ID: 1182786726

View in Genome Browser
Species Human (GRCh38)
Location 22:32914172-32914194
Sequence ATACAAACCTGAGCTAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182786725_1182786726 18 Left 1182786725 22:32914131-32914153 CCAATGTAAGTGACAGCGCTGGC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1182786726 22:32914172-32914194 ATACAAACCTGAGCTAACAGAGG 0: 1
1: 0
2: 1
3: 8
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182786726 Original CRISPR ATACAAACCTGAGCTAACAG AGG Intronic
900558362 1:3291293-3291315 ACACACACCTGCGCTCACAGTGG + Intronic
900675201 1:3881083-3881105 AGGCAACACTGAGCTAACAGAGG + Intronic
900953400 1:5872363-5872385 ATTCAGACCTGAGCTAGCAGAGG + Intronic
901951623 1:12753705-12753727 ATACAAAACTGAACTCAAAGTGG + Intronic
904920708 1:34005778-34005800 ATACAAATCTGAGGTATCAGAGG - Intronic
906817157 1:48890758-48890780 ATACCAACCTGAGCTCACCCTGG - Intronic
906925190 1:50108600-50108622 TTGCAAACCTAAACTAACAGTGG - Intronic
907904238 1:58769737-58769759 CTGCACACCTGAGCAAACAGAGG + Intergenic
910595466 1:88975877-88975899 ATACAAAAATGAGCTAAGCGTGG + Intronic
912944055 1:114069981-114070003 ATACAATCCTGAGGTGGCAGGGG - Intergenic
913722347 1:121610420-121610442 TTTCAAACCTGAACTATCAGAGG + Intergenic
913722433 1:121611614-121611636 TTACAAACGTGAACTAACAAAGG + Intergenic
913742107 1:121857678-121857700 TTTCAAACCTGAACTATCAGAGG + Intergenic
913742193 1:121858872-121858894 TTACAAACGTGAACTAACAAAGG + Intergenic
913751791 1:121976071-121976093 TTACAAACGTGAACTAACAAAGG + Intergenic
913786062 1:122454297-122454319 TTTCAAACCTGAACTATCAGAGG - Intergenic
914681294 1:149940224-149940246 AAAAAAAACTGAGCTAATAGAGG + Exonic
914986902 1:152467446-152467468 ACACAAACCTGTGCATACAGAGG - Intergenic
916482525 1:165227573-165227595 ATACAATGCAGAGCCAACAGAGG + Intronic
921298239 1:213724464-213724486 ATACAAACCTGAGATCACAAGGG + Intergenic
923072659 1:230579989-230580011 TTACAAGCCTTAGCTCACAGTGG + Intergenic
923385114 1:233458580-233458602 AAACAAAACTGAGCTTAGAGAGG - Intergenic
1063122354 10:3113896-3113918 ATACAAACCTTAGTGAACACAGG + Intronic
1064827707 10:19424313-19424335 ATACAAAAATGAGCTAAGCGTGG - Intronic
1065764616 10:29016211-29016233 ACACAAACCAGAGCTAAAAAAGG - Intergenic
1066081864 10:31938637-31938659 ATACAAAACTCAGCTGAGAGTGG - Intergenic
1069643969 10:69978300-69978322 ATACAAAAATTAGCTGACAGTGG + Intergenic
1071341705 10:84654801-84654823 ACAGAAACCAAAGCTAACAGTGG - Intergenic
1071472780 10:85996028-85996050 TTTCAAACCTGAGCTGACATTGG + Intronic
1073378702 10:103060403-103060425 ATACAAACATCAGCTAGGAGTGG + Intronic
1073835209 10:107433750-107433772 ATACTAAGCTGAGCACACAGAGG - Intergenic
1075791777 10:125089869-125089891 ATATGAAACTGAGCCAACAGAGG - Intronic
1081229993 11:40574454-40574476 GAACAAACCTGAGCTAAGGGAGG + Intronic
1082554643 11:54548330-54548352 TTTCAAACCTGATCTAACAAAGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1083483966 11:62971275-62971297 ATACAAACATTAGCTAGGAGTGG + Intronic
1090023002 11:123143962-123143984 ATACAAAACTTAGCCAAGAGTGG - Intronic
1090497772 11:127231459-127231481 AAACAAACCAGAGCTCACTGTGG + Intergenic
1090535239 11:127633692-127633714 ATACAAACCTAAGAAAAAAGAGG + Intergenic
1093237763 12:16632165-16632187 ATACAAAACTTAGCTAAGCGTGG - Intergenic
1094086567 12:26599512-26599534 AAAGAAAACTGAGCTCACAGAGG + Intronic
1094373741 12:29767546-29767568 ATACAAAACTGAACAAACTGTGG + Intronic
1097407396 12:59207083-59207105 ATACAAAAATCAGCTCACAGTGG + Intergenic
1098764256 12:74466547-74466569 ACAAACCCCTGAGCTAACAGAGG - Intergenic
1100568135 12:95818563-95818585 ATACACACCTGACTTAACTGAGG - Intronic
1101938833 12:109083767-109083789 AGACAATCCTGACCTAACTGGGG - Intronic
1104255308 12:127131012-127131034 ATACAAACCTCAGCAAