ID: 1182779518

View in Genome Browser
Species Human (GRCh38)
Location 22:32856490-32856512
Sequence GAGGAGTCTCAGTACCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182779518_1182779522 16 Left 1182779518 22:32856490-32856512 CCTTCTGGGTACTGAGACTCCTC 0: 1
1: 0
2: 5
3: 14
4: 173
Right 1182779522 22:32856529-32856551 TTTTATTGATACATAATAAATGG 0: 1
1: 4
2: 13
3: 56
4: 681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182779518 Original CRISPR GAGGAGTCTCAGTACCCAGA AGG (reversed) Intronic
900980422 1:6043193-6043215 GAGCAGCCTCAGTCCTCAGAAGG + Intronic
902198869 1:14819067-14819089 GAAGATACTCAGTACCAAGAAGG + Intronic
904292375 1:29496571-29496593 GTACAGTGTCAGTACCCAGAAGG + Intergenic
905253770 1:36666604-36666626 GAGGATTCTGAGGAGCCAGAGGG - Intergenic
906210218 1:44008647-44008669 GAGGAGCCTCAGCATCCAGCAGG + Intronic
907283050 1:53363232-53363254 GAGGGGACTCAGTACCCAGAGGG - Intergenic
907318204 1:53586049-53586071 GGGGAGACTGAGTCCCCAGATGG - Intronic
907867080 1:58408779-58408801 GTGGAGACTCAGTTCCCACAGGG + Intronic
909922789 1:81402321-81402343 GAGAAGTTTCTGTACCCAGCAGG - Intronic
911048024 1:93644709-93644731 GAGAAGACTCAGGACCCTGAAGG + Intronic
912355746 1:109053303-109053325 GAGGCTCCTCAGTTCCCAGACGG - Intergenic
912414536 1:109499069-109499091 GAGGGGTATCTGAACCCAGAAGG - Intronic
913555016 1:119957185-119957207 GAGGACTGTGAGTTCCCAGAAGG - Intronic
914222340 1:145692256-145692278 AAGGACTCTCAGGCCCCAGACGG + Intronic
916037301 1:160933239-160933261 GAGGCTCCTCAGTTCCCAGACGG - Intergenic
916577578 1:166081348-166081370 GAGGACTCTGAGAACCCAGCTGG - Intronic
917033533 1:170721433-170721455 GAGGAGGCACAGTACACAGTGGG + Intronic
919777577 1:201204346-201204368 GAGGAGTGTCAGTTCCTAGATGG - Intronic
919850430 1:201668574-201668596 TTGGAGTCTCAGTCCCCAGAAGG - Intronic
919927145 1:202197873-202197895 GAGCAGTGTCAGTAAACAGATGG + Intronic
920553060 1:206881111-206881133 CAGTAGTCTCACTACCCAGGAGG + Intergenic
922179736 1:223224373-223224395 GTGGACCCTCAGTGCCCAGAGGG + Intronic
922583105 1:226713158-226713180 GAGGAGACTCCGGACCCAGCTGG + Intronic
1064733226 10:18354668-18354690 GAGGAGTCTCAGGACCCAGCAGG + Intronic
1065377903 10:25061377-25061399 GAGGAGTAACAGTGCACAGATGG + Intronic
1065575660 10:27115399-27115421 GAGGATTCTCTGAACCCAGGAGG - Intronic
1065943284 10:30584197-30584219 AAGGAGGCACAGTAGCCAGAAGG + Intergenic
1066022215 10:31315488-31315510 TAGGAGCCTCATTCCCCAGAGGG + Intergenic
1069777839 10:70937184-70937206 GAGGAGTCTCAGAAGCCATGGGG + Intergenic
1071262789 10:83936006-83936028 GAGGAGGCCCAGGACCAAGAGGG - Intergenic
1074111960 10:110429138-110429160 GAGGGGTTTCAGTTCCCAGGAGG - Intergenic
1075161075 10:120025010-120025032 AAGGAGTATCAGCACCAAGATGG + Intergenic
1076055941 10:127372949-127372971 CCGGAGTCCCAGTACTCAGATGG + Intronic
