ID: 1182782400

View in Genome Browser
Species Human (GRCh38)
Location 22:32878551-32878573
Sequence TGCTTGGCCCCCTGGGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 364}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182782400_1182782410 4 Left 1182782400 22:32878551-32878573 CCACTACCCCAGGGGGCCAAGCA 0: 1
1: 0
2: 0
3: 24
4: 364
Right 1182782410 22:32878578-32878600 CCACCATGGTTGAGTGAGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 114
1182782400_1182782405 -10 Left 1182782400 22:32878551-32878573 CCACTACCCCAGGGGGCCAAGCA 0: 1
1: 0
2: 0
3: 24
4: 364
Right 1182782405 22:32878564-32878586 GGGCCAAGCAGGTACCACCATGG 0: 1
1: 0
2: 1
3: 17
4: 125
1182782400_1182782408 3 Left 1182782400 22:32878551-32878573 CCACTACCCCAGGGGGCCAAGCA 0: 1
1: 0
2: 0
3: 24
4: 364
Right 1182782408 22:32878577-32878599 ACCACCATGGTTGAGTGAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 139
1182782400_1182782407 0 Left 1182782400 22:32878551-32878573 CCACTACCCCAGGGGGCCAAGCA 0: 1
1: 0
2: 0
3: 24
4: 364
Right 1182782407 22:32878574-32878596 GGTACCACCATGGTTGAGTGAGG 0: 1
1: 0
2: 1
3: 5
4: 95
1182782400_1182782412 13 Left 1182782400 22:32878551-32878573 CCACTACCCCAGGGGGCCAAGCA 0: 1
1: 0
2: 0
3: 24
4: 364
Right 1182782412 22:32878587-32878609 TTGAGTGAGGTGGGCCTCTTCGG 0: 1
1: 0
2: 1
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182782400 Original CRISPR TGCTTGGCCCCCTGGGGTAG TGG (reversed) Intronic
900791612 1:4684479-4684501 AGCCTGGCCACCTGGGGGAGGGG + Intronic
901913705 1:12481261-12481283 TACTTGGCCCCGTTGGGTACTGG - Intronic
902039155 1:13480259-13480281 TGCTTGAACCCCGGAGGTAGAGG + Intronic
902919803 1:19658828-19658850 TGCCTGGCCCCCTGGGAGAAGGG + Intergenic
902970593 1:20045302-20045324 TACTTGCCCCCCTGGGGAGGTGG + Intronic
903110674 1:21130306-21130328 TGCTTGAACCCCGGGGGCAGAGG - Intronic
903517111 1:23918672-23918694 TGCTTGAACCCGTGGGGCAGAGG + Intergenic
903606987 1:24582062-24582084 CGCTAGGCCAGCTGGGGTAGGGG - Intronic
904198570 1:28804285-28804307 TGCAAGGCCCCCTGGGGCACAGG + Intergenic
904730796 1:32589631-32589653 TGCTTGACCCCCAGAGGTGGAGG - Intronic
905334985 1:37238957-37238979 TTCTGGGCCCTCTGGGGGAGGGG + Intergenic
905409244 1:37756907-37756929 TGCTTGGCCCCAGGAGGCAGGGG - Intronic
905665908 1:39763050-39763072 TGCCCAGCCCCCTGGGGTGGGGG - Intronic
906291129 1:44619811-44619833 TGCTTGGCCCCCAGAGGCTGAGG - Intronic
906476738 1:46174485-46174507 GGCCTGGCCCCCTGGGGTTCAGG - Intronic
906644227 1:47462031-47462053 TGCTGGGCCACCTGGGACAGTGG + Intergenic
906647427 1:47485490-47485512 TGCTTGAGCCCCCGAGGTAGAGG + Intergenic
906704349 1:47883983-47884005 TGCTTGACCCCCAGGGGATGTGG + Intronic
906827473 1:48997004-48997026 TGCTTGAACCCCTGAGGTGGAGG - Intronic
909621879 1:77677252-77677274 TGCTTGAACCCGGGGGGTAGAGG + Intronic
911155015 1:94628459-94628481 TGCTGGGCCCTCTGGGGTCCAGG + Intergenic
912842508 1:113051506-113051528 TGCTTGGACCCAGGGGGTGGAGG + Intergenic
913151207 1:116045653-116045675 TGCTTGAACCCGGGGGGTAGAGG + Intronic
914049573 1:144120170-144120192 TGCTTGGACCCCGGAGGCAGAGG + Intergenic
914129609 1:144845270-144845292 TGCTTGGACCCCGGAGGCAGAGG - Intergenic
914883597 1:151567000-151567022 TGCTTGAACCCCGGGGGTCGAGG - Intronic
915313021 1:155013830-155013852 TCCTTGGCCCCATGGGGGAGGGG + Intronic
915316815 1:155033408-155033430 AGCTTGGCACCCAGGGCTAGGGG - Intronic
916893641 1:169138225-169138247 TGCTTGAACCCCGGGGGTGGAGG + Intronic
917310787 1:173675528-173675550 TGCTTGAACCCAGGGGGTAGAGG + Intergenic
919118580 1:193312265-193312287 TGCTTGGCCCCAGGAGGTCGAGG - Intergenic
