ID: 1182761643

View in Genome Browser
Species Human (GRCh38)
Location 22:32727049-32727071
Sequence GGCCATGGTGGTTTGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 11, 2: 27, 3: 58, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182761643 Original CRISPR GGCCATGGTGGTTTGCTGCA TGG Intronic
902199126 1:14820816-14820838 GGCCATGGCAGTCTGATGCAGGG + Intronic
903084541 1:20843713-20843735 TGTCATGGGGGTTTGCTGTACGG + Intronic
903319186 1:22531824-22531846 GGCCAAGGTGGCTGGCTGGAAGG + Intergenic
904979297 1:34483549-34483571 TGCCATGTTGGTGTGCTGCGAGG - Intergenic
907784362 1:57597265-57597287 GGGCATGTTGATTTGCTGTATGG - Intronic
909541558 1:76797402-76797424 TGCCATGGTGATTTGCTGCACGG - Intergenic
909919801 1:81367285-81367307 TGCCATGGTGCTGTGCTGCAGGG + Intronic
912004078 1:104874090-104874112 TGCCAACGTGGTTTGCTGCACGG + Intergenic
914201688 1:145490799-145490821 TGTCATGGTGGTTTGCTGCACGG - Intergenic
914480813 1:148063923-148063945 TGTCATGGTGGTTTGCTGCACGG - Intergenic
915556027 1:156661262-156661284 GCCCATGGTGGTGAGCTGGAAGG + Intergenic
917121168 1:171645845-171645867 GGCCATGGTGGGATTCAGCAGGG - Intronic
920449671 1:206050423-206050445 GGGCATGCTGGTTTCCTCCAGGG + Intronic
922110092 1:222547923-222547945 GGCCAGGTGGGCTTGCTGCAGGG - Exonic
923089517 1:230729155-230729177 GGGCATGGTGGTGCCCTGCATGG - Intergenic
1063092964 10:2884425-2884447 TGCCATGGTGGTTTGCTGCATGG - Intergenic
1063958512 10:11286561-11286583 GGCCATGTTGGTCTGCAGTAGGG + Intronic
1068384699 10:56310439-56310461 TGCCTCGGTGATTTGCTGCATGG + Intergenic
1071027908 10:81137851-81137873 TGCCATGGCAGTTTGCTACACGG + Intergenic
1071672321 10:87620162-87620184 GGCCATTGTAGTTTGTTTCAGGG - Intergenic
1072194674 10:93107002-93107024 GGCAGTGGTGGTGTGCTCCATGG - Intergenic
1072768445 10:98115659-98115681 GGCCATGGTGGAGTTCTGCCGGG - Intergenic
1073846976 10:107567935-107567957 GCCCATGCTGGTTTGCCACATGG - Intergenic
1076873659 10:133205564-133205586 GACCATCGTGGTTTGCTGGGCGG - Intronic
1077997554 11:7466997-7467019 GCCCAAGGTGATGTGCTGCAGGG + Exonic
1080654136 11:34245375-34245397 GTCCTGGGTGGTTTGCTGTAGGG - Intronic
1081388747 11:42503824-42503846 GTCCAGAGAGGTTTGCTGCAGGG - Intergenic
1081594139 11:44447530-44447552 GGCCACAGTGGTTTGAGGCAGGG - Intergenic
1081878827 11:46430308-46430330 TGCCATTGTGGTTTTGTGCATGG - Intronic
1082173200 11:49031105-49031127 TGCCATGGTGGTTTGCTGCCCGG + Intronic
1082688406 11:56268815-56268837 TGTCATGGTGGTTTGCTGCACGG - Intergenic
1086692570 11:89804946-89804968 TGCCATGGTGGTTTGCTGCCCGG - Intronic
1086713230 11:90034713-90034735 TGCCATGGTGGTTTGCTGCCCGG + Intronic
1092935115 12:13354219-13354241 TGCCATGCTAGTGTGCTGCATGG + Intergenic
1093252678 12:16827024-16827046 TGCCATGGTGGTTTGCTGCATGG + Intergenic
1093960929 12:25272000-25272022 GGCCATGGGGGTGAGATGCAGGG + Intergenic
1095906192 12:47380479-47380501 GGCCAGGGTGTTCTGCAGCAAGG - Intergenic
