ID: 1182779647

View in Genome Browser
Species Human (GRCh38)
Location 22:32857665-32857687
Sequence GATGAATAACTTTCAAAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182779647_1182779650 1 Left 1182779647 22:32857665-32857687 CCCGTCTTTGAAAGTTATTCATC 0: 1
1: 0
2: 1
3: 13
4: 221
Right 1182779650 22:32857689-32857711 TTAGGCAGTCAGTGTAGTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182779647 Original CRISPR GATGAATAACTTTCAAAGAC GGG (reversed) Intronic
901175483 1:7295616-7295638 GATGAATAAATTTCACACAGTGG - Intronic
902136999 1:14316066-14316088 GATGACTAAAGTTTAAAGACTGG - Intergenic
903834612 1:26195289-26195311 GTTGAATAACTTATAAAGAAAGG + Intronic
905545093 1:38791459-38791481 GATGCAGAAATTTCCAAGACAGG - Intergenic
910292700 1:85614894-85614916 GATGAATACTTTTGGAAGACTGG - Intergenic
910814366 1:91274782-91274804 GATGAATAAATCTCAAAGTGTGG - Exonic
911105888 1:94131145-94131167 CCTGAATAACTTTCAATAACAGG + Intergenic
911282608 1:95950040-95950062 CATGAATCACTTCCAAAGATTGG + Intergenic
915652742 1:157330421-157330443 GACAAATAGCTTTCAAAGTCTGG - Intergenic
915666592 1:157450645-157450667 TATGAAGAACTTCCCAAGACAGG - Intergenic
915798633 1:158764533-158764555 GATGAATACCTTTAAAAGTGTGG + Intergenic
916260163 1:162833972-162833994 GATAAATCACTTTCATAGAGAGG + Intronic
916643715 1:166760706-166760728 CATGAATAACTTTGAAATGCTGG - Intergenic
917982193 1:180276892-180276914 TATGATTAACTTACAAAAACTGG - Exonic
918944938 1:191051605-191051627 GATGAAAAACTTTGAAACTCAGG + Intergenic
919001922 1:191843468-191843490 GGTGAATAACTGTCAAAATCTGG + Intergenic
921522354 1:216171816-216171838 GATAAATTACTTTCAAATCCAGG - Intronic
922927987 1:229366479-229366501 GATGTCTAACTGTCAAAGCCTGG - Intergenic
924126533 1:240859117-240859139 AATTAATAACCTTCTAAGACAGG - Intronic
924400658 1:243677007-243677029 TATGAATAGCTTTGAAAGTCAGG - Intronic
924919156 1:248608382-248608404 TATAAATAAAATTCAAAGACCGG + Intergenic
1063147097 10:3305468-3305490 CATGTATAACTTACAAACACAGG - Intergenic
1064227397 10:13499640-13499662 GCTGAGTTACTTTAAAAGACAGG - Intronic
1068797302 10:61097662-61097684 CATGAACAACTTTGAAAGTCAGG - Intergenic
1072433221 10:95392074-95392096 GATGTATGCCTTTCAAAGAAAGG - Intronic
1074228267 10:111508659-111508681 GAGGAAAAAGTTTGAAAGACTGG - Intergenic
1074251085 10:111747977-111747999 GATGACTAATTTTGAAAGATTGG + Intergenic
1074389057 10:113041818-113041840 GATAAATAAATTTCAAAGCCTGG - Intronic
1075547757 10:123368262-123368284 TATAAAGAACTTTCAAAGAGGGG - Intergenic
1076286443 10:129302128-129302150 GATGAATAACTTTCTCACAGGGG + Intergenic
1079277342 11:19053733-19053755 AATGACTAAAATTCAAAGACTGG + Intergenic
1080812732 11:35721792-35721814 GCTGAATAATTTTCTAAGCCTGG + Intronic
1081246112 11:40768796-40768818 GATAAAAACCTTTAAAAGACTGG + Intronic
1081349209 11:42027858-42027880 TATAAATAACTGTCCAAGACTGG + Intergenic
