ID: 1182777540

View in Genome Browser
Species Human (GRCh38)
Location 22:32841988-32842010
Sequence GACCTTCTTGGTGCTCAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182777540_1182777545 11 Left 1182777540 22:32841988-32842010 CCGGACTGAGCACCAAGAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1182777545 22:32842022-32842044 CGACAAGCACTGCTTTGGAGAGG 0: 1
1: 0
2: 0
3: 11
4: 84
1182777540_1182777546 16 Left 1182777540 22:32841988-32842010 CCGGACTGAGCACCAAGAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1182777546 22:32842027-32842049 AGCACTGCTTTGGAGAGGTTAGG 0: 1
1: 0
2: 1
3: 16
4: 193
1182777540_1182777544 6 Left 1182777540 22:32841988-32842010 CCGGACTGAGCACCAAGAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1182777544 22:32842017-32842039 GACTTCGACAAGCACTGCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 87
1182777540_1182777547 17 Left 1182777540 22:32841988-32842010 CCGGACTGAGCACCAAGAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1182777547 22:32842028-32842050 GCACTGCTTTGGAGAGGTTAGGG 0: 1
1: 0
2: 0
3: 11
4: 128
1182777540_1182777548 18 Left 1182777540 22:32841988-32842010 CCGGACTGAGCACCAAGAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1182777548 22:32842029-32842051 CACTGCTTTGGAGAGGTTAGGGG 0: 1
1: 0
2: 0
3: 9
4: 210
1182777540_1182777551 23 Left 1182777540 22:32841988-32842010 CCGGACTGAGCACCAAGAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1182777551 22:32842034-32842056 CTTTGGAGAGGTTAGGGGGGAGG 0: 1
1: 0
2: 3
3: 38
4: 668
1182777540_1182777549 19 Left 1182777540 22:32841988-32842010 CCGGACTGAGCACCAAGAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1182777549 22:32842030-32842052 ACTGCTTTGGAGAGGTTAGGGGG 0: 1
1: 0
2: 3
3: 12
4: 172
1182777540_1182777550 20 Left 1182777540 22:32841988-32842010 CCGGACTGAGCACCAAGAAGGTC 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1182777550 22:32842031-32842053 CTGCTTTGGAGAGGTTAGGGGGG 0: 1
1: 0
2: 4
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182777540 Original CRISPR GACCTTCTTGGTGCTCAGTC CGG (reversed) Intronic
900473377 1:2865139-2865161 GTTCTTCCTGGTCCTCAGTCAGG - Intergenic
903138885 1:21326827-21326849 GACCCTCTCTGTGCTCAGTGGGG - Intronic
907394395 1:54179148-54179170 TACCTTCTTTGTACTCAGCCAGG - Exonic
918969362 1:191394480-191394502 GACCTTCTCGGTGCCCATTTGGG - Intergenic
919882812 1:201911974-201911996 GATCTTGTTAGTGCTCAGCCAGG - Intronic
921200207 1:212797902-212797924 GATCTTCCTGATGCTGAGTCAGG - Intronic
921318074 1:213910479-213910501 AACCTGCTTTGTGCTCAGCCCGG + Intergenic
922906008 1:229174239-229174261 GACATTCTTGTTGCCCAGGCTGG - Intergenic
924954076 1:248910663-248910685 GACCTTCTTGGCACTAAGGCAGG - Intronic
1063205321 10:3825841-3825863 GACCACCTTGGTGATGAGTCTGG + Intergenic