1096051124 12:48609017-48609039 TGCCATGTTGATTTGCTGCACGG + Intergenic
1096655201 12:53085849-53085871 TGCCATGGTGGTTTGCGGCACGG - Intergenic
1096692358 12:53328903-53328925 GGCCAGGGTGATGGGCTGCAAGG - Exonic
1098056340 12:66509873-66509895 TGCCATCATGGTTTGCTGCACGG - Intronic
1098380058 12:69860007-69860029 TGCCTAGGTGGTTTGCTGCAAGG + Intronic
1099583084 12:84478331-84478353 TGTCATGGGGGTTTGCTGTATGG - Intergenic
1101812765 12:108121771-108121793 GGCCATGGGGGTCTGTTGCAAGG + Intergenic
1102904823 12:116666445-116666467 GGCCCTTGTGGATTGCTGCCTGG - Intergenic
1103401335 12:120645132-120645154 GGCCATGGTGGTTTGGGTCATGG + Intronic
1103690594 12:122771138-122771160 GGCCAAGCTGCTTTGATGCATGG + Intergenic
1104873081 12:132014641-132014663 GGCCATGAGGCTTTGCTGCAGGG + Intronic
1107817182 13:44254660-44254682 GGACATGGTGGTTAGGAGCATGG - Intergenic
1108712494 13:53047364-53047386 GTCCAAGATGGTTTGCTGCCAGG + Intronic
1112387564 13:98954402-98954424 GACCAAGGTGGCTCGCTGCAAGG + Intronic
1117269172 14:54123956-54123978 GGCCATGGTTGGTGGATGCAGGG - Intergenic
1117387672 14:55232319-55232341 GGCCAGGGTGGGTTTCTGCCTGG - Intergenic
1117829770 14:59739080-59739102 TGCCATGGTGTTTTGCTGCATGG - Intronic
1118559029 14:67057511-67057533 TGCCATGGTGGTTTGCTGCACGG - Intronic
1118644783 14:67827543-67827565 TGCCATGGTGGTTTGCTGTATGG + Intronic
1120953801 14:90063992-90064014 GCCCATTCTGGTCTGCTGCAAGG - Intronic
1123115099 14:105891006-105891028 GGCTCCGGTGGTTTGCGGCAGGG - Intergenic
1125715637 15:41818425-41818447 GGACACGGGGGTTGGCTGCAGGG - Intronic
1128321292 15:66696568-66696590 GGCCATGGTGGCTTGGACCAGGG - Intergenic
1128861418 15:71077271-71077293 TGCCAAGGTGGTCTGCAGCAAGG - Intergenic
1129448236 15:75633866-75633888 GGCCAGGCTGGTTCCCTGCATGG - Intergenic
1129458996 15:75690533-75690555 GGCCATTGAGGGTGGCTGCATGG + Exonic
1129724819 15:77896360-77896382 GGCCATTGAGGGTGGCTGCATGG - Intergenic
1131514533 15:93068243-93068265 GGCCATGCTGTTTTGCTGCTTGG - Intronic
1131591397 15:93752730-93752752 TGCCATGATGGTTTGCTGCACGG - Intergenic
1132315072 15:100883734-100883756 TGCCATGGTGGTTTGCTGCATGG + Intronic
1132849983 16:2020568-2020590 GGCCAAGGCGGTTTGCTGCGGGG - Exonic
1133189856 16:4125585-4125607 GGGCGTGGTGGTATGATGCAGGG - Intergenic
1133306660 16:4813807-4813829 GGCCCCAGTGGTGTGCTGCAAGG - Exonic
1133725275 16:8531481-8531503 AGCCATGTTGGTTTTCTTCAAGG + Intergenic
1134253283 16:12590062-12590084 GACCATGGTTGTTGGCTCCAAGG + Intergenic
1136046530 16:27619580-27619602 GGCCTTGGTGGCATGTTGCATGG + Intronic
1136517712 16:30777867-30777889 GGCCATTCTGGTTTCCTTCACGG + Intergenic
1136990061 16:35146583-35146605 AGCCAGGGTGGTGTGCTGCCTGG + Intergenic
1137325794 16:47435108-47435130 TACCATGGTGGTTTGTTGCATGG - Intronic
1138781777 16:59797118-59797140 TGTCATGGGGGTTTGCTGTACGG - Intergenic
1139471456 16:67180164-67180186 GTCCATGTTGGTTGGCCGCAGGG + Exonic
1143829556 17:9640304-9640326 TGCCGTGGTGGTTTGCTGTACGG + Intronic