1082173214 11:49031222-49031244 GATGAATGACTATGAAAGAGTGG - Intronic
1083079812 11:60079521-60079543 GAGGAATAAATTTCAAAAAATGG - Intergenic
1084664727 11:70570293-70570315 GATGATTAATTTTCTAAAACTGG + Intronic
1086010640 11:82098962-82098984 GGTGAATAACTTCCACAGCCTGG + Intergenic
1086482223 11:87254568-87254590 GTTGAATAACTTTTAAAGATGGG - Intronic
1086692555 11:89804825-89804847 GATGAATGACTGTGAAAGAGTGG + Intronic
1086713245 11:90034834-90034856 GATGAATGACTGTGAAAGAGTGG - Intronic
1087708748 11:101525045-101525067 GATGAATATGTTTAAAAGTCTGG + Intronic
1090955170 11:131506997-131507019 GATGAATGACTCTCTAAGCCTGG + Intronic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1092619914 12:10252731-10252753 GAGGAATAACTTTCAGAGGAAGG + Intergenic
1094622761 12:32096044-32096066 GATGACTAAGTTTTAAAGTCAGG + Intergenic
1098258968 12:68647651-68647673 GTTGGCAAACTTTCAAAGACAGG + Intronic
1100712383 12:97272015-97272037 GATGAGTAATTTTCAAAGTGTGG - Intergenic
1101015974 12:100500879-100500901 TATGAAGAACTATCCAAGACTGG - Intronic
1101695609 12:107122806-107122828 GGTGAATATCATTCACAGACCGG + Intergenic
1104947471 12:132422585-132422607 GATGAAGGACTTTTAAACACAGG + Intergenic
1109147043 13:58791650-58791672 CATAAATAACTTCCAAACACTGG - Intergenic
1109767020 13:66914865-66914887 GAAGAATAAAATTCAAAAACAGG + Intronic
1110509917 13:76337377-76337399 GATGATTACATTTCAAAGACAGG + Intergenic
1110577149 13:77070630-77070652 GCTGACTAACTTACAAAAACAGG - Exonic
1111024047 13:82495084-82495106 GATGGTTAAATCTCAAAGACAGG + Intergenic
1111283384 13:86056286-86056308 TATGAATAAATATCCAAGACAGG - Intergenic
1111683308 13:91470288-91470310 GATGGAGAAATTTCACAGACAGG - Intronic
1112619548 13:101040640-101040662 GATGAATTTATTTCAAAGGCAGG - Intergenic
1115061293 14:29193428-29193450 TATATATAACTTACAAAGACAGG + Intergenic
1116172610 14:41422338-41422360 GATGAATTACTTTCAAAATTTGG - Intergenic
1116561628 14:46386728-46386750 GATGATTATATTTCAAAGAATGG + Intergenic
1116917020 14:50535183-50535205 ACTGAAGAACTTTCAAAGAAGGG - Intronic
1118330639 14:64813000-64813022 GTTGAATAAATTTCAATGACAGG + Intronic
1118543268 14:66855222-66855244 GATGAAAAAGTTTTAAAAACAGG - Intronic
1120539969 14:85739286-85739308 GATGAAGAAATTTCAAAAAATGG + Intergenic
1120750011 14:88188404-88188426 GATGAATAACTCTGAACTACAGG + Intronic
1122103823 14:99435905-99435927 GATGAAGAACTGCCCAAGACGGG + Intronic
1126250154 15:46557916-46557938 GATGAATAACCTTCCAAACCTGG + Intergenic
1126415418 15:48412965-48412987 GATAAATAAATATCCAAGACAGG - Intronic
1126465623 15:48958898-48958920 GCTCAATATCTTTCAAAGAATGG + Intronic
1126745547 15:51822798-51822820 GATGCATCACTTTAAAAGCCAGG + Intergenic
1127294124 15:57594858-57594880 GCTGAACAACTTTCAATGAAAGG - Intronic
1131700117 15:94926176-94926198 GATGAATCATGTTCAGAGACAGG + Intergenic