919926487 1:202194283-202194305 TGCTTGGTGCCCTGGGGCATGGG + Intronic
920263734 1:204706957-204706979 TGGTTGGGGCCCTGGGGTCGGGG - Intergenic
922134326 1:222809859-222809881 TGCTTGAACCCCGGGGGTGGAGG + Intergenic
922527492 1:226316775-226316797 TGCTTGGGCCCAGGAGGTAGAGG + Intergenic
923103612 1:230837321-230837343 CCCTTGGCCCCCTGGGTTTGGGG - Exonic
923475181 1:234325265-234325287 TGCCTGGACACATGGGGTAGGGG - Intergenic
923766491 1:236896771-236896793 GGCCTGTCCCCCTGGGTTAGAGG + Intronic
924116654 1:240753994-240754016 TGCTTGGACCCCGGGGGCAGAGG - Intergenic
1063277414 10:4585558-4585580 TGATTGGCCCCCTGAAGTGGTGG - Intergenic
1063290008 10:4735443-4735465 GGCTTTGCCCCCTGGGGAGGAGG - Intergenic
1064805118 10:19121722-19121744 TGCTTTGCCCCCTGTAGGAGCGG - Intronic
1065881350 10:30040041-30040063 TGCTTGATCGCCTGGGGAAGGGG + Intronic
1066239819 10:33522675-33522697 TGCTTGAACCCCGGAGGTAGAGG + Intergenic
1067061807 10:43081612-43081634 TTCTGTGCCCCATGGGGTAGGGG + Intronic
1067113065 10:43414338-43414360 TGCTTGGCCTGCTGGGGAAATGG - Intergenic
1067755358 10:49000745-49000767 TGCCTGGTCCCCTTGGGGAGGGG + Intergenic
1067849809 10:49747316-49747338 AGCTTGGCCCTCTGAGGCAGTGG - Intronic
1068204783 10:53836103-53836125 TGCTCCTCCCCCAGGGGTAGGGG - Intronic
1068696224 10:59970643-59970665 TGTCTGGCTCACTGGGGTAGAGG + Intergenic
1069450027 10:68509617-68509639 TGCTTGGGCCCAGGAGGTAGAGG + Intronic
1069485391 10:68819344-68819366 TGCTTGGCCCCAGGAGGCAGAGG - Intergenic
1069524635 10:69158419-69158441 TGCTTGGCCACTTTGTGTAGAGG + Intronic
1069774847 10:70920313-70920335 TGCTTGGACCCAGGAGGTAGAGG + Intergenic
1070290059 10:75108270-75108292 TGCCTGGCCCCCTGCTGCAGAGG + Intronic
1070905210 10:80066032-80066054 TGCTTGACCCCCTGGGATGGAGG + Intergenic
1071735860 10:88299539-88299561 TGCTTGACCCCGTGAGGTGGAGG + Intronic
1071889732 10:89990778-89990800 TGCTTGAACCCCAGGGGTGGAGG - Intergenic
1071964319 10:90836592-90836614 TGCTTGGGCCCCAGAGGTCGAGG - Intronic
1072908425 10:99477177-99477199 TGCTTGAACCCCAGAGGTAGAGG + Intergenic
1074745228 10:116525312-116525334 TGCTTGGACCTCGGAGGTAGAGG - Intergenic
1075308584 10:121391133-121391155 TGATTGGCCCCCTGCTGCAGAGG + Intergenic
1076742572 10:132494068-132494090 TGCACGGCCCCGTGGGGTGGTGG - Intergenic
1076900430 10:133335166-133335188 AGCTTGGCCCGCGGGGGTGGGGG + Intronic
1077206602 11:1347606-1347628 GGCTTGGCCTCATGGGGTGGCGG + Intergenic
1077332856 11:1990920-1990942 TGCTGGGCCTCCTGGCCTAGGGG + Intergenic
1077501354 11:2911062-2911084 TCCTTGGCCACCAGCGGTAGAGG - Intronic
1078355554 11:10629327-10629349 TCCTAGGCCCTCTGGGGAAGAGG - Intronic
1078590137 11:12633570-12633592 TGCTTGAGCCCCGGAGGTAGAGG - Intergenic
1078826700 11:14936689-14936711 TGCTTGACCCCAGGAGGTAGAGG + Intronic
1079861042 11:25671564-25671586 TGCTTGAACCCCTGAGGCAGAGG - Intergenic
1080188581 11:29520404-29520426 TCCTTGACCCCCTGGGGTGGGGG - Intergenic
1080625846 11:34029909-34029931 TGCTTGGGCCCAGGAGGTAGAGG + Intergenic
1082172419 11:49021801-49021823 TGCTTGAACCCCTGGGATGGAGG - Intergenic
1082825646 11:57575975-57575997 TGCTTGAACCCAGGGGGTAGAGG + Intergenic
1082859387 11:57839961-57839983 TGCTTGGGCCCATGAGGTTGAGG - Intergenic
1083749707 11:64754335-64754357 TGGATGGCCACCTGGGGTAGGGG + Exonic
1083901122 11:65644084-65644106 TTCTTGGCCCCCAGGAGTGGTGG + Intronic
1085227263 11:74933339-74933361 TGCTTGAACCCCTGAGGCAGAGG - Intronic
1086028683 11:82326808-82326830 TGCTGGGCTGCCTGGGGTTGGGG - Intergenic
1086693347 11:89814233-89814255 TGCTTGAACCCCTGGGGTGGAGG + Intergenic
1089216455 11:116837314-116837336 TGGTTGGCTCCCTAGGTTAGGGG + Intronic