1144215007 17:13047626-13047648 GCTCCTGGTGCTTTGCTGCATGG + Intergenic
1146158160 17:30541815-30541837 GGCCCTGGTTGATGGCTGCATGG - Intergenic
1147579537 17:41620493-41620515 GGCCCTGGGGGTTGGGTGCATGG - Intronic
1150341272 17:64369675-64369697 GGCCATGCTGGATTGCAGCATGG + Intronic
1151534423 17:74730630-74730652 GGTCATCCTGGTTTGCTTCATGG - Intronic
1152361349 17:79834544-79834566 GGGCTTGGTGGTGAGCTGCAGGG + Exonic
1153871625 18:9326200-9326222 TGCCCTGGTGGCCTGCTGCAGGG + Intergenic
1154462160 18:14602847-14602869 TGCCATGTTGGTGTGCTGCATGG + Intergenic
1154517757 18:15191570-15191592 TGTCATGCTGGTGTGCTGCATGG - Intergenic
1154997156 18:21651679-21651701 GGCCATATTGGTTTTCTGGAGGG - Exonic
1155101027 18:22609881-22609903 GGAGATGCTGGCTTGCTGCAGGG + Intergenic
1155200575 18:23514185-23514207 TGCCATGGTGCTTTGCTGTAAGG + Intronic
1155448303 18:25936096-25936118 TGCCATGATAGTTTGCTGCACGG + Intergenic
1155501978 18:26495512-26495534 GGCCATGGGTGTTGACTGCAAGG + Intronic
1155842646 18:30665168-30665190 TGCCACAGTGGTTTGCTGCATGG - Intergenic
1159119441 18:64151635-64151657 GTCTATGGTGGTTTCATGCATGG + Intergenic
1159277477 18:66239412-66239434 GGTCATGGGGGTTTGCCGTACGG - Intergenic
1160425360 18:78775243-78775265 GGTCAGACTGGTTTGCTGCAGGG - Intergenic
1161643684 19:5439408-5439430 TGCCGTGGTAGTTTGCTGCTAGG + Intergenic
1165985374 19:39764138-39764160 TGCCGTGGTGGTTTGCTGCAGGG - Intergenic
926278382 2:11423991-11424013 TGCCATTGTGGTTTGCTGCACGG - Intergenic
926409737 2:12590518-12590540 GGCCATGGTGCCTGGCAGCATGG + Intergenic
928245654 2:29624670-29624692 TGCCATGGTGGTTTGCTGCACGG - Intronic
928562813 2:32508941-32508963 GGGCATGGCGGTGTGCTGCTTGG + Intronic
929046541 2:37796158-37796180 GAGCATGCTGGATTGCTGCAAGG - Intergenic
930981606 2:57532416-57532438 TGCCACGGTGTTCTGCTGCACGG - Intergenic
931462285 2:62459414-62459436 GGTCATGGTGACTTGCTGCTCGG + Intergenic
933042763 2:77488914-77488936 TGCCATGCTGGTGTGCTGCATGG - Intronic
937446527 2:121963125-121963147 GGCCATGTGGGTTTGCTGGAGGG - Intergenic
937840876 2:126523359-126523381 TGCCATGGTAGTTTTCTGCAGGG - Intergenic
940343151 2:152602004-152602026 GTCCAGGGTTGTTTGCTGAATGG + Intronic
940677366 2:156740945-156740967 GGCCAGGGAGGTTTGCTGCCTGG + Intergenic
940785339 2:157975282-157975304 TGCTGTGGTGGTTTGCTGCATGG + Intronic
941681220 2:168401548-168401570 AGCCCAGGTGGTTTGGTGCAGGG - Intergenic
944350328 2:198718694-198718716 TGCCATGGTGGTTTGCTGCCAGG + Intergenic
946323947 2:218973209-218973231 TGCCTTGTTGGTTTGCTGCAAGG - Intergenic
946625013 2:221602070-221602092 TGCCATGGTGGTTTGCTGCATGG - Intergenic
948548847 2:238753864-238753886 GGATATGGTGGTTTTCTGGAAGG - Intergenic
948551872 2:238778310-238778332 GGCCAAGGTGGTTTCCTGCCAGG + Intergenic
1169321557 20:4637089-4637111 GGGCATGCTGGTTGGCTCCAAGG - Intergenic
1170521204 20:17187405-17187427 GGTCATGGGGGTTTGGTGTACGG - Intergenic
1171041667 20:21769782-21769804 TGCCATGGTGGTTTGCCGCACGG + Intergenic
