ID: 1182767185

View in Genome Browser
Species Human (GRCh38)
Location 22:32765939-32765961
Sequence TGGAGGGCCCCTGGGTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182767185_1182767194 21 Left 1182767185 22:32765939-32765961 CCTGTAAACCCAGGGGCCCTCCA 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1182767194 22:32765983-32766005 GCTCTTTGTCCAGATGAGAGAGG 0: 1
1: 0
2: 1
3: 13
4: 145
1182767185_1182767195 25 Left 1182767185 22:32765939-32765961 CCTGTAAACCCAGGGGCCCTCCA 0: 1
1: 0
2: 1
3: 14
4: 133
Right 1182767195 22:32765987-32766009 TTTGTCCAGATGAGAGAGGCTGG 0: 1
1: 0
2: 1
3: 35
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182767185 Original CRISPR TGGAGGGCCCCTGGGTTTAC AGG (reversed) Intronic
900422350 1:2561041-2561063 GGGAGGGCCCCTGGGCTTCAGGG + Intronic
903050205 1:20594944-20594966 TGCAGTGCCCCTAGGGTTACAGG - Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904074338 1:27829111-27829133 GGGAGGGCCTCTGGTTTTAATGG - Intergenic
904311262 1:29631098-29631120 TGCAGGGTTCATGGGTTTACTGG - Intergenic
906140719 1:43531947-43531969 TGGAGAGACCCTGGGATTGCAGG - Intronic
909674595 1:78225276-78225298 TGGAGTTCCCCTGGATTTCCTGG + Intergenic
913531067 1:119734811-119734833 TGGAGGGCCCATTTGTTAACTGG - Intronic
915487233 1:156230159-156230181 TGGCGGGCCACTGGGTAAACAGG - Intronic
918094635 1:181324752-181324774 TGGAGGTTCCCTGGGTTTACAGG + Intergenic
1064295188 10:14073116-14073138 TGGAGGTACCCTGGGTTTCCTGG - Intronic
1070280398 10:75044068-75044090 TGGGTGGCCCCTGAGTTTCCCGG - Intronic
1072919697 10:99565881-99565903 TGGTGAGACCCTTGGTTTACAGG - Intergenic
1074383183 10:112996636-112996658 TGGAGGGCACCTGGGATTTCCGG + Intronic
1074832154 10:117256518-117256540 TGGAGGGCGCCTGGGAGAACTGG + Intronic
1076373609 10:129969458-129969480 TGGAGCGCCCATGGTTTTCCAGG - Intergenic
1076742513 10:132493810-132493832 TGGAGGGCTCTTGGGATAACTGG - Intergenic
1077954400 11:6999246-6999268 AGGATGGTCCCTGGGTTTTCTGG + Intergenic
1079082042 11:17420479-17420501 TCAAGTGCCCCTGGGTTTCCTGG - Intronic
1082175233 11:49050193-49050215 TGGCGGGCCCCAGGCTTTCCCGG - Intergenic
1083667991 11:64285696-64285718 TGGCGGGCGCCCGGGGTTACGGG - Intronic
1090400061 11:126443302-126443324 TGGAGGGCCGCTGATTTCACTGG + Intronic
1091310728 11:134573533-134573555 CTGATGGCCCCTGAGTTTACTGG + Intergenic
1100329241 12:93570024-93570046 TGGAGGCCCCCTGGCCTTAGTGG - Intronic
1104760790 12:131296644-131296666 TGGGGTGCCCCTGGGCTGACGGG - Intergenic
1104964905 12:132504544-132504566 TGGAGGGCCCCTGTGTGCGCAGG + Intronic
1105038076 12:132940906-132940928 TTGAGGTCCCCTGTGTCTACTGG + Intronic
1113846990 13:113397844-113397866 TGAAGAGCCCCTGGGCTGACTGG - Intergenic
1113991305 14:16029932-16029954 TGGAGGGGCCCTGGGATCCCCGG + Intergenic