1090151579 11:124390089-124390111 TGCTTGGCCCTCTCAAGTAGAGG + Intergenic
1091263880 11:134255218-134255240 TGCTTGAACCCGTGGGGCAGAGG - Intronic
1202815839 11_KI270721v1_random:46096-46118 TGCTGGGCCTCCTGGCCTAGGGG + Intergenic
1091391446 12:128702-128724 GGCCTGGCCTCCTGGGGCAGGGG - Intronic
1092004915 12:5061116-5061138 GTCGTGGCCCCCTGGTGTAGAGG - Intergenic
1092256638 12:6929432-6929454 TGCTTTGGCAACTGGGGTAGGGG + Intronic
1092465458 12:8727815-8727837 TGCTTGAACCCCAGGGGTGGAGG + Intronic
1092735381 12:11577690-11577712 TACTTGGCCCTCTGGGGGACTGG - Intergenic
1093643586 12:21556250-21556272 TGCTTGGGCCCTGGAGGTAGAGG - Intronic
1093923173 12:24882680-24882702 TGCTTGAACCCAGGGGGTAGAGG - Intronic
1096069376 12:48766496-48766518 TACTTGGTGCCATGGGGTAGGGG - Exonic
1096242165 12:49965338-49965360 TGATGGGACTCCTGGGGTAGGGG + Exonic
1097062541 12:56296364-56296386 TGCTTGGGCCCATGAGGTTGAGG + Intronic
1097383489 12:58922106-58922128 TGCTTGAACCCAGGGGGTAGAGG - Intergenic
1101553993 12:105789649-105789671 GGCTTGGCCCACTGGAATAGGGG + Intergenic
1101909676 12:108851957-108851979 TGCTTGGCCTCCTGAAGTACTGG - Intronic
1101966895 12:109287845-109287867 TGCTGGGCACCCGGGGGGAGCGG + Exonic
1102642408 12:114378718-114378740 TGCTTGAACCCCAGAGGTAGAGG - Intronic
1103415314 12:120738994-120739016 TCCTTGGCCCCGTGGGTCAGAGG + Intronic
1103771555 12:123330839-123330861 TGCTTGAGCCCCTGAGGTAGAGG + Intronic
1104485076 12:129144241-129144263 TGCTTGTCACTCTGTGGTAGAGG + Intronic
1104664071 12:130635049-130635071 TGCCTGGTCCCCTGGGGCAGGGG - Intronic
1106700253 13:32221594-32221616 TGCTTGCACCCCAGAGGTAGAGG - Intronic
1107696867 13:43008827-43008849 TGCTTGAGCCCATGGGGTGGGGG - Intergenic
1108232784 13:48367033-48367055 TGCTTGAACCCCGGGGGCAGAGG + Intronic
1108507194 13:51123139-51123161 TGCTAGGGTCCCTGGGGGAGGGG - Intergenic
1108974652 13:56423533-56423555 TGCTTGACCCTGTGGGGCAGAGG + Intergenic
1111958110 13:94780394-94780416 TGCTTGAACCCCTGAGGCAGAGG - Intergenic
1112117098 13:96368080-96368102 TGCTGGGCTCTGTGGGGTAGAGG - Intronic
1112658068 13:101474103-101474125 AGCTTGGCCCAGTGGGTTAGAGG + Intronic
1114991260 14:28293237-28293259 TGCTTGATCCCCGGGGGCAGAGG - Intergenic
1116281184 14:42910200-42910222 TACTGGGCCCCATGGGGTAGGGG - Intergenic
1116345485 14:43787440-43787462 TGCTTGACCCCCGGAGGTGGAGG - Intergenic
1118502795 14:66378857-66378879 TGCTTGGCCCCCTTTGCAAGAGG - Intergenic
1118867074 14:69712227-69712249 TCCCTGGCCCCCTGGGGGAAGGG + Exonic
1121400130 14:93668758-93668780 TGCTTAGCCCCAGGAGGTAGAGG + Intronic
1121538590 14:94708207-94708229 TGCTTGAACCCGGGGGGTAGAGG + Intergenic
1122158608 14:99766780-99766802 TGCTTGGCAACCTGGGATTGTGG - Intronic
1125887370 15:43238744-43238766 TCTCTGGCTCCCTGGGGTAGGGG + Intronic
1126833613 15:52635910-52635932 TGCTTGAACCCCGGGGGCAGGGG + Intronic
1128955630 15:71940406-71940428 TGCTTGGGCCCCAGAGGTCGAGG + Intronic
1129047443 15:72748994-72749016 TGCTTGAGCCCATGGGGCAGAGG - Intergenic
1129523198 15:76198567-76198589 TCCATGGCTCCCTGGAGTAGGGG + Intronic
1129716829 15:77857217-77857239 TGCAAGGGCCCCTGGGGTGGGGG - Intergenic
1129741102 15:77990009-77990031 TGCTCAGCCCCCTGTGGCAGTGG + Intronic
1129925832 15:79363852-79363874 TGCTTGGCACCCTGTAGTAAAGG - Intronic
1130907702 15:88251979-88252001 TGCTGGGCTTCCTGGGGCAGGGG + Intronic
1131066092 15:89435842-89435864 GGCTGGGCCCCCTGGGGGACGGG - Intergenic
1132113119 15:99116749-99116771 TGCTTGAACCCGTGAGGTAGAGG - Intronic
1132402788 15:101523629-101523651 TCCTGGGCCCGCTGGGGGAGTGG + Intronic
1132459705 16:45650-45672 TGCTTGGCCCCCAGGAGTTCAGG + Intergenic