1171246631 20:23615415-23615437 TGCCATGTTGGTTTGCTGATGGG + Intergenic
1172817915 20:37704073-37704095 GGCCATGGTTCTTTTCTTCATGG + Intronic
1173379948 20:42531155-42531177 GCCAATGGTGGTTTTCTTCAGGG + Intronic
1174332367 20:49830451-49830473 GGCCCCAGTGGTATGCTGCAAGG + Intronic
1178404726 21:32314947-32314969 GGCCATCGTGGTGCTCTGCAAGG - Exonic
1178728339 21:35075770-35075792 GGTGATCGTGGTTGGCTGCAGGG - Intronic
1179603941 21:42499843-42499865 GGCCATGGTTGATCTCTGCAGGG + Intronic
1180088784 21:45523518-45523540 GCCCATGGGGGCTTGGTGCAGGG - Intronic
1181017051 22:20076772-20076794 GGCAATGGGGTTTTGCTGCAGGG + Intergenic
1182311604 22:29412585-29412607 GGCCATGGGTGTTTGCTGCCAGG + Intronic
1182688738 22:32141250-32141272 GGCCATGGGTGTTTGCTGCCAGG - Intergenic
1182761643 22:32727049-32727071 GGCCATGGTGGTTTGCTGCATGG + Intronic
1183735118 22:39640771-39640793 GGCCATCCTGCTATGCTGCATGG + Intronic
1184554903 22:45227845-45227867 ATCCATCGGGGTTTGCTGCAGGG + Intronic
1185059186 22:48597246-48597268 GGCCATGGTGGCGTGGTGAAGGG - Intronic
1185059266 22:48597562-48597584 GGCCATGGTGGCGTGGTGAAGGG - Intronic
950886820 3:16369541-16369563 GTCTCTAGTGGTTTGCTGCATGG - Intronic
951257226 3:20464140-20464162 TGCCATGGCGGTTTGCTGCATGG + Intergenic
952179237 3:30900702-30900724 TGCCATGGTGGTTTGCTTGGAGG + Intergenic
952306690 3:32153142-32153164 GGGCATGTAGGTTTGCTCCAGGG + Intronic
952922768 3:38297529-38297551 TCCCATGGTGGTTTGCTGCATGG + Intronic
953492495 3:43363400-43363422 GGCCATCCAGCTTTGCTGCAGGG + Intronic
954486307 3:50855747-50855769 TGCCATGGTGGTTGGCTGCACGG + Intronic
955486308 3:59438325-59438347 GGCCTTGGTGGTTTGCTTCATGG - Intergenic
956102332 3:65781489-65781511 GTACGTGGTGGTTTGCTGCATGG + Intronic
956841251 3:73142197-73142219 GGCAGAGGTGGTTTTCTGCATGG + Intergenic
960964791 3:123097262-123097284 GTGCATGGTGGTGTGCTGGAAGG - Intronic
961361642 3:126371693-126371715 GGTCAGGATGGTTAGCTGCATGG - Intergenic
961589729 3:127968695-127968717 TGCCATGGTGGTGTGCTGCACGG - Intronic
963820241 3:149883769-149883791 TGCCATGGTGGTTTGCTGCACGG + Intronic
965682792 3:171268729-171268751 GGGCTGGGTGGTGTGCTGCAAGG + Intronic
966145621 3:176808681-176808703 GGCCATGAAGGGTTGCTGCAAGG + Intergenic
969573479 4:8023563-8023585 AGCCATGGTGGCCTGCTCCACGG + Intronic
970742062 4:19250671-19250693 GCCCAGGGAAGTTTGCTGCAGGG + Intergenic
974188705 4:58475053-58475075 GGCAATGGAGAGTTGCTGCATGG + Intergenic
977999802 4:103543445-103543467 TGCCATAGTGATTTGCTGCAAGG - Intergenic
979152442 4:117337130-117337152 TGTCATGATGGTTTGCTGCACGG + Intergenic
979174777 4:117650162-117650184 TACCATGGTGGTTTGCTGCACGG - Intergenic
979484950 4:121260238-121260260 TGCCATGGTAGTTAGCTGCACGG + Intergenic
981251218 4:142603307-142603329 TGCCATGGTGGTTTGCTACATGG - Intronic
982524200 4:156456920-156456942 TGCCAAGGTGGTTTGCTGCACGG - Intergenic
982776915 4:159451560-159451582 TGCCATTGTGGTTTACTGCACGG + Intergenic