1114131636 14:19799933-19799955 TGGAGGCCCCCCGGGGTCACGGG - Intronic
1114234538 14:20812812-20812834 TGGAGGCCCCCTGTGTGTTCTGG - Intergenic
1119302854 14:73584934-73584956 TGGAGGGCCCAAGGTGTTACGGG - Intergenic
1119586735 14:75842801-75842823 TGAAAAGCCGCTGGGTTTACAGG - Intronic
1121017592 14:90557854-90557876 TGGAAGGCGACTGGATTTACAGG + Intronic
1121183993 14:91950741-91950763 TGGGGGGCCCCTGGCTTTAGAGG - Intergenic
1121979534 14:98442611-98442633 TGGAAGGCCCCTGGGTTTGAAGG + Intergenic
1122374320 14:101248257-101248279 TGGAGGAACCCTGGGTTCACAGG + Intergenic
1123762974 15:23446861-23446883 TGGAGAGCCCCAGGGTTCACCGG + Intronic
1124964626 15:34423873-34423895 TGGTGGCCCCCTGGGTGCACAGG - Intronic
1126672372 15:51127934-51127956 TGGAGGGGCCCTGGGTCTTGAGG + Intergenic
1127327892 15:57913281-57913303 TCCAGAGCCCCTGGGTTTCCAGG + Intergenic
1128221064 15:65969054-65969076 TGGAGGGCCCCTTGGCTTTAGGG + Intronic
1129664585 15:77572410-77572432 TGGAGGGTCCCTGGGTTCTGGGG + Intergenic
1130097563 15:80867387-80867409 TGGAGGGCCTCTGGGGTTTTTGG + Intronic
1130676946 15:85961205-85961227 TTGAGGGCTCCTGTGTTTGCTGG + Intergenic
1132632085 16:922969-922991 TGAAGGTCGCCTGGGTTTTCGGG + Intronic
1132632096 16:923034-923056 TGAAGGTCGCCTGGGTTTTCGGG + Intronic
1133770925 16:8866975-8866997 TGGAGGCCCCCTTGGGTTCCCGG - Intronic
1133878697 16:9760695-9760717 TGGCAGCCCCCTGGGTTTAGAGG + Exonic
1134109617 16:11506954-11506976 TGGAGGTCCCCTGGGCTGAGGGG - Intronic
1134588882 16:15435546-15435568 TGGGGAGCCCCCGGGTTTGCAGG - Intronic
1135465886 16:22684457-22684479 TGGGTGACCCCTGGGTTTGCTGG + Intergenic
1136043862 16:27600674-27600696 TGGAGGGGGCCTGGGATTACTGG - Intronic
1138492021 16:57382492-57382514 TGGAGGGGTCCTGGGTGGACGGG - Exonic
1147838369 17:43351451-43351473 TTGAGGGCTCCTTGGTTTAGTGG - Intergenic
1147962748 17:44177807-44177829 AGGAGGGCCCCTGGGTAGAGAGG + Intronic
1148699243 17:49578054-49578076 GGGAGAGCCCCTGGTTTGACAGG - Intronic
1148757694 17:49982633-49982655 TGGAGGGAATCTGGGGTTACAGG - Intergenic
1150623481 17:66825297-66825319 TGGAGGGCCCCCGAGTTGAGAGG - Intergenic
1150817203 17:68401588-68401610 TGCAGGGACCCTGGGTTTGGAGG - Intronic
1150922077 17:69494531-69494553 TGGAGAGCCCCTGGATTAAAAGG + Intronic
1152346598 17:79756280-79756302 TGGAGGGTCTCTGGGTTTCAGGG - Intergenic
1154067181 18:11118289-11118311 TGGAGGGGCCCTGGGGGTACAGG + Intronic
1157220655 18:45826538-45826560 TTGAGGGCACCTGGGATTAATGG + Intronic
1157451916 18:47795389-47795411 TGGCGGGCCCCTGGTTCTCCTGG - Intergenic
1161297178 19:3526027-3526049 GGGAGGGGCCCTGGGCTTCCCGG - Intronic
1161363844 19:3867672-3867694 GGGTGGGCACCTGGGTTTCCAGG - Intronic
1161641270 19:5424836-5424858 TGGAGGGCCACTGGGGTTGCTGG + Intergenic
1164035567 19:21451063-21451085 TGGTGGGCACCTGGGATTACAGG + Intronic