1132693924 16:1193809-1193831 TGCTGGGGTCCCTGGGGGAGGGG + Intronic
1132881585 16:2163950-2163972 TGCTGGGCCCCCCGGAGAAGCGG - Exonic
1134335707 16:13297838-13297860 TGCTTGGACCTCGGAGGTAGAGG - Intergenic
1135317349 16:21460885-21460907 TGCTTGAACCCCGGAGGTAGAGG - Intergenic
1135370247 16:21892697-21892719 TGCTTGAACCCCGGAGGTAGAGG - Intergenic
1135441542 16:22478004-22478026 TGCTTGAACCCCGGAGGTAGAGG + Intergenic
1136056643 16:27694710-27694732 TGCTTGAACCCCAGAGGTAGAGG + Intronic
1136314136 16:29440625-29440647 TGCTTGAACCCCGGAGGTAGAGG - Intergenic
1136327575 16:29542390-29542412 TGCTTGAACCCCGGAGGTAGAGG - Intergenic
1136442264 16:30282390-30282412 TGCTTGAACCCCGGAGGTAGAGG - Intergenic
1136540548 16:30925611-30925633 TCCTTGTCCCCCTGAGGAAGAGG + Intronic
1138014307 16:53414679-53414701 TGCTTGAGCCCCGGGGGTCGAGG + Intergenic
1138122308 16:54410521-54410543 TGCTTGAACCCAGGGGGTAGAGG - Intergenic
1138440240 16:57029937-57029959 GTCTGGGGCCCCTGGGGTAGGGG + Intronic
1139373006 16:66480072-66480094 TGCTCGAGCCCCTGGGGCAGGGG - Intronic
1139568048 16:67792148-67792170 TGCATGGCTTCCTGGGGCAGGGG - Intronic
1139889071 16:70236113-70236135 TGCTTGAACCCCAGAGGTAGAGG - Intergenic
1140276048 16:73509777-73509799 TGCTTGAACCCCGGGGGTGGAGG - Intergenic
1140334993 16:74096602-74096624 TGCTTGAACCCTTGGGGCAGAGG + Intergenic
1140893662 16:79306471-79306493 TGCTTGGCCTCCTGGTAGAGAGG + Intergenic
1141094250 16:81151653-81151675 TGCTTGACCCAGGGGGGTAGAGG + Intergenic
1141131082 16:81437305-81437327 TGCTTGGGCCCAGGAGGTAGAGG + Intergenic
1141683535 16:85557218-85557240 TCCTGTGCCCCCTGGGGTCGGGG + Intergenic
1141763882 16:86046187-86046209 AGGCTGGCCCCCTGGGGAAGTGG + Intergenic
1141775480 16:86120101-86120123 TGCTTGAGCCCATGAGGTAGAGG + Intergenic
1143724035 17:8833149-8833171 TGCCGGGCCCCCAGGGGCAGCGG - Intronic
1144689261 17:17249405-17249427 TGCTTGAACCCCGGAGGTAGAGG - Intronic
1144963389 17:19059903-19059925 TGCTTGAACCCCGGGGGCAGAGG - Intergenic
1144964301 17:19066137-19066159 TGCTTGAACCCCGGGGGCAGAGG + Intergenic
1144971770 17:19114623-19114645 TGCTTGAACCCCGGGGGCAGAGG + Intergenic
1144983665 17:19186007-19186029 TGCTTGAACCCCGGGGGCAGAGG - Intergenic
1144984560 17:19192232-19192254 TGCTTGAACCCCGGGGGCAGAGG + Intergenic
1145873586 17:28297671-28297693 TGCTTGGCCCCAGGGGGCAGAGG + Intergenic
1146228064 17:31084441-31084463 TGCTTGAACCCCAGGGGCAGAGG + Intergenic
1146494563 17:33309943-33309965 TGCTTGACTCCATGGGGTGGAGG - Intronic
1146929211 17:36765919-36765941 GGCTTGGCTCCCTGGGGATGGGG + Intergenic
1147296678 17:39489162-39489184 TGCTTGAACCCCAGGGGTGGAGG - Intronic
1147328181 17:39680075-39680097 TGCTTAGCTCCCTGGGGCAGGGG + Intronic
1148695344 17:49555306-49555328 TGCCTGGCCCCCTGAGTCAGTGG + Intergenic
1148913613 17:50956584-50956606 TGCTTGGGTCCCTGGGCTATGGG + Intergenic
1150106083 17:62463471-62463493 TGCTTGAACCCGGGGGGTAGAGG + Intronic
1150477662 17:65487224-65487246 GGGTTGGCCCCATGGAGTAGGGG - Intergenic
1151111085 17:71678721-71678743 CGCTTGAGCCCCTGGGGTTGAGG + Intergenic
1151276877 17:73041488-73041510 TGCCTGGCTGCCTGGGGTACAGG - Intronic
1152280127 17:79380199-79380221 GGCTTGGCAGCCTGGGGGAGGGG - Intronic
1152600060 17:81257794-81257816 TGCCTGCCCCGCTGGGGGAGCGG + Intronic
1152686652 17:81696967-81696989 TGCTGGGCATGCTGGGGTAGGGG - Exonic
1152691652 17:81720829-81720851 CGCTTGGCTCCCTGGGGGAATGG + Exonic
1153041370 18:815355-815377 TGCTTGAACCCCGGGGGCAGAGG + Intergenic
1153850066 18:9085676-9085698 TGCGTGGGCCCATGAGGTAGCGG - Intergenic
1155086204 18:22460797-22460819 CCCATGGTCCCCTGGGGTAGTGG - Intergenic