982783243 4:159512937-159512959 TGTCATGGTGATTTGCTGCACGG + Intergenic
985272198 4:188204447-188204469 TGCCATGGTGCTTTGCTGCTCGG - Intergenic
985991014 5:3561350-3561372 TGTCATCGTGGTTCGCTGCACGG + Intergenic
986055746 5:4135398-4135420 TGACATGGTGGTTCGCTGCATGG - Intergenic
987625825 5:20398969-20398991 TGCCATGGTGGTTTTCTACGTGG - Intronic
988031037 5:25762567-25762589 TGCCATGGTGGTTTGTTGCAAGG + Intergenic
989236435 5:39153520-39153542 GGCAATGGTGGTTGGCTGGCCGG + Exonic
991971714 5:72147782-72147804 GGGCTTGGTGGTTTGTTGCCTGG + Intronic
993335945 5:86659109-86659131 TGCCATGGTGGTTTGCTGCATGG + Intergenic
994135777 5:96284419-96284441 CCCCATGCTGGTTAGCTGCAGGG - Intergenic
994161661 5:96563522-96563544 GGCAATGGTAGTTTTCTCCAAGG + Intronic
994657610 5:102612979-102613001 TGCTGTGGTGGTTTGCTGCAGGG + Intergenic
995329153 5:110927575-110927597 TGCCATGGTGGTTTGCTGTGCGG + Intergenic
995696428 5:114883432-114883454 GGCTATCGTGGTTAGCTGCTTGG - Intergenic
996506048 5:124268723-124268745 TGCCATAGTGGTTTGCACCATGG + Intergenic
998505410 5:142668155-142668177 GGCCATGGTAGCTGGGTGCAAGG + Intronic
1000174751 5:158740633-158740655 GGCCATTGTAGCTCGCTGCATGG - Intronic
1001545295 5:172567348-172567370 GGCCATGGAGGTTGGCTTCCAGG - Intergenic
1001696227 5:173672140-173672162 GGCTATGGTGGTTTACTTGAAGG + Intergenic
1002616962 5:180461920-180461942 GGCAACGGTTGTGTGCTGCAGGG - Intergenic
1003965091 6:11245252-11245274 GGTGATGGTGGTTTGAAGCATGG + Intronic
1006137792 6:31906451-31906473 GGCAAAGGTGGTGGGCTGCAGGG - Intronic
1008711200 6:54229432-54229454 TGCCATAGTGGTTTGCTGCATGG + Intronic
1010493493 6:76503305-76503327 TGCCACGGTGGTTTGCTGCGCGG + Intergenic
1011380689 6:86739393-86739415 GGCCATGATGGTTTACTACCTGG + Intergenic
1012122237 6:95383847-95383869 GGCCAGGGTTGTGTGCTCCAGGG + Intergenic
1014869793 6:126579766-126579788 TGACATGGCGGTTTGCTGCACGG + Intergenic
1015192856 6:130490577-130490599 TGCCATGGTGGTTTGCTATATGG + Intergenic
1016201688 6:141418088-141418110 TGCCATGGTAGTTCGCTGTAGGG - Intergenic
1019079697 6:169422008-169422030 GGCCATGGTGGGCTGCTGGAAGG - Intergenic
1023223545 7:37945790-37945812 TGCCATGGTATCTTGCTGCACGG + Intronic
1023836745 7:44073107-44073129 GCCCCTGCTGGTGTGCTGCAGGG - Exonic
1026585051 7:71649140-71649162 GGGCTTGGTGGCTTGCTGCAAGG + Intronic
1027187359 7:75980371-75980393 CGCCCTGGTGGTTTTCTGCATGG + Exonic
1028540012 7:91932602-91932624 GGCAATGGAGGTTTTGTGCAAGG + Intergenic
1032078968 7:128849237-128849259 GGCCAGGGTGGTTGGCGGTAGGG + Intronic
1034400176 7:150856931-150856953 GGGCTTGGTGGCTTCCTGCAGGG - Exonic
1035163036 7:156965384-156965406 GGGCAAGGTGGCTTCCTGCACGG - Intronic
1035853174 8:2942250-2942272 AGCCGGGGTGGTCTGCTGCATGG - Intronic
1040655370 8:49501195-49501217 GGCCATGGTTGATTGCTGTAAGG - Intergenic
1041850631 8:62387987-62388009 GGCCATGGTGGTTTTAGCCATGG + Intronic
1042081535 8:65059687-65059709 GGCCATGGTGGTTTTGGGAAAGG - Intergenic
