAGCCACATGCCTTCCATGAGGG + Intronic
950162188 3:10768780-10768802 GAGCCATTTCCCCTCCAGGTGGG - Intergenic
952544334 3:34402664-34402686 GAGCCATATCCCTTCCCCAGAGG - Intergenic
952905761 3:38138320-38138342 GAGCCACAGTTCTTCCACGGAGG - Intergenic
955815492 3:62838117-62838139 TAGCCACATCTTTTCCAGTGTGG - Intronic
957478263 3:80755718-80755740 GAGCTACATACCTTCCAGCCTGG + Intergenic
959301090 3:104602278-104602300 GAGCCAAATCCCTTCAAGTTGGG + Intergenic
959816387 3:110678142-110678164 GTGCCACATCCCTCCAATGGAGG + Intergenic
960445647 3:117745921-117745943 GTGGCACATTCCTTCCAAGGGGG - Intergenic
963483192 3:145903652-145903674 GAGCCCCAACCCTTCCAAGTTGG + Intergenic
964990375 3:162803463-162803485 GAGCCACATGCAGCCCAGGGAGG - Intergenic
967135515 3:186509674-186509696 GGGCCACATTCCTCCCAGGAGGG + Intergenic
967978178 3:195046881-195046903 GAGCCACATCCCTAGCATGTGGG - Intergenic
968359386 3:198136787-198136809 GAGCCAAGCACCTTCCAGGGGGG + Intergenic
969239935 4:5891282-5891304 GGGCCCCATCCCTTCGCGGGCGG - Intronic
969708470 4:8829125-8829147 TACCAACATCCCTACCAGGGTGG - Intergenic
972358417 4:38303851-38303873 GAGCCCCATCCCTTTCAAGTTGG - Intergenic
974124115 4:57674779-57674801 GAGCCACATCCAAGCCAGGTTGG + Intergenic
974278598 4:59759703-59759725 GAGCCACACCCCTTCCCAGTTGG - Intergenic
975170347 4:71225549-71225571 GAGCCTCATCCCTGCCAGCTGGG + Intronic
975725885 4:77291285-77291307 AGGCCACATCCCTTACTGGGTGG - Intronic
976734167 4:88294121-88294143 GTGCCATCTTCCTTCCAGGGAGG + Intergenic
981094238 4:140761816-140761838 GAGCTACTGCCCTTCCAGGTTGG - Intergenic
986015306 5:3752204-3752226 GTGCCACACCCTTTCCTGGGGGG - Intergenic
988670880 5:33379964-33379986 GAGCCACTTCCCTTCCAGCTGGG + Intergenic
990915835 5:60905150-60905172 GAGCCCCCTCCCCACCAGGGTGG - Intronic
992278668 5:75149882-75149904 GAACCATGTCCCTTGCAGGGTGG - Intronic
992489500 5:77228455-77228477 AAGCCACTTCCCTGCCAGGTAGG - Intronic
993003699 5:82408290-82408312 GTGACACAACCTTTCCAGGGAGG - Intergenic
1001217836 5:169872384-169872406 GAACAATATCCCTTCCAGGCTGG - Intronic
1003404289 6:5815887-5815909 GATCCTCATACCCTCCAGGGTGG + Intergenic
1003559415 6:7168621-7168643 GTGCCTCATTCCTTCCATGGTGG + Intronic
1005533866 6:26735125-26735147 GAGCTCCATCCCTGCCAAGGTGG + Intergenic
1005536929 6:26766529-26766551 GAGCTCCATCCCTGCCAAGGTGG - Intergenic
1007095058 6:39207893-39207915 GAGCCAGCTTCCTCCCAGGGAGG - Intronic
1009007821 6:57808940-57808962 GAGCTCCATCCCTGCCAAGGTGG - Intergenic
1015788234 6:136940234-136940256 AAGCCTCAGCTCTTCCAGGGTGG + Intergenic
1015972269 6:138753954-138753976 GAGTCACATACCTTGCAGGTGGG - Intronic
1018632870 6:165835591-165835613 GTCTCACAGCCCTTCCAGGGAGG + Intronic
1019722803 7:2583663-2583685 GATCCGCATCTCTTCCAGGTTGG - Exonic
1022468171 7:30665298-30665320 GAGCCACTTCCCACCCATGGTGG + Intronic
1023684575 7:42721317-42721339 GAGTCAGATCCCTTCCTGGCTGG + Intergenic
1032480567 7:132243397-132243419 CAGCCACATTCCATCCAAGGTGG - Intronic
1034438661 7:151075791-151075813 GAGGCACACCCCTTCCGGTGGGG - Intronic