1155128590 18:22905870-22905892 TGCTTGAACCCCAGAGGTAGAGG - Intronic
1155945809 18:31850034-31850056 TGCTTGGGCCCAGGAGGTAGAGG - Intronic
1156232904 18:35172247-35172269 TGCAAGGCACCCTGGGGCAGTGG - Intergenic
1157573503 18:48729201-48729223 TGCTGGACCCCCTGGGTAAGAGG - Intronic
1158536045 18:58309186-58309208 GGCGTGGCCCCGTGGGGCAGTGG - Intronic
1159294460 18:66466444-66466466 TGCTTGGACCCGGGGGGTGGAGG - Intergenic
1159719591 18:71871555-71871577 TGCTTGAACCCCAGTGGTAGAGG + Intergenic
1160895039 19:1398517-1398539 TGCTTGGGCCCCAGGGGCAGAGG - Exonic
1161146837 19:2683932-2683954 AGCTCGGCCCCCTGGGGCTGAGG - Intronic
1161394040 19:4035303-4035325 TGCATGGACCCGTGGGGCAGGGG + Intronic
1161557434 19:4951961-4951983 TGAGTGACCCCCTCGGGTAGAGG - Intronic
1162496861 19:11028183-11028205 TGCTGGGCGCACTGGGGAAGGGG + Intronic
1162724036 19:12679212-12679234 TGCTTGGCCCCAGGAGGTTGAGG + Intronic
1163448211 19:17360105-17360127 TGCTGTGCTCCCTGGGGTACAGG + Intronic
1163573798 19:18098952-18098974 TGCTGGGAGCCCTGGGGTAGAGG + Intronic
1163599455 19:18239940-18239962 TGCTTGAACCCAGGGGGTAGAGG + Intronic
1163615490 19:18325147-18325169 TGCTTGACCCCGGGAGGTAGAGG + Intergenic
1163852175 19:19670325-19670347 TGCTTGGGCCCCAGAGGTTGAGG - Intronic
1164522733 19:28991239-28991261 TGCATGGCCCCCCTGGGTGGTGG + Intergenic
1164614474 19:29658286-29658308 TGCTTGGGCCCAGGAGGTAGAGG + Intergenic
1165281336 19:34800677-34800699 TGCTTGGACCCGGGGGGCAGAGG - Intergenic
1165934465 19:39380806-39380828 GGCCTGGCCTCCTGGGGTTGGGG + Intronic
1165953888 19:39489707-39489729 TGCTGCTCCTCCTGGGGTAGGGG - Exonic
1166169421 19:41017124-41017146 TGCTTGATCCCCGGGGGTGGAGG - Exonic
1166671777 19:44714422-44714444 TGCTTGAACCCATGGGGCAGGGG + Intergenic
1166825426 19:45606121-45606143 TGCTTGAGCCCCAGAGGTAGAGG - Intergenic
1167282605 19:48578790-48578812 TGCTTGGAACCGGGGGGTAGAGG + Intronic
1167359017 19:49020072-49020094 TGCTTTGCAACTTGGGGTAGAGG + Intergenic
1167468199 19:49661244-49661266 TGCTTGGCCCCTGTGGCTAGTGG + Intronic
1167797869 19:51721680-51721702 TGCTTGAACCCCTGAGGTGGAGG + Intronic
1168177815 19:54636872-54636894 TGCGTCCCCCCCTGGGCTAGTGG - Exonic
1202688963 1_KI270712v1_random:72738-72760 TGCTTGGACCCCGGAGGCAGAGG + Intergenic
927214021 2:20656039-20656061 TGCTTGTCCCCCTCTGGAAGAGG - Intergenic
928383783 2:30846741-30846763 TGCTTGAGCCCCTGAGTTAGAGG - Intergenic
928390043 2:30902549-30902571 TGTTTGTCCCCCTGGGGCTGAGG + Intergenic
928573807 2:32634738-32634760 TGCTTGAACCCATGGGGCAGAGG - Intronic
928580639 2:32704268-32704290 TGCTTGAACCCCAGAGGTAGAGG - Intronic
929694485 2:44102445-44102467 TGCTTGGGCCCGAGGGGTTGAGG + Intergenic
930074738 2:47397334-47397356 TGCTTGAACCCCAGGGGCAGAGG + Intergenic
933796922 2:85927316-85927338 GGCTTGGCACCGTGGGGGAGGGG - Intergenic
933957474 2:87383361-87383383 TGCTTGGACCCCGGAGGCAGAGG - Intergenic
934241591 2:90275256-90275278 TGCTTGGACCCCGGAGGCAGAGG - Intergenic
934271582 2:91541429-91541451 TGCTTGGACCCCGGAGGCAGAGG + Intergenic
935207486 2:100909084-100909106 TTCTGGTCCCCCTGGGGTGGAGG + Intronic
936732872 2:115405333-115405355 TCCTGGGCACACTGGGGTAGAGG + Intronic
937564376 2:123266065-123266087 TGCTTGGCCCCTTGTGTTATTGG + Intergenic
937999210 2:127719392-127719414 TGCATGCCACCCTGGGGTGGAGG + Exonic
938030808 2:127991421-127991443 TGCTTGGCCCCAGGAGGTTGAGG - Intronic
938568378 2:132540643-132540665 TGCCTGGCCACCTGGGTTGGAGG + Intronic
939317119 2:140566203-140566225 TGCTTGACCCCCTGGCGAAGGGG - Intronic
939861232 2:147422969-147422991 TGCTTGAACCCCGGGGGCAGGGG - Intergenic