1138957409 16:61987759-61987781 GATGAACGATTTTCAGAGACTGG - Intronic
1142435013 16:90050963-90050985 GATGATTACCTTTCAAAGGGAGG + Intergenic
1149099410 17:52885642-52885664 GATCAAGCACATTCAAAGACTGG + Intronic
1150652790 17:67020698-67020720 GCTGAGCAACTTTCAGAGACAGG + Intronic
1150654691 17:67032110-67032132 GCAGAATAACTTACAATGACAGG - Exonic
1150937472 17:69652652-69652674 TATGAAGAAATTTCCAAGACTGG + Intergenic
1152298671 17:79483037-79483059 GATGAATATTTTTAAAAGAGAGG - Intronic
1155194886 18:23464670-23464692 TTTGAATACCTTTCAAAAACAGG + Intronic
1156408270 18:36803659-36803681 GATGAATAAATTTAAAAGAGGGG - Intronic
1157445344 18:47741943-47741965 GATTAATCTCTTTAAAAGACTGG - Intergenic
1157563990 18:48667608-48667630 GATGAATAACTATGAAGGAGAGG + Intronic
1157587232 18:48811502-48811524 GATGAAGAAGTTTTAGAGACTGG - Intronic
1158757259 18:60340808-60340830 AATTAGTAACTTACAAAGACTGG - Intergenic
1164887439 19:31794031-31794053 GATCAATAATTTAAAAAGACTGG + Intergenic
1165128375 19:33617021-33617043 TATGACTAACTTGCAAAGAAAGG - Intergenic
1168484182 19:56747078-56747100 GATCAATATCTTACAAAAACAGG - Intergenic
925475571 2:4210749-4210771 TATGAAGAACTTCCCAAGACAGG + Intergenic
926391845 2:12401947-12401969 TATAAATAACTGTCCAAGACTGG - Intergenic
926468352 2:13219863-13219885 TATGAATAACTTTCAAAAATTGG - Intergenic
928831516 2:35491498-35491520 GATGAATAACTGTTCAAGAAGGG - Intergenic
929879453 2:45823380-45823402 GTTGAATTACTTTCGCAGACAGG + Intronic
930529704 2:52573232-52573254 GATGATTAGATTTCCAAGACAGG - Intergenic
930683837 2:54286776-54286798 GTTTGAAAACTTTCAAAGACAGG + Intronic
932136365 2:69233021-69233043 GATGAATTATTTTCTAAGAAAGG + Intronic
932669799 2:73727704-73727726 GATGATGACGTTTCAAAGACGGG - Intergenic
933635790 2:84707928-84707950 GATGAATAGCTTTCTAAGACAGG - Intronic
934532593 2:95104026-95104048 CATGAATACATTTCAAAAACAGG + Intronic
935199094 2:100840452-100840474 AATGAATAATTTTAAAAGATGGG - Intronic
936607233 2:113970778-113970800 GTTGAATAGATTTCGAAGACAGG + Intergenic
937015183 2:118598651-118598673 GATGAGTAAATTTCAGAGAGAGG + Intergenic
938075067 2:128327568-128327590 GATGGATAACTTTGAAATGCTGG + Intergenic
940049187 2:149443560-149443582 TATAAACAACTTTCAAAGATTGG - Intronic
940142544 2:150509209-150509231 GATGATTATTTTTCAGAGACAGG + Intronic
945374513 2:209063883-209063905 GATGAATAAGCTTCAAAAATTGG - Intergenic
945585648 2:211658543-211658565 GATAAGTATCTTTTAAAGACAGG - Intronic
946539296 2:220666120-220666142 GATGAATACCTGTCAGAGAGGGG - Intergenic
947300699 2:228685232-228685254 GTTGAATAACCTTCAAGCACAGG - Intergenic
947323229 2:228946073-228946095 GTTGCATGACTTTCAAAGATAGG - Intronic
947478369 2:230472922-230472944 GATGAATGAGTTTAGAAGACAGG - Intronic
1176940173 21:14913619-14913641 GATGAATAATTTTTAAATAGAGG + Intergenic