1069260859 10:66394597-66394619 GACAGTCCTGATGCTCAGTCTGG - Intronic
1070553542 10:77510766-77510788 GCCTTTCTTGTTGCTCAGGCTGG - Intronic
1074960403 10:118440045-118440067 GACCTTCATTGTGCTGAGGCAGG + Intergenic
1081758463 11:45560790-45560812 GGCCTTCCTGGAGCTCAGCCAGG - Intergenic
1084960357 11:72713173-72713195 CACCTTCTTGGTCATCACTCTGG + Exonic
1087519022 11:99205980-99206002 GACCTGCTTAGTGCTCTGTGAGG + Intronic
1088075752 11:105846643-105846665 GAACTTCTTGGTAATCAGTGAGG + Intronic
1090393208 11:126402854-126402876 GCTCTTCTTGGTGCTCTGCCAGG - Intronic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1093014199 12:14139781-14139803 TACCCTCAAGGTGCTCAGTCTGG + Intergenic
1093680379 12:21995666-21995688 GATCCTCTTGGTGCTCCGACAGG + Intergenic
1100367489 12:93935110-93935132 GTCCTTGTGGGTGCTAAGTCTGG - Intergenic
1104870812 12:131994158-131994180 GGCCTTCTTGGTGGGCAGTGGGG + Intronic
1106480655 13:30134791-30134813 GACTTTCTTTCTGCTCTGTCAGG - Intergenic
1113742230 13:112719185-112719207 GACCGTCTTGGTGAATAGTCAGG + Intronic
1114505949 14:23213577-23213599 CACCTTCTTGCTGCCGAGTCGGG - Intronic
1114825883 14:26078972-26078994 AACCTTCCTGGTGCTAAATCAGG - Intergenic
1120584868 14:86299920-86299942 GACCTTCTTAGTGCTCACTTGGG - Intergenic
1122163842 14:99806343-99806365 GACATTCTTGTTGCCCAGGCTGG + Intronic
1125250367 15:37695186-37695208 GAACTGCTTGGGGGTCAGTCAGG - Intergenic
1125253517 15:37734265-37734287 AACCTTGTTGATGCTCAGTTGGG - Intergenic
1128387275 15:67158799-67158821 GGCCATCTGGGTGCACAGTCAGG - Intronic
1131185190 15:90267959-90267981 CACCTTCTGAGTCCTCAGTCAGG + Intronic
1132251318 15:100337556-100337578 GAGCTCCTTGGTGGTCTGTCTGG + Intronic
1132345016 15:101102843-101102865 GACCTTGTTGGTGCTCTGTGAGG + Intergenic
1136475729 16:30512031-30512053 GAACTTCTTGGTCCTTGGTCAGG + Intronic
1136547942 16:30965880-30965902 GACCGACTTGGGGCTCAGTGGGG + Exonic
1139679747 16:68552331-68552353 GACCTTCTAGGAGCACAGTTTGG + Intronic
1142571499 17:877886-877908 GAGCTTCATGGTTCACAGTCTGG - Intronic
1144791502 17:17862088-17862110 GTCCTGCTTGGGGCTCAGTAGGG - Intronic
1145304654 17:21666815-21666837 GACCTTCTTGGTGCTACCCCTGG + Intergenic
1147965293 17:44191477-44191499 GTCCTTCATAGAGCTCAGTCAGG + Exonic
1149799572 17:59554886-59554908 GACCTTCTTGGTGCCCATTTGGG - Intergenic
1153505560 18:5793992-5794014 GTCCTTCCTGGTGCTGTGTCAGG + Intergenic
1154124114 18:11674343-11674365 GAGCTTCAGGGTGCGCAGTCTGG + Intergenic
1157430662 18:47621866-47621888 GAGCTTCTTGGGGGTTAGTCTGG - Intergenic
1157555235 18:48609180-48609202 GTCCTCCTTGGGCCTCAGTCTGG - Intronic
1158480146 18:57814741-57814763 GCCCTTTGTGGTCCTCAGTCAGG + Intergenic
1168497012 19:56861823-56861845 TACCTTCTTGGTTGTCAGTTGGG - Intergenic
929483332 2:42333704-42333726 GTCAGTCTTGGTCCTCAGTCTGG + Intronic
930428168 2:51237868-51237890 GACCTTGTTGGTGCTGTGTTTGG + Intergenic