944712622 2:202348813-202348835 TGCTTGAACCCCAGTGGTAGAGG - Intergenic
945871607 2:215232422-215232444 TGCTTGGACCCGGGAGGTAGAGG + Intergenic
946162036 2:217841294-217841316 TGCTGGCTCCCCTGGGGTGGGGG - Intronic
946189539 2:218001067-218001089 TGCTTGGACCCAGGAGGTAGAGG + Intronic
946622955 2:221578278-221578300 TGCTTGAGCCCCGGAGGTAGAGG - Intergenic
946819062 2:223611655-223611677 TGATTGGCCCCTTGGAGTACAGG - Intergenic
946961855 2:224993727-224993749 AGCTTGGCCACATTGGGTAGGGG - Intronic
947410362 2:229831545-229831567 TGCTTGGGCCCAGGAGGTAGAGG + Intronic
947550633 2:231042918-231042940 TGCTTGGACCCCGGAGGTGGAGG + Intronic
948892232 2:240913105-240913127 TCCTTGGACCCCGGGGCTAGTGG - Intergenic
1168730444 20:73906-73928 TGCTTGAACCCGTGGGGCAGAGG + Intergenic
1170223249 20:13963630-13963652 TGCTTGGACCCGGGAGGTAGAGG + Intronic
1171189209 20:23146779-23146801 TGCTTGGCCTCGTAGGGCAGGGG - Intergenic
1171456079 20:25273153-25273175 TGCTTGGCACCCTGGCCAAGGGG + Intronic
1172475211 20:35231957-35231979 TGCTTGAACCCCGGGGGCAGAGG + Intronic
1173353843 20:42268955-42268977 TGCATGACCTCCTGGGGAAGTGG - Intronic
1173535868 20:43812986-43813008 TGCTTGGACCCAGGGGGTGGAGG - Intergenic
1173681607 20:44885973-44885995 GGGTGGGCCCCGTGGGGTAGCGG + Intronic
1173725333 20:45293407-45293429 TGCTGCGCCGCCTGGGGGAGGGG - Intergenic
1173941922 20:46918390-46918412 TGCTTGAGCCCCAGAGGTAGAGG - Intronic
1174147963 20:48465399-48465421 TGCAAGACCCCCTGGGGTAGAGG - Intergenic
1174843626 20:53922234-53922256 TGCTTGGACCCCAGAGGCAGAGG + Intergenic
1175327227 20:58138082-58138104 TGGTGGGCCCCATGGGGTACAGG - Intergenic
1177102298 21:16913802-16913824 TGCTTGAACCCCTGAGGTGGAGG - Intergenic
1178695913 21:34792674-34792696 TGGGTAGCCCCCTGGGGCAGAGG - Intronic
1178717900 21:34983603-34983625 TTCTTGGCTACCTGGGGCAGGGG + Intronic
1179435283 21:41358444-41358466 TGCTGGGGCCCCTGAGGAAGGGG - Intergenic
1180018723 21:45105182-45105204 TGCTTGACCCCAGGAGGTAGAGG - Intronic
1181036406 22:20171782-20171804 TGCTGAGCCCCCAGGGGCAGGGG - Intergenic
1181351571 22:22262167-22262189 TGCTTGGACCCCGGAGGCAGAGG + Intergenic
1182286405 22:29250999-29251021 GGCTTGGGCCCCTGAGGTCGAGG - Intronic
1182338210 22:29599316-29599338 TGCTTGGGCCCCAGAGGCAGAGG + Intergenic
1182500855 22:30746338-30746360 TGCTTGACCCCCAGAGGTTGAGG + Intronic
1182782400 22:32878551-32878573 TGCTTGGCCCCCTGGGGTAGTGG - Intronic
1183074810 22:35420072-35420094 TGCTTGGCAACCAGGGGCAGTGG + Intronic
1183307669 22:37091425-37091447 TGCTGGGCCCCCAGGGGAGGGGG + Intronic
1183341243 22:37283134-37283156 TTTTTGGCCCCCGGGGGTTGGGG + Intronic
1183469069 22:37996262-37996284 GGCTGGGTCCCCTGGGGCAGTGG - Intronic
1183952123 22:41357843-41357865 TGATTTGCCCCCAGGGGGAGGGG - Exonic
1185044520 22:48522474-48522496 TGGTGGGCTCCCTGGGGCAGTGG + Intronic
1185210061 22:49565665-49565687 CGCTGGTCTCCCTGGGGTAGAGG + Intronic
950497094 3:13340334-13340356 TGCTTGGCGCCATGGGCTTGGGG - Intronic
950537322 3:13586579-13586601 TGCTTGAACCCCAGGGGTGGAGG - Intronic
951504703 3:23430600-23430622 TGCTTGACCCCAGGGGGTTGAGG - Intronic
951621015 3:24602499-24602521 TTCTTAGCCCCCTGGAGAAGGGG - Intergenic
953471377 3:43169559-43169581 TCATTGGCCCCCTGGGCCAGTGG + Intergenic
953951498 3:47193999-47194021 TGCTAGGCCCTATGAGGTAGAGG + Intergenic
955079225 3:55642416-55642438 TGCTTGAACCCCAGGGGCAGAGG - Intronic
955832171 3:63015882-63015904 TGCCTGGTTCCCTGGGGGAGGGG - Intergenic
956325051 3:68042969-68042991 TGCTTGAACCCGTGAGGTAGAGG - Intronic
957580459 3:82065894-82065916 TGATTTGCCACCTGTGGTAGTGG - Intergenic
960281292 3:115784197-115784219 TGCTTGGCCACCTGGGGGCGGGG - Intergenic
961350936 3:126301696-126301718 TGCTTGAACCCCGGGGGCAGAGG - Intergenic
961787045 3:129353531-129353553 TGCTGGGCACCCAGGGGTAGAGG + Intergenic
962505812 3:136045480-136045502 TGCCAGGCTCCCTTGGGTAGAGG - Intronic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
966615534 3:181908916-181908938 TGCTTGAGCCCCGGAGGTAGAGG + Intergenic
969482986 4:7456754-7456776 TGCTTGTCCCCCTGTGGCAGGGG + Intronic
971072927 4:23114940-23114962 TCCTTGGAACCCTGGAGTAGGGG + Intergenic
971168113 4:24204905-24204927 TGCTTGGACCCGTGAGGTAGAGG - Intergenic
972710269 4:41588509-41588531 TGCTTGGCTCCCTGTGCTACTGG - Intronic
976114837 4:81715452-81715474 TGCTGGGCTCCATGGGGTTGGGG - Intronic
978186073 4:105858338-105858360 TGCTTGGCTCCGTGGGGGTGGGG + Intronic
978666608 4:111191932-111191954 TACTTGGGCCCCAGAGGTAGAGG - Intergenic
979057702 4:116016647-116016669 TCCTTGACCTCCTGGGGCAGTGG - Intergenic
983743800 4:171169175-171169197 TTTTTTTCCCCCTGGGGTAGGGG + Intergenic
984136951 4:175952944-175952966 TGCTTGACCCCAGTGGGTAGAGG + Intronic
984440521 4:179763712-179763734 CGCTTGAACCCGTGGGGTAGAGG - Intergenic
985347687 4:189023748-189023770 TGCTTGAGCCCGGGGGGTAGAGG + Intergenic
986399045 5:7361578-7361600 TGCTTGTGCCACTGGGGAAGAGG + Intergenic
986415843 5:7527155-7527177 TGCCTGGTCCCCAGGGGTGGTGG + Intronic
986914903 5:12607579-12607601 TGCTTGAGCCCCAGGGGCAGAGG + Intergenic
990807236 5:59678547-59678569 TGCTTGAACCCCAGAGGTAGAGG - Intronic
990829604 5:59941790-59941812 TGCCTGGCCTCCTGAGGTGGGGG - Intronic
991037104 5:62138633-62138655 AGCTTGGCCCTCTGGGGTCAGGG - Intergenic
991697868 5:69289777-69289799 TGCTTGAGCCCATGAGGTAGAGG + Intronic
992231765 5:74670883-74670905 TGCTTGGCCCCTGGTGGGAGGGG - Intronic
993891677 5:93482663-93482685 TGCTTGGCTCCATGGGGCTGGGG - Intergenic
996564192 5:124862673-124862695 TGCTTGAGCCTGTGGGGTAGAGG + Intergenic
998229397 5:140350424-140350446 AGCTGTGCCCCCTGGGGGAGAGG + Intergenic
999000345 5:147914575-147914597 TGCTTGAACCCCGGGGGTGGAGG - Intergenic
1000618635 5:163458505-163458527 TGCTTGACCCCATGGGTTTGAGG + Intronic
1002314377 5:178333738-178333760 TGACTGGCCCCCTGAGGAAGTGG + Intronic
1002342507 5:178526298-178526320 TGCTTGGCCCCCCAGGTCAGGGG - Intronic
1004133227 6:12941324-12941346 TGCTTGGCCCACTGCAGTTGTGG + Intronic
1004245063 6:13966677-13966699 TGCTTGACCCCGCGGGGTGGAGG + Intronic
1005282042 6:24284525-24284547 TGCTTGAACCCGTGGGGCAGAGG + Intronic
1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG + Intronic
1007385327 6:41516601-41516623 TGCTTTGCCCACTGGGGTCAGGG - Intergenic
1007593022 6:43034782-43034804 TGCTTGAACCCCGGAGGTAGAGG + Intergenic
1007602213 6:43089684-43089706 GGCCTGGATCCCTGGGGTAGAGG - Intronic
1007643005 6:43357910-43357932 TGCTTGTTCCCCTGGGGAAAGGG - Intronic
1007687721 6:43676941-43676963 TGCTTGGCAGCCTAGGGTGGAGG - Intronic
1007809730 6:44477205-44477227 TTCATGGCCCCCTGTGGAAGTGG - Intergenic
1010467759 6:76189076-76189098 TGCTTGAACCCATGAGGTAGAGG + Intergenic
1010681822 6:78807569-78807591 TGCTGGGCTCCCTGGGGGGGGGG + Intergenic
1013412302 6:109892992-109893014 TCCTTGACCTCCTGGGGCAGTGG + Intergenic
1014190977 6:118496436-118496458 TGCTTGAACCCCGGGGGTGGAGG - Intronic
1014201579 6:118614755-118614777 TGCTTGGACCCCGGAGGTGGAGG + Intronic
1014474929 6:121860377-121860399 TGCTGGGGGCCCTGGGGCAGAGG + Intergenic
1014487046 6:122011901-122011923 TGCTTGAACCCATGGGGTGGAGG + Intergenic
1017758393 6:157549163-157549185 TGCTTGGCTCCCTGGAGCAGTGG + Intronic
1019579121 7:1751416-1751438 ACCTTGGCCCCCTGGGAGAGGGG + Intergenic