1077571103 11:3339220-3339242 GAGGTGCTTCAGTTCCCAGAGGG + Intergenic
1081645623 11:44788188-44788210 CAGGACCCTCAGTCCCCAGATGG + Intronic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1082953866 11:58847751-58847773 GAGGAATCTCACTGCCCTGATGG + Intronic
1083484499 11:62974933-62974955 GAGGAGTTTCAGCACCAAGGGGG + Intronic
1083682666 11:64358642-64358664 GAGGAGCCTCATCACCAAGAGGG - Intergenic
1084324450 11:68391578-68391600 GAGGAGTCTCAGCACCTTCAGGG + Intronic
1088008846 11:104974377-104974399 GAGAAGACTCAGGACCCGGAAGG - Intergenic
1088124632 11:106408985-106409007 GAGGAGTCGCAGTGCCTGGAAGG + Intergenic
1092722736 12:11458047-11458069 GATGAGCCCCAGAACCCAGATGG + Intronic
1093247631 12:16759786-16759808 CAGGCGACTCAGTACCCAGGAGG - Intergenic
1093433023 12:19105346-19105368 GATGACTCCCAGAACCCAGATGG + Intergenic
1096001629 12:48135086-48135108 CAGGAGACTCAGAAGCCAGAAGG - Intronic
1096321062 12:50613227-50613249 TATGAGTCTCAGTTTCCAGATGG - Intronic
1097057048 12:56256699-56256721 AAGAAATCTCAGTGCCCAGAGGG + Intronic
1098655995 12:73030053-73030075 GTGGGGTCTCAGTACATAGACGG - Intergenic
1099234059 12:80061161-80061183 GAGGAGTCTGTGATCCCAGAAGG + Intergenic
1103406658 12:120680625-120680647 GAAGAGTGTCAGTCCCCAGGTGG - Intergenic
1104357895 12:128104428-128104450 GAGGAGTGTGGGAACCCAGATGG - Intergenic
1109314452 13:60733914-60733936 GAGGAGTCTCAGTCTCTAAAGGG - Intergenic
1113311149 13:109134554-109134576 AAGGAGTCACAGTCCTCAGATGG - Intronic
1114215676 14:20656064-20656086 CAGGTGTCCCAGTCCCCAGAGGG + Intergenic
1114537115 14:23430010-23430032 TGGGAGTCTCAGAACCCACAGGG - Intronic
1117086458 14:52206747-52206769 GAGGGGTCACAGAAGCCAGAAGG + Intergenic
1119003497 14:70904422-70904444 GAGTACTCTCAGTCCCCAGGAGG + Intergenic
1119558068 14:75568530-75568552 GAGGAGGGGCAGTTCCCAGAAGG - Intergenic
1120974825 14:90239378-90239400 GAGAAGACTCAGGACCCTGAAGG + Intergenic
1121310363 14:92932417-92932439 GAGGAGGCTCAGGACCCCGAAGG + Exonic
1122026174 14:98878991-98879013 AAGGAATATCAGTACCAAGAGGG + Intergenic
1122717180 14:103702747-103702769 GAGGAGGCTCAGGAGCCTGACGG - Intronic
1123683460 15:22780847-22780869 GAGGAGTGTTTGAACCCAGAAGG - Intronic
1126267664 15:46773590-46773612 GAGAAGACTCAGGACCCGGAAGG - Intergenic
1126645906 15:50874654-50874676 GAGAAGACTCAGGACCCTGAAGG - Intergenic
1128106652 15:65050234-65050256 GGGGTGTCTCAGTACCCAGAGGG + Intronic
1128960569 15:71999309-71999331 TAGGAGCCTCAGTATACAGATGG + Intronic
1134195582 16:12156817-12156839 GAGGAAACTCAGTGCCCAGAGGG - Intronic
1137006164 16:35275899-35275921 GAGGAGCCTAAGTCCCCACAAGG - Intergenic
1137367152 16:47870518-47870540 GAGGGGTCTCAGAGCCAAGATGG + Intergenic
1141663238 16:85452928-85452950 GAGGACCCTCAGTGCCCACAGGG - Intergenic
1141720663 16:85753515-85753537 GAAGATTCTCAGCACCCACAGGG - Intergenic