931028335 2:58139959-58139981 AACTTTCTTGGTGCTGAGTTAGG - Intronic
932067653 2:68583588-68583610 GAACTTCTTTGTGCTTGGTCAGG - Intronic
932799796 2:74730951-74730973 CACCCTCTTGGTTCTCTGTCAGG - Intergenic
936271263 2:111050900-111050922 GACTTTCATGGTGCTCTGGCTGG + Intronic
937065317 2:119012842-119012864 GACCCTCAAGGTGCTCAGCCCGG + Intergenic
937169485 2:119851407-119851429 GACCTTCTTGGTGCCCACTTGGG - Intronic
937359131 2:121217110-121217132 GAGCTTCCTGGTGTCCAGTCCGG - Exonic
941812467 2:169768291-169768313 GACCTTCTTCGTCCTCGGGCAGG + Intronic
1169016205 20:2294703-2294725 TACCTTCAAGGAGCTCAGTCTGG + Intergenic
1171062307 20:21977762-21977784 GACCCTCTGGATGGTCAGTCAGG + Intergenic
1171153557 20:22849920-22849942 GACCTTCTTTCTGCACAGGCAGG + Intergenic
1171448340 20:25220052-25220074 GACCTTCTTGCTGCTCTGCTGGG - Intronic
1171522169 20:25784254-25784276 GACCTTCTTGGTGCTACCCCTGG + Intronic
1171529919 20:25846199-25846221 GACCTTCTTGGTGCTACCCCTGG + Intronic
1171554658 20:26071629-26071651 GACCTTCTTGGTGCTACCCCTGG - Intergenic
1173994092 20:47324487-47324509 GAGCTTCTTGTTGCCCAGGCTGG - Intronic
1174393533 20:50232705-50232727 GAGCTTCTTGGGGCACAGTGAGG - Intergenic
1175229873 20:57467011-57467033 GACATTTTTGGTTGTCAGTCTGG + Intergenic
1175751215 20:61499286-61499308 GACCTTCATGCTGCTCACTCTGG + Intronic
1176655970 21:9589251-9589273 GACCTTCTTGGTGCTACCCCTGG + Intergenic
1180928262 22:19570957-19570979 TCCCTTCTTGCTGCTCAGTTAGG + Intergenic
1181118840 22:20651781-20651803 GATCTCATTGGTGCTCAGGCTGG - Intergenic
1181722396 22:24785911-24785933 GACCTTGTTTCTGCTCTGTCTGG + Intergenic
1182292567 22:29292792-29292814 TTCCTTCTTGGTGCCCAGGCTGG + Intronic
1182777540 22:32841988-32842010 GACCTTCTTGGTGCTCAGTCCGG - Intronic
1184038426 22:41929318-41929340 GAGCTGCCTGGTACTCAGTCAGG - Intergenic
1184311663 22:43649121-43649143 CACCTTCTGGGTTCTCAGCCCGG - Intronic
1184737128 22:46405923-46405945 GGCCTTCTGGGTGCCCAGTGGGG + Intronic
951879982 3:27471432-27471454 CACATTCTTGTTGCTCAGGCTGG + Intronic
952499676 3:33949058-33949080 GACCATCTCTGTGCACAGTCTGG + Intergenic
955041272 3:55320056-55320078 GATCTTGGTGGTGCTCAGGCAGG + Intergenic
955649208 3:61175403-61175425 GACTTTCCTAGAGCTCAGTCTGG - Intronic
956469555 3:69552164-69552186 CACTTTCTTGGTTCTCATTCAGG + Intergenic
962626888 3:137234559-137234581 GATTTTTTTGGTGGTCAGTCAGG - Intergenic
962850960 3:139308020-139308042 GGCCTCCTTGCTGCTCAGTAAGG + Intronic
964166845 3:153717948-153717970 GACCTTCATGTTGCTAATTCTGG + Intergenic
970460299 4:16268479-16268501 GAACTTCTTTGTCGTCAGTCAGG - Intergenic
976469323 4:85409336-85409358 GATTTTCTTGATTCTCAGTCAGG + Intergenic
979251793 4:118573584-118573606 GAGCTTCTTGGTGGTAAGGCCGG + Intergenic
980935316 4:139220460-139220482 GACCATCCTGTTGCTCAGGCTGG - Intergenic