1164465281 19:28482467-28482489 TGGAGAGCCCCTGTCTTTGCTGG + Intergenic
1164656553 19:29926029-29926051 TGGAGGGCTCCTGGGGTTCTAGG + Intronic
1165618998 19:37228201-37228223 TAGAGGGCTCCTTGGTCTACCGG - Intronic
1166733403 19:45071031-45071053 GGGAGGGCGCTTGGGTTTACAGG + Intergenic
1167048612 19:47066010-47066032 TGGAGGCCCAGTGGGTTTTCTGG - Exonic
1167236512 19:48319065-48319087 TGGAAGGCCTCTGGGTCTTCTGG + Intronic
1168455265 19:56502577-56502599 TGGAGAGACCCTGGGTAGACAGG - Intergenic
1168492418 19:56821908-56821930 TGTAGGGCCACTGGTTTTATGGG - Intronic
926147432 2:10405203-10405225 AGCAGGGCCCCTGGGTCTGCGGG + Intronic
927865115 2:26583179-26583201 TGCAGAGCCCCTGTGTGTACTGG - Intronic
928842365 2:35625570-35625592 GGGAGGCCCTCTGGGTTTCCTGG + Intergenic
930599867 2:53430611-53430633 GGGAAGGCCCCTGGGTTACCAGG - Intergenic
931709351 2:64974711-64974733 TGGAGACACCCTGGGTTAACAGG + Intergenic
931750331 2:65324584-65324606 TGGAGGGACCTTGAGTTTACTGG + Intronic
932468641 2:71939799-71939821 TGGAGGGGCCCTGGCTTAGCCGG - Intergenic
937111632 2:119371162-119371184 GGGAGGGCCACTGGGGTTAGGGG - Intronic
937916027 2:127099114-127099136 TGGAGGCTCCCTGGGTTTGAGGG - Intronic
940283536 2:152011267-152011289 TGGAGGGACCTGGGGGTTACTGG - Intronic
942463695 2:176187744-176187766 TGGAGGGCGCAAGGGCTTACCGG - Intergenic
1169091592 20:2864301-2864323 TGGGGGGCCCCTGGGCTAAGTGG + Intronic
1170047610 20:12102104-12102126 TAAAGGGCCCCTGGGTTATCTGG + Intergenic
1173458680 20:43224440-43224462 TGGAGAGCCCATGGGGTTAGAGG - Intergenic
1174613153 20:51815569-51815591 TGGGGAACTCCTGGGTTTACAGG + Intergenic
1175140473 20:56857230-56857252 TGGAGTGCAGCTGGGTTTGCAGG - Intergenic
1175366437 20:58459559-58459581 TGGTGGGCCCAAGGGTTTTCAGG - Exonic
1175708330 20:61198399-61198421 TGGAGGAGCCCTGGGTTGTCTGG - Intergenic
1176150617 20:63588988-63589010 GGGAGAGCCCCTGGGTGTTCAGG - Exonic
1180253876 21:46608995-46609017 TGGAGGGCCCCTAAGTTTTGTGG - Intergenic
1180315963 22:11277592-11277614 TGGAGGGGCCCTGGGATCCCCGG - Intergenic
1181726353 22:24813767-24813789 AGGAGGGCCCCTGGCTTGCCTGG + Intronic
1182767185 22:32765939-32765961 TGGAGGGCCCCTGGGTTTACAGG - Intronic
1183641462 22:39095439-39095461 TGCATGGCCCCTGGGGTCACAGG - Intergenic
1185381460 22:50509839-50509861 TGGAGGGGCCATAGGTTGACTGG - Intronic
949394865 3:3603827-3603849 TGGAGGACCCCTGGCATTCCAGG + Intergenic
961892911 3:130145495-130145517 AGGATGGCCCCTGTGTTTAAGGG - Intergenic
968903926 4:3443253-3443275 TGGAGGGTCTCTGGGTTCACTGG - Intronic
968953463 4:3706558-3706580 GGCAGGGCCCCTGTGTTCACAGG - Intergenic
969715446 4:8866067-8866089 AGGAGGCCCCCTGGGCTTGCTGG + Intronic
988941309 5:36151226-36151248 TGGAGGCCCCCTGCGTGCACGGG + Intronic
988987179 5:36631885-36631907 TGGAGGATCCCTGTGTATACTGG + Intronic
989099953 5:37814068-37814090 TGGAAGGCCCCTGTGTCTCCCGG + Intronic