1142727067 17:1823548-1823570 GGGGAGTCTCAGTACCCAGGCGG - Intronic
1146585317 17:34077117-34077139 GAGGAGGCTCTGGAGCCAGATGG - Intronic
1146639384 17:34528323-34528345 GAGGATTCTGAGAACACAGATGG - Intergenic
1147445952 17:40475416-40475438 GAAGAGTCCCCGAACCCAGATGG - Intergenic
1149042080 17:52202251-52202273 TAGGAGTCTGGCTACCCAGAGGG + Intergenic
1150644430 17:66969185-66969207 GAGGAGACTCTGGGCCCAGAGGG + Intronic
1151371454 17:73648714-73648736 GAGGTGTCTCAGTTCCCTGCAGG - Intergenic
1151705418 17:75764713-75764735 GAGGAGCCCCAGCCCCCAGAGGG + Intronic
1153140515 18:1967179-1967201 CAGCAGTCTCAGAACCCACATGG - Intergenic
1157618004 18:48998738-48998760 GAGGAATGTCAGAGCCCAGAGGG - Intergenic
1164263847 19:23594582-23594604 GAGGATCCTCACTTCCCAGATGG - Intronic
1167693901 19:51002968-51002990 GCGGAGTCTTAGTGTCCAGAGGG + Exonic
927297457 2:21470879-21470901 CAGGAGACTCATTTCCCAGAGGG - Intergenic
927716413 2:25356113-25356135 GGGGAGTCTCCTTCCCCAGATGG - Intergenic
927846188 2:26473933-26473955 GAGGAGTCTGAGGACCCAGGAGG - Intronic
927960137 2:27236167-27236189 GAGGAGACTGAGGACCCATAGGG - Intronic
928194234 2:29203118-29203140 GAGGATTCGCAGTTCCCAGGTGG + Intronic
931418087 2:62100270-62100292 GAGAAGACTCAGGACCCTGAAGG - Intronic
933726314 2:85429609-85429631 GAGGAGTCCCAGTACTCACCGGG - Intronic
934663505 2:96155273-96155295 GAGGGGCTTCAGTCCCCAGAGGG - Intergenic
937646108 2:124267939-124267961 GAAGAGTCTGAGTATGCAGAGGG + Intronic
944583219 2:201150951-201150973 GAGGAGTCCTGGAACCCAGAGGG + Intronic
944795982 2:203185742-203185764 GAGGAGTCTGACTACCCAGTTGG - Intronic
947935217 2:233998432-233998454 CAGGACTCTCAGTACTAAGATGG - Intronic
947957554 2:234206545-234206567 GAGGATTCTAAGTTCCAAGAGGG + Intergenic
948465202 2:238148792-238148814 GAGGGGTCACTGTCCCCAGAGGG + Intronic
1172804540 20:37602221-37602243 GAAGAGTCTCAGGACCCAATTGG - Intergenic
1174068493 20:47883220-47883242 AAGGGGACTCAGGACCCAGAAGG + Intergenic
1174429981 20:50460704-50460726 CAGGAGTCCAAGTCCCCAGAGGG + Intergenic
1175944757 20:62553523-62553545 GAGGAGTCCAGGTTCCCAGAGGG - Exonic
1175957829 20:62620782-62620804 GAGGAGACTCTGTGCCCACAAGG - Intergenic
1175966023 20:62660674-62660696 GAGGCGTCTCTCCACCCAGATGG - Intronic
1178612583 21:34097211-34097233 GAGGAGTCTCAGAGACCTGATGG + Exonic
1178894765 21:36549314-36549336 GAGGACTCTCAGTAGCCGGAGGG - Intronic
1179783979 21:43719447-43719469 GACGAGCCTCAGTTCCCCGAGGG + Intronic
1181802691 22:25357912-25357934 GAAGAAGCTCAGCACCCAGAGGG + Intronic
1182779518 22:32856490-32856512 GAGGAGTCTCAGTACCCAGAAGG - Intronic
1183210575 22:36448881-36448903 GATGATTCTCAGTGCACAGATGG + Intergenic
1184469918 22:44690571-44690593 GAGGATTCTCATTTCACAGATGG + Intronic
1184493340 22:44823265-44823287 GAGGAGGCACAGAACCCAGCTGG + Intronic