981080000 4:140630392-140630414 GAACTTCTTTGTCTTCAGTCAGG - Intronic
982803528 4:159734240-159734262 TACCTACTTGGTGTTCAGTTTGG + Intergenic
986251060 5:6058982-6059004 GACATTCCTGGGGCTCAGCCTGG - Intergenic
988964514 5:36402950-36402972 TACCTTCTTAGTGATCTGTCTGG - Intergenic
991436122 5:66597805-66597827 GTCCTTCTGGCTGCTCTGTCCGG + Intronic
1001587323 5:172842074-172842096 TTCCTTCTTGTTGCTCAGGCTGG + Intronic
1004963240 6:20816748-20816770 GACATTCCTGGTGCTCATCCTGG + Intronic
1011379052 6:86722905-86722927 GACATTTTTGGTGATAAGTCTGG - Intergenic
1012467485 6:99531736-99531758 GGCCTTCTTGCTTCTCACTCCGG - Intergenic
1012952496 6:105533707-105533729 AACATTCTTGGTACTGAGTCCGG - Intergenic
1014811335 6:125889632-125889654 GCCCTTCTTTGTTCTTAGTCAGG - Exonic
1015591910 6:134830284-134830306 TGCCTGCTTGGTGTTCAGTCTGG - Intergenic
1017819742 6:158040802-158040824 CACCCTCTGGCTGCTCAGTCTGG + Intronic
1018626888 6:165788486-165788508 TTCCTTCTTGTTGCTCAGGCTGG - Intronic
1020009766 7:4801626-4801648 GCCCTGCCTGGTGCTCAGGCGGG - Intronic
1023151218 7:37203111-37203133 GACCTTCTTGGTCCTCCTTGTGG - Intronic
1023873644 7:44275781-44275803 GGCCTTCTGGGGGCTCAGTGGGG - Intronic
1024318512 7:48043274-48043296 GTCCTGCTTTGTGCTCAGGCAGG - Intronic
1026679782 7:72457036-72457058 TTCCTTCTTGTTGCTCAGGCTGG + Intergenic
1030224930 7:107139573-107139595 GACCCTCTTGGTGCTCTGCAAGG + Intronic
1034106733 7:148496786-148496808 AACCTTCTGGGAGCTGAGTCAGG - Intergenic
1036010498 8:4716289-4716311 GACCTTCTTTGTGCCCTTTCTGG - Intronic
1036047461 8:5159905-5159927 GACTTCCTTGGTGCTCAAACAGG + Intergenic
1039787774 8:40848947-40848969 GAGCTCCTTGCTGCTGAGTCTGG - Intronic
1039884285 8:41646466-41646488 CGCCTTCTCGGTGCTCAGCCTGG - Exonic
1042215688 8:66428611-66428633 GACAGTCTTGGGGCTCAATCCGG - Intergenic
1043855017 8:85255144-85255166 GACTTTCTTTGTTCTCAGGCTGG + Intronic
1045104265 8:98876062-98876084 GTGGTTCTTGGTGTTCAGTCTGG + Intronic
1045124543 8:99074663-99074685 GACAATCTTGTTGCTCAGGCTGG + Intronic
1047067573 8:121302695-121302717 GACCTTCTGGGGGCTCTGTGTGG - Intergenic
1047764766 8:127981389-127981411 CACCTTCCTGGTGCCCTGTCAGG - Intergenic
1051173172 9:14340028-14340050 GACCTCTTTGGGCCTCAGTCTGG - Intronic
1051864811 9:21667765-21667787 GAACTACTTGGTGTTCAGTTTGG - Intergenic
1056350047 9:85741270-85741292 CACCTTGCTGGCGCTCAGTCGGG + Intronic
1056672987 9:88647247-88647269 GTCCTTCTTGGGACTCAGCCAGG - Intergenic
1056993262 9:91430536-91430558 GCCCCTCTTGGTACACAGTCTGG - Intergenic
1062485527 9:136773108-136773130 GAACTTCTTTGTCCTTAGTCAGG + Intergenic
1203633687 Un_KI270750v1:92711-92733 GACCTTCTTGGTGCTACCCCTGG + Intergenic
1189727042 X:43977661-43977683 GACATTTATGGTGCTCAATCTGG + Intergenic
1194648074 X:96482703-96482725 GACCTTCTTGGTGCCCACCTGGG - Intergenic
1195873752 X:109516006-109516028 GATCTTCTTTTTTCTCAGTCTGG - Intergenic