997742501 5:136269375-136269397 GGGTGGGCACCTGCGTTTACTGG + Intronic
999804496 5:155069223-155069245 CGGAGGTCACCTGGGATTACTGG - Intergenic
1004914758 6:20321263-20321285 TGGTGGGCTCCTGGTCTTACTGG - Intergenic
1007465399 6:42048228-42048250 TGGAAGCCCCGTGGCTTTACCGG - Intronic
1010227766 6:73506957-73506979 TGGATGACCTCTGGGATTACAGG + Intronic
1015086038 6:129293064-129293086 TGCAGCGCCTCTGGGATTACCGG - Intronic
1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG + Intronic
1019174768 6:170154402-170154424 TGGAGGGGCCCTGGGTTCTGTGG - Intergenic
1019174782 6:170154442-170154464 TGGAGGGGCCCTGGGTTCTGTGG - Intergenic
1019174804 6:170154503-170154525 TGGAGGGGCCCTGGGTTCTGTGG - Intergenic
1019174812 6:170154523-170154545 TGGAGGGGCCCTGGGTTCTGTGG - Intergenic
1019174820 6:170154543-170154565 TGGAGGGGCCCTGGGTTCTGTGG - Intergenic
1019174850 6:170154624-170154646 TGGAGGGGCCCTGGGTTCTATGG - Intergenic
1019174858 6:170154644-170154666 TGGAGGGTCCCTGGGTTCTGTGG - Intergenic
1019174873 6:170154685-170154707 TGGAGGGGCCCTGGGTTCTATGG - Intergenic
1019174886 6:170154725-170154747 TGGAGGGTCCCTGGGTTCTGTGG - Intergenic
1019174893 6:170154745-170154767 TGGAGGGGCCCTGGGTTCTGTGG - Intergenic
1019174927 6:170154845-170154867 TGGAGGGGCCCTGGGTTCTGTGG - Intergenic
1022634745 7:32120615-32120637 TGGAGGGCTGCTGTCTTTACTGG - Intronic
1024703966 7:51937991-51938013 AGCATGGCCCCTGGGTTCACAGG + Intergenic
1024962742 7:54994617-54994639 TGTAGGGCCCTAGGGTGTACGGG - Intergenic
1038496561 8:28007503-28007525 TGGAGCGTCCCTGGGTTACCAGG - Intergenic
1039630635 8:39107892-39107914 GGGAGGGCCCCGGGCTTTGCAGG - Intronic
1044304607 8:90624049-90624071 TTGAGAGCACCTGGGTCTACAGG - Exonic
1046635509 8:116670916-116670938 TGGAGGGCCACTAGGATTAGAGG + Intronic
1046820632 8:118630541-118630563 TGGAGAGCCCATGGGTCCACTGG - Intergenic
1048972392 8:139652521-139652543 TGGAAGGCCCCTCTGCTTACAGG - Intronic
1056666828 9:88587984-88588006 TGGAGCGTCCCTGGGTGTGCAGG + Intergenic
1057945709 9:99326267-99326289 TGTTAGGCCACTGGGTTTACAGG - Intergenic
1058855777 9:109060771-109060793 TGGAAGGTCACTGGGATTACAGG - Intronic
1060430992 9:123551485-123551507 TGGAGGGAACCTGGGTTTGGAGG + Intronic
1062014360 9:134283818-134283840 TGGATGACCCCTGTGTTTCCCGG - Intergenic
1203364260 Un_KI270442v1:243546-243568 TGGAGGGGCCCTGGGATCCCCGG - Intergenic
1190274971 X:48893632-48893654 TGGAGGGTCCCAGGGCTAACTGG + Exonic
1198062357 X:133059603-133059625 TGGAGGCTCCCTGGGATCACAGG + Intronic
1202168518 Y:22017070-22017092 AGGAGGACCCCTGGTTTGACTGG - Intergenic
1202222843 Y:22569298-22569320 AGGAGGACCCCTGGTTTGACTGG + Intergenic
1202320272 Y:23626362-23626384 AGGAGGACCCCTGGTTTGACTGG - Intergenic
1202550495 Y:26043694-26043716 AGGAGGACCCCTGGTTTGACTGG + Intergenic