1184947882 22:47817164-47817186 GAGGAGCCTCGGTACAGAGACGG + Intergenic
1184949621 22:47831936-47831958 AAAGAGTCTCTGGACCCAGAAGG - Intergenic
949416626 3:3821992-3822014 AAGGAGTCTCCCTGCCCAGACGG + Intronic
950202789 3:11056798-11056820 GAGTATCCTCAGGACCCAGATGG - Intergenic
952758072 3:36889804-36889826 GAGTAGTGGCATTACCCAGAGGG - Intronic
954487953 3:50872617-50872639 GGGGAAACTCAGTACCCTGAAGG - Intronic
956918416 3:73899634-73899656 GAGGAATCACAGTAGCCACATGG - Intergenic
960723638 3:120648902-120648924 GAGAAGACTCAGAACCCTGAAGG + Intronic
963638467 3:147829236-147829258 GAGGATTCTTAGAACCCAGGAGG - Intergenic
964668898 3:159203816-159203838 GAGAGGTCTGAGTCCCCAGATGG + Intronic
964827683 3:160848312-160848334 GAGCAGTTTCAGTACACTGATGG - Intronic
964827923 3:160850312-160850334 GAGCAGTTTCAGTACACTGATGG + Intronic
966658358 3:182385384-182385406 GAAAATTCTCAGTGCCCAGAAGG - Intergenic
967488846 3:190065356-190065378 GATGAGTGTCAATACCCAGGAGG + Intronic
969841483 4:9886155-9886177 GAGCAGTCTCTGCTCCCAGAGGG - Intronic
969883539 4:10195586-10195608 CAGAAGTCCCTGTACCCAGATGG + Intergenic
970176102 4:13340930-13340952 GATGACTCTCAGTCCCCACATGG - Intergenic
970250950 4:14115377-14115399 TAGGATTCTCACTGCCCAGAAGG - Intergenic
975066009 4:70064308-70064330 GAGAAGACTCAGGACCCTGAAGG - Intergenic
976099851 4:81550151-81550173 GAGGAGCCGCAGTGCCCAGCAGG - Intronic
977924671 4:102686688-102686710 GGGGAGTCACAGAAACCAGAGGG - Intronic
980759417 4:137210251-137210273 GAGGAGTGTAAGAAGCCAGAAGG + Intergenic
981245813 4:142536680-142536702 GGGCCATCTCAGTACCCAGAAGG + Intronic
986199958 5:5571180-5571202 GAGGAGACTGAGGCCCCAGAGGG - Intergenic
987335704 5:16896110-16896132 GAGTAATCTCAGGACTCAGAAGG + Intronic
990266678 5:54084275-54084297 GCGGATTCTCAGTCCACAGATGG + Intronic
999574495 5:152960551-152960573 AAGGAGTTTCAGTACCAAGAAGG + Intergenic
1001579715 5:172790293-172790315 GAGGCGACTCAGAACCCAGAGGG + Intergenic
1002457644 5:179354743-179354765 AAGGAGTCTCAGGGCTCAGACGG - Intergenic
1002565196 5:180109052-180109074 GAGGAGTCTCAGGGCAGAGAGGG - Intronic
1005495984 6:26388332-26388354 CAGGATCCTCAGCACCCAGATGG + Intronic
1008078553 6:47170989-47171011 GAGGAGCCTTTGAACCCAGAGGG - Intergenic
1009973276 6:70647077-70647099 GAGGAGCCACAGAACCCTGAAGG + Intergenic
1010843291 6:80674650-80674672 GAGTAGTCTCATTACTCAGTGGG + Intergenic
1012892192 6:104908780-104908802 GAGGGATCTCACTACCCTGAAGG + Intergenic
1014124485 6:117760401-117760423 GAGGAGTCACACAACCGAGAAGG + Intergenic
1015229643 6:130899642-130899664 GAGGAGTGTCTGTGCTCAGAGGG + Intronic
1015300980 6:131652869-131652891 CAGCAGTCTCAGTGCCCAGAAGG + Exonic
1017986051 6:159444078-159444100 GAAGAGACCCAGTACCCACAGGG - Intergenic
1019078639 6:169412045-169412067 GGGGAGTCTCAGAACCTAAAAGG + Intergenic