1020668562 7:11076649-11076671 TGCTTGAACCCCGGAGGTAGAGG - Intronic
1023705953 7:42941942-42941964 TGGTTGTCACGCTGGGGTAGGGG + Intronic
1024270496 7:47637953-47637975 TGCTTGAGCCCCAGAGGTAGAGG - Intergenic
1024995317 7:55269722-55269744 GGCTTGGCCTCCTGGGCTGGTGG - Intergenic
1025971357 7:66328993-66329015 TGCTTGAGCCCGTGGGGTTGAGG - Intronic
1028793411 7:94878376-94878398 TGGTTGGCAACCTGGGGTAAAGG + Intergenic
1028841166 7:95431501-95431523 TGCTTGAACCCCAGAGGTAGAGG - Intronic
1028858756 7:95622868-95622890 TTTTTTGCCCCCAGGGGTAGCGG - Intergenic
1029270285 7:99373522-99373544 TGCTTGAACCCCGGGGGCAGAGG - Intronic
1029952693 7:104603834-104603856 TGCTGGGCACACTGGGGTGGGGG + Intronic
1032035148 7:128516057-128516079 TGCTTGAACCCGGGGGGTAGAGG + Intergenic
1032106721 7:129037787-129037809 TGCCTGTCCCCTAGGGGTAGAGG - Intronic
1034151188 7:148916683-148916705 TGCTTGTCCCCCCTGGGGAGGGG - Intergenic
1034276491 7:149826151-149826173 TGCTCGGCCCCCTGTGGTGGGGG + Intergenic
1034305549 7:150042504-150042526 TGCCTCGCCCCCTGCGATAGTGG + Intergenic
1034720231 7:153285415-153285437 TGGTTGGGCTACTGGGGTAGGGG + Intergenic
1035163681 7:156970194-156970216 TGCTTGGACCCTGGAGGTAGAGG + Exonic
1035472641 7:159119990-159120012 TGCTTGTCCCCCTTGGGGAGGGG + Intronic
1035553608 8:546676-546698 GGCCTGGCCTCCTGGGCTAGGGG + Intergenic
1036555998 8:9861133-9861155 TGCTTGGACCCAGGAGGTAGAGG + Intergenic
1036785189 8:11681012-11681034 TGCTTTGCAGCCTGGGGTATGGG - Intronic
1037401279 8:18497475-18497497 TGCAGGGCCCCTTGGGGGAGAGG + Intergenic
1039455838 8:37705883-37705905 TGCTTGAGCCCCAGGGGTGGAGG - Intergenic
1040498472 8:47987354-47987376 TGCTTGAACCCGGGGGGTAGAGG + Intergenic
1046174449 8:110556724-110556746 TGCTTGAACCCCAGGGGCAGAGG + Intergenic
1049743982 8:144255329-144255351 GGCTTGGCCCTCAGGGGTAGAGG - Intronic
1051852735 9:21528229-21528251 TGCTTTGGGCCCTGGGGAAGTGG + Intergenic
1053350358 9:37409959-37409981 TGCTTGGTCCCAGGAGGTAGAGG - Intergenic
1056375977 9:86011440-86011462 TGCTTGAACCCAGGGGGTAGAGG - Intronic
1057010020 9:91592356-91592378 TGCTTGAACCCCGGGGGCAGAGG - Intronic
1057046076 9:91887055-91887077 TGCTAGGACCCCTGCGGTCGAGG + Intronic
1057375395 9:94517105-94517127 CGCTTGAACCCCTGAGGTAGAGG - Intergenic
1058847438 9:108975077-108975099 CGCTTGAACCCCTGAGGTAGAGG + Intronic
1058967498 9:110050709-110050731 TGCTTGAACCCATGAGGTAGAGG - Intronic
1059105456 9:111507366-111507388 TGCTTGACCCCCAGAGGCAGTGG + Intergenic
1059455149 9:114395662-114395684 TGCTTGGCAGCCTGGAGTTGGGG - Intergenic
1060932557 9:127498010-127498032 TGCCTGCCTCCCTGGGGAAGAGG + Intronic
1061958770 9:133977448-133977470 TCCCAGGCCCCCTGGGGTGGCGG - Intronic
1062099874 9:134722464-134722486 TGCTGGACACCCTGGGGTACGGG + Intronic
1186482526 X:9907021-9907043 TGCTGGTCCCCCTGGCGTTGGGG + Intronic
1189468525 X:41296499-41296521 TGCTTGAACCCAGGGGGTAGAGG + Intergenic
1189559421 X:42176961-42176983 TGCTAGGCATCCTGAGGTAGTGG + Intergenic
1190507819 X:51145160-51145182 TGCTGGGCTCCCTGGAGTAGGGG + Intergenic
1195628247 X:107026444-107026466 TGCTTGAACCCGTGAGGTAGAGG + Intergenic
1197870342 X:131058075-131058097 CTCTGGGCTCCCTGGGGTAGGGG + Intergenic
1198103931 X:133444996-133445018 TGGTTGGCCCTGTGGAGTAGTGG + Intergenic
1201737232 Y:17281312-17281334 TGCTTGACCCCAGGAGGTAGAGG - Intergenic
1202168122 Y:22014070-22014092 TCCTTGACCTCCTGGGGCAGGGG - Intergenic
1202223239 Y:22572298-22572320 TCCTTGACCTCCTGGGGCAGGGG + Intergenic
1202319876 Y:23623362-23623384 TCCTTGACCTCCTGGGGCAGGGG - Intergenic
1202550892 Y:26046694-26046716 TCCTTGACCTCCTGGGGCAGGGG + Intergenic