1177376504 21:20277074-20277096 GTTAAATGACTTTCAAAGAGAGG - Intergenic
1177386942 21:20421035-20421057 TATAAACAACTTCCAAAGACTGG + Intergenic
1178159847 21:29899421-29899443 CATGAAAAACTTTGAAGGACTGG - Intronic
1179055944 21:37934177-37934199 GATGAAGAACTTATTAAGACTGG + Intergenic
1181108341 22:20587612-20587634 GATGAACAACTGACAAACACAGG - Exonic
1182779647 22:32857665-32857687 GATGAATAACTTTCAAAGACGGG - Intronic
1184530142 22:45050300-45050322 GGGGAATAAGTTTCAAAGAATGG + Intergenic
949094558 3:70963-70985 GTTGAATGACATTCAGAGACAGG - Intergenic
949601104 3:5598631-5598653 GTTGACTAACTTGCAAACACGGG + Intergenic
951619084 3:24581029-24581051 GATGGATAAATTTGAGAGACAGG + Intergenic
952272857 3:31849734-31849756 CATGAAAAAATTTCCAAGACTGG + Intronic
953378690 3:42450130-42450152 AAAGGATAATTTTCAAAGACTGG - Intergenic
955091554 3:55756629-55756651 GATGAATTATTTCCAAACACTGG + Intronic
956347054 3:68291875-68291897 GATGATTAGATTTTAAAGACAGG - Intronic
956717670 3:72092664-72092686 GACAAATAGGTTTCAAAGACAGG - Intergenic
957744353 3:84319234-84319256 GATGAAAAACTTTCAAACAAAGG - Intergenic
958717067 3:97796954-97796976 GAAGAATATTTTTCAAAAACAGG + Intronic
959778175 3:110195289-110195311 GAGATATCACTTTCAAAGACAGG + Intergenic
961800143 3:129441179-129441201 GCTGAATGATTTTCAAAGTCAGG - Intronic
962039775 3:131694570-131694592 GATGCATGACTTCCAAAGCCAGG + Intronic
963394033 3:144708859-144708881 TATAAATAACATTAAAAGACAGG - Intergenic
963816990 3:149842088-149842110 GATATCTAAGTTTCAAAGACAGG - Intronic
965321514 3:167257565-167257587 GATGAAAACCTTTAAAAAACTGG - Intronic
965378107 3:167952095-167952117 GATAAATAATTTTCAATAACTGG + Intergenic
965386357 3:168050723-168050745 CATGCAAAACTTTCAAAGAAAGG + Intronic
967775297 3:193380304-193380326 CATGGATCACTTTCAAAGAAAGG - Intergenic
969948941 4:10813783-10813805 TATGAAGAAATATCAAAGACTGG + Intergenic
972105687 4:35482829-35482851 AATGAATAAATTTTAAACACAGG + Intergenic
975974287 4:80077263-80077285 AAAGAATAATTTTCAAAGAGTGG - Intronic
976028887 4:80726514-80726536 AATGAATAACTATCAAATAATGG + Intronic
977076065 4:92452079-92452101 GATGTATAAGTGTAAAAGACAGG + Intronic
977491971 4:97725809-97725831 GCTGAATATCTTTCAATGCCTGG - Intronic
977690054 4:99895526-99895548 GGTGAATAGTTTTCAAAGATAGG - Intergenic
979204742 4:118024647-118024669 TATGAAGAAATATCAAAGACTGG - Intergenic
980894103 4:138845073-138845095 GATGAAGCACTTTTAAAGGCAGG - Intergenic
983510787 4:168607499-168607521 GATATATAACTATCAAAGCCTGG - Intronic
983735696 4:171056942-171056964 AATGAAAAACTTAGAAAGACTGG + Intergenic
983766253 4:171488630-171488652 GATAAAGAACTGTCCAAGACTGG - Intergenic
986454649 5:7904102-7904124 GATGAGAAACTGTCACAGACTGG - Intronic
986869081 5:12026930-12026952 TATGAAGAACTATCTAAGACTGG + Intergenic
986940362 5:12940826-12940848 GATTCATAACTTTCCAAAACAGG + Intergenic