1019086956 6:169487414-169487436 GAGGAGTGTCAGGAAACAGAAGG + Intronic
1020745992 7:12078229-12078251 GGGGAGTCTCATTAACCATATGG + Intergenic
1023058909 7:36311165-36311187 GAGGAGTCTGAGCACCCACCAGG + Intergenic
1024121811 7:46249663-46249685 GAGGAGACCCAGAACCCAGTAGG - Intergenic
1024212141 7:47215402-47215424 TGGGAGTCTCAGTGCCCAGTGGG - Intergenic
1024606015 7:51023359-51023381 GAAAAGTCTCCTTACCCAGATGG - Intronic
1026410680 7:70118685-70118707 GAAGAATCTCTGAACCCAGAAGG + Intronic
1029921031 7:104264177-104264199 AAGGAGTTTCAGTCCCCACAGGG - Intergenic
1032092799 7:128920009-128920031 CAGGAGTCTCATTTCCCAGAAGG - Intergenic
1033840199 7:145363828-145363850 GAGCAGTATCAGTAGCCAGCAGG + Intergenic
1040480826 8:47824911-47824933 CAAGAGGCTTAGTACCCAGAAGG - Intronic
1040917016 8:52573705-52573727 GAGGCTCCTCAGTTCCCAGACGG + Intergenic
1042515961 8:69659269-69659291 GAGAAGTCACAGCACCTAGAAGG + Exonic
1046631872 8:116629616-116629638 GAGGAGTCCCAGAGGCCAGAAGG - Intergenic
1048179746 8:132184060-132184082 GAGGAATTTGAGGACCCAGAAGG + Intronic
1048801010 8:138193810-138193832 GAGGAATCCCAGGCCCCAGAGGG + Intronic
1050054689 9:1639475-1639497 AGGTAGTCTCAGTACCCAGCAGG - Intergenic
1051272792 9:15371662-15371684 GAGAAGACTCAGGACCCTGAAGG + Intergenic
1053508966 9:38670698-38670720 GAGAAGGCTCTGTTCCCAGAAGG - Intergenic
1055094203 9:72394010-72394032 AAGGAGTGTCAGTCCCCAGAAGG - Intergenic
1056225428 9:84490291-84490313 GAGGGGTCCCAGTACCCTGATGG + Intergenic
1057077357 9:92145328-92145350 GAGCAGTGTCAGTAAACAGATGG + Intergenic
1058152068 9:101474489-101474511 GAGGAGTCTCATTTCCAAGCTGG + Exonic
1058442147 9:105019253-105019275 AAGGATTCACAGTAGCCAGAGGG - Intergenic
1060516866 9:124271378-124271400 GGGGAGGCTCAGCACCCACAGGG + Intronic
1185699688 X:2221282-2221304 CAGGAGTCTCAGGACTCACATGG + Intronic
1189081005 X:37972512-37972534 GAGAAGACTCAGGACCCCGAAGG - Intronic
1189779112 X:44497196-44497218 ACGGAGTCTCATTACCCAGGCGG + Intergenic
1192099540 X:68249567-68249589 AAGGCTTCTCAGTACACAGAGGG - Intronic
1193718277 X:84957605-84957627 GAGAAGACTCAGGACCCAGAAGG - Intergenic
1195451082 X:105013713-105013735 GAGGATTTTCAGTAGGCAGAAGG - Intronic
1197516639 X:127440175-127440197 GAGGACTCTCAGTAGCCCCATGG - Intergenic
1198221396 X:134605663-134605685 GAGGTGGCTCAGTACCCTGCAGG + Intronic
1198229504 X:134675805-134675827 GAAGAGTCTGAATTCCCAGATGG + Intronic
1198532483 X:137560035-137560057 GAGGAGTCTCAGGAGAAAGAAGG - Intergenic
1199121167 X:144055752-144055774 GAGGCGTCTCAATAATCAGATGG - Intergenic
1199634998 X:149805985-149806007 GAGGAGTCTCAGGACCCTGAGGG + Intergenic
1199897374 X:152137698-152137720 GAGGAGTCCCAGAGCCCTGAGGG - Intronic
1200425190 Y:3012781-3012803 GAGAAGACTCAGGGCCCAGAAGG - Intergenic
1201438087 Y:13980807-13980829 GAAGAGTCTCAGCTCCCGGAGGG - Intergenic