1035108872 7:156463929-156463951 ATGCCACAGCCCTTCCAAGGAGG + Intergenic
1035434696 7:158850441-158850463 GAGCCACATCCCTTCTGAGTTGG - Intergenic
1037663094 8:20943829-20943851 CAGCCCCATCCCTTACACGGAGG - Intergenic
1037946329 8:22991785-22991807 GAACCACAGCCCTTCCCAGGTGG + Intronic
1038874246 8:31530282-31530304 TTGCCACATCCCTTTCAGTGTGG + Intergenic
1039714542 8:40093320-40093342 AAGCCACATACCTTCCCAGGGGG - Intergenic
1039971743 8:42326383-42326405 AAGCCACATTCCCTTCAGGGAGG + Intronic
1040375792 8:46823549-46823571 GAGACACATCACTTCAAGGTTGG - Intergenic
1040592362 8:48805410-48805432 GAGCCCCTCCCATTCCAGGGAGG - Intergenic
1040816043 8:51509564-51509586 GAGACACATGCATGCCAGGGAGG - Intronic
1041357426 8:57014821-57014843 GAGCCCCACCCCTTCCAAGTTGG - Intergenic
1041370092 8:57150063-57150085 CAGCCACTTCTCTTCCAGGCAGG - Intergenic
1043328301 8:79080919-79080941 GAGCTATACCCCTTCCAGTGAGG + Intergenic
1048880455 8:138868291-138868313 GGGCAACATCACTTCCAAGGGGG + Intronic
1048910267 8:139128238-139128260 AAGCCAGATCCCCTCCAGGACGG - Intergenic
1049751207 8:144285096-144285118 CAGCCACATCGCTGCCAGGATGG + Intronic
1052707385 9:32010383-32010405 GAGCCCCATCCCTTCCAAGCTGG + Intergenic
1053076515 9:35138949-35138971 GAGCCCCGCCCCTTCCAGGTTGG + Intergenic
1057260573 9:93580841-93580863 GAGACACTCCCCCTCCAGGGTGG - Intronic
1058600720 9:106667209-106667231 CAGCCATATCCCTTGCAGTGTGG - Intergenic
1061361088 9:130142774-130142796 GAGCCAGATGCCTCCCAGGTTGG + Intergenic
1062362133 9:136193188-136193210 GAGCCCCCTTCCTTCCAGGGTGG - Intergenic
1062744073 9:138200501-138200523 GAGCCAAGCACCTTCCAGGGGGG + Intergenic
1203617218 Un_KI270749v1:77099-77121 GAGCCACATTCATTCCATAGAGG + Intergenic
1186894437 X:13991841-13991863 GAGCCACCTCCTTTCCTTGGAGG - Intergenic
1188585493 X:31769673-31769695 GAGCCACATGCGTCCCAGGATGG - Intronic
1189381401 X:40505152-40505174 CAGCCACACTCCTACCAGGGAGG - Intergenic
1193591412 X:83392657-83392679 GAGCATCATCCCTTCCATAGAGG - Intergenic
1195582908 X:106528890-106528912 TAGTCAAACCCCTTCCAGGGAGG + Intergenic
1196476883 X:116097725-116097747 GTGCCCTATCCCTCCCAGGGAGG + Intergenic
1196883776 X:120223880-120223902 GAGCCCCACCCCTTCCAAGTTGG - Intergenic
1196883841 X:120224150-120224172 GAGCCCCACCCCTTCCAGGTTGG - Intergenic
1199612207 X:149628188-149628210 GTGCCACATGGCTACCAGGGTGG + Intronic
1199714339 X:150495631-150495653 AAGCCAGACCTCTTCCAGGGTGG + Intronic
1199776353 X:151015339-151015361 GAGGCTCCTGCCTTCCAGGGAGG - Intergenic
1200011316 X:153123057-153123079 GAGCCACATCCCATCGAAAGGGG - Intergenic
1200028283 X:153276865-153276887 GAGCCACATCCCATCGAAAGGGG + Intergenic
1200897412 Y:8390274-8390296 GAGTCACATCACTTCAAGGTTGG + Intergenic
1200900818 Y:8430034-8430056 GAGTCACATCACTTCAAGGTTGG + Intergenic
1202263930 Y:22998430-22998452 GAGTCACATCACTTACAGGATGG - Intronic
1202416921 Y:24632172-24632194 GAGTCACATCACTTACAGGATGG - Intronic
1202453866 Y:25037914-25037936 GAGTCACATCACTTACAGGATGG + Intronic