987907787 5:24100706-24100728 AATCAATATTTTTCAAAGACAGG + Intronic
988385255 5:30554823-30554845 GATGATTATCTTTCCAAGAGTGG - Intergenic
989471627 5:41826308-41826330 GATAAAGAACTTTGGAAGACAGG + Intronic
990139470 5:52686428-52686450 GATAAATAAATTTCTCAGACAGG - Intergenic
991606536 5:68407879-68407901 TATGAAGAACTTCCCAAGACTGG + Intergenic
992278709 5:75150339-75150361 GATGAAGAACTTTCAAGTATGGG - Intronic
993134088 5:83935092-83935114 GATGAATAACTAACAGAGAATGG + Intergenic
994890682 5:105631042-105631064 GATGAACAGCCTTCAAAGGCTGG - Intergenic
995603439 5:113824230-113824252 GCTGAACAACTTCCAAAGAGAGG - Intergenic
996032761 5:118724380-118724402 CATGAATAACATTCAAACCCTGG + Intergenic
996852706 5:127970367-127970389 GGTGAATACCTTTAAAAGAATGG + Intergenic
999348177 5:150842945-150842967 GATGAAAAACATTCATAGAATGG + Intergenic
1001244144 5:170093159-170093181 GGTGAAAGACTTGCAAAGACAGG - Intergenic
1001938637 5:175725626-175725648 GATGAAGAAATACCAAAGACTGG + Intergenic
1002437857 5:179243204-179243226 GGAGAATGAATTTCAAAGACTGG + Intronic
1002658837 5:180776027-180776049 GAGGAATAACTTGAAAAGGCTGG - Intergenic
1004568820 6:16825151-16825173 AATGAATATCTTTCTAAGACTGG + Intergenic
1008672332 6:53783290-53783312 AATAAATAAATGTCAAAGACTGG + Intergenic
1009198310 6:60713722-60713744 GAGAAATATCTTTCAGAGACTGG + Intergenic
1010808407 6:80266793-80266815 CATGAATAACTCTTCAAGACTGG - Intronic
1011228279 6:85131703-85131725 GATGAATAATTTAAAAATACAGG - Intergenic
1012049703 6:94325874-94325896 AATGAAGAACTCTCAAATACTGG - Intergenic
1012114296 6:95275779-95275801 GATCTATAACTGTCAGAGACTGG + Intergenic
1012536384 6:100302923-100302945 CATGAATAACTTGAAAAGACAGG + Intergenic
1012704257 6:102500816-102500838 AATATAGAACTTTCAAAGACTGG + Intergenic
1013566849 6:111373454-111373476 GAGTAACAACTTTCAAAGCCTGG + Exonic
1015564132 6:134549012-134549034 GATGAATTACTTTCAACAAGTGG - Intergenic
1015902980 6:138086559-138086581 AATGAAGAAGTTTCAAAAACAGG - Intergenic
1016125429 6:140396486-140396508 AATGAAAGACTTTCAAACACAGG + Intergenic
1017841685 6:158227447-158227469 GAAGAGTAACTTTCAAAGAAAGG + Intergenic
1019316622 7:389986-390008 GAGGAAGAACTTGCAAAGCCTGG - Intergenic
1020410534 7:7887126-7887148 GATCAAGAACCTTCAAAGAGGGG - Intronic
1020618386 7:10488769-10488791 GTTGAATCACTATCAAACACAGG - Intergenic
1026338920 7:69418913-69418935 AATTAATTACTTTCAATGACAGG + Intergenic
1028025008 7:85826354-85826376 AAAGAATGACTTTCAAGGACTGG + Intergenic
1028283660 7:88967151-88967173 TATGAAGAACTATCTAAGACTGG + Intronic
1028900827 7:96098863-96098885 CATGAAAAACATTCGAAGACAGG + Intronic
1029216695 7:98955628-98955650 CATGAATAACTTTCCAAGGCAGG - Intronic
1030768824 7:113447215-113447237 AATGAATAACTGTCATTGACAGG + Intergenic
1031505025 7:122571557-122571579 GAGCAACAACTTTCAAAGTCAGG + Intronic
1037075257 8:14708391-14708413 GATGAATATATTTTAAAAACAGG + Intronic