1044552769 8:93530353-93530375 TGCCATGGAAGTTTGCTGCTGGG - Intergenic
1044603529 8:94029175-94029197 GAGCATGGTGGTTTACAGCATGG + Intergenic
1047133471 8:122049710-122049732 GGAAATGGTGGTTTACTGCATGG + Intergenic
1047367053 8:124221337-124221359 TGTCATGGTGGTTTGCTGCACGG + Intergenic
1049523280 8:143106153-143106175 TGCCATGGTGGTTCGCTGGTTGG - Intergenic
1049523286 8:143106193-143106215 TGCCATGGTGGTTCGCTGGTTGG - Intergenic
1049523292 8:143106233-143106255 TGCCATGGTGGTTCGCTGGTTGG - Intergenic
1049523298 8:143106273-143106295 TGCCATGGTGGTTTGCTGGTTGG - Intergenic
1049523310 8:143106353-143106375 TGCCATGGTGGTTTGCTGGTTGG - Intergenic
1049523316 8:143106393-143106415 TGCCATGGTCGTTTGCTGGTTGG - Intergenic
1049523325 8:143106473-143106495 TGCCATGGTGGTTTACTGGTTGG - Intergenic
1049523331 8:143106513-143106535 TGCCATGGTGGTTTGCTGGTTGG - Intergenic
1049523337 8:143106553-143106575 TGCCATGGTGGTTTGCTGGTTGG - Intergenic
1049523343 8:143106593-143106615 TGCCATGGTGGTTTGCTGGTTGG - Intergenic
1049523355 8:143106672-143106694 TGCCATGGTGGTTTGCTGGTTGG - Intergenic
1049523367 8:143106751-143106773 TGCCATGGTGGTTTGCTGGTTGG - Intergenic
1049523373 8:143106791-143106813 TGCCATGGTGGTTTGCTGGTTGG - Intergenic
1049598041 8:143493423-143493445 GGCCTTGGTGGTTTGGGGTAGGG - Intronic
1049815215 8:144596099-144596121 GGTCATGTGGGTTTGCTGCGGGG - Intronic
1052535152 9:29737148-29737170 GAACATGCAGGTTTGCTGCATGG + Intergenic
1056045897 9:82715491-82715513 TGCCATGGTGGTTTGCTGCACGG + Intergenic
1056622719 9:88227406-88227428 GGCCATGGTGCTCAGCTGTATGG + Intergenic
1056635894 9:88330995-88331017 CGCCATGGAGCTTTGATGCAGGG + Intergenic
1058713551 9:107702341-107702363 AGCCATGGTGGTTAACAGCAGGG - Intergenic
1062572212 9:137190916-137190938 GGCCATGCTTGGTTGCTGCAGGG - Intergenic
1185798518 X:2987486-2987508 TGCCATGGTGATTTACTGCACGG + Intergenic
1186747220 X:12582606-12582628 GTCCATAGTGCTTTCCTGCAGGG - Intronic
1188270091 X:28128455-28128477 TGCCATGGTGGTTTGCTGCATGG + Intergenic
1190502546 X:51094173-51094195 TGCCATGGTGATTTGCTGCACGG + Intergenic
1191707330 X:64106899-64106921 TGCCATGGTGGTTCACTGCACGG - Intergenic
1191816174 X:65247809-65247831 TGTCATGCAGGTTTGCTGCACGG - Intergenic
1193259258 X:79386148-79386170 TGCCATGGTGGTTTGCTGCACGG - Intergenic
1194329820 X:92567925-92567947 TGCCATGGTGGTTTGTCGCATGG - Intronic
1196372079 X:114990457-114990479 TGCTATAATGGTTTGCTGCATGG - Intergenic
1199150472 X:144479011-144479033 TGCCATGGTATTTTTCTGCACGG - Intergenic
1199559277 X:149146148-149146170 GTCAATGGATGTTTGCTGCATGG - Intergenic
1200022683 X:153225466-153225488 GGCCATTGTGGTTTTCCACAGGG - Intergenic
1200132700 X:153859846-153859868 GGGCATGTTGGTATGCTGCTGGG + Intergenic
1200314684 X:155119639-155119661 GGTTATGGTGGTTTACAGCAAGG + Intronic
1200638524 Y:5687107-5687129 TGCCATGGTGGTTTGTCCCATGG - Intronic
1200834634 Y:7721325-7721347 GTCTCTAGTGGTTTGCTGCATGG - Intergenic