1038720789 8:30033688-30033710 GATGAATAACCTTCTGAGGCCGG - Intergenic
1038758269 8:30361973-30361995 TATGTATAACCTCCAAAGACTGG - Intergenic
1038811287 8:30848311-30848333 GATGAATACCTTCAAAATACTGG - Exonic
1039688105 8:39830264-39830286 GAACAATAATTTTCAAATACAGG + Intronic
1040130928 8:43795648-43795670 CATGAAGCAGTTTCAAAGACAGG - Intergenic
1040597651 8:48855317-48855339 GAGCAATAACTTTCAGACACAGG - Intergenic
1041086954 8:54265455-54265477 GATGAATAAATTTATAAGATGGG + Intergenic
1043288103 8:78560424-78560446 CAGAATTAACTTTCAAAGACAGG - Intronic
1043419268 8:80082602-80082624 GATGAATAACTTTGACAGGCTGG - Intronic
1044395601 8:91707452-91707474 TATAAAGAACTTCCAAAGACAGG - Intergenic
1046228923 8:111327194-111327216 CATGACTAACTAGCAAAGACAGG - Intergenic
1047039966 8:120982551-120982573 GAAGAACAACTTTCTAAGACAGG - Intergenic
1047918178 8:129604780-129604802 TATAAATAACTGTCCAAGACTGG + Intergenic
1048113801 8:131497396-131497418 TATGAATAACTGCCAGAGACTGG - Intergenic
1055184066 9:73429090-73429112 AATGAGTAACTGTCACAGACTGG - Intergenic
1055812920 9:80171633-80171655 AATGAATTACTTTCTAAGAAAGG + Intergenic
1059183663 9:112244717-112244739 GATGCACAATGTTCAAAGACTGG + Intronic
1059735949 9:117099865-117099887 GATGAATAACTGTCTCAGAGAGG + Intronic
1059867974 9:118537864-118537886 GATGAAATACTTTGGAAGACAGG + Intergenic
1062251583 9:135598755-135598777 GAAGAATATTTTTCAAAAACAGG - Intergenic
1185886247 X:3785873-3785895 TATGAAAAACTTCCCAAGACTGG - Intergenic
1186508975 X:10116375-10116397 GATTAGTACATTTCAAAGACAGG - Intronic
1187321415 X:18241716-18241738 GATCAATAACTTTCTGAGAAGGG + Intronic
1187551397 X:20309535-20309557 GATGAAAATCTTTCAAAGCTTGG + Intergenic
1187880312 X:23841164-23841186 CATGAATAACTCTGAAAGAGGGG - Intronic
1193438303 X:81507854-81507876 GATGAAAAACTTCCAGAGATTGG + Intergenic
1194151791 X:90334371-90334393 AATGCAGAACTTACAAAGACAGG + Intergenic
1194883014 X:99277236-99277258 CATGAATCACTCTCAAAGATAGG + Intergenic
1195511252 X:105717783-105717805 GAGGAGTCACCTTCAAAGACTGG - Intronic
1196639567 X:118042420-118042442 TATGGATCACTTTCAAGGACAGG + Intronic
1197681171 X:129386918-129386940 GATGAATGCCATGCAAAGACTGG + Intergenic
1198315624 X:135463274-135463296 AATGATTAAGTTTCAAACACAGG - Intergenic
1198428435 X:136542412-136542434 GATTTATAAAGTTCAAAGACAGG + Intronic
1199057148 X:143310257-143310279 GATGAATAGATTTCAAAAAGTGG - Intergenic
1199135059 X:144239831-144239853 TATGAAGAACTTACCAAGACTGG + Intergenic
1199212079 X:145224331-145224353 GATGAATAATTTCCACAGATCGG + Intergenic
1200498151 Y:3911137-3911159 AATGCAGAACTTACAAAGACAGG + Intergenic
1201424529 Y:13833662-13833684 GATAAATATATATCAAAGACAGG + Intergenic
1201912467 Y:19146750-19146772 TATGAAGAACTTCCCAAGACTGG + Intergenic
1202191712 Y:22252804-22252826 GATGAATAATTTTTACAGTCAGG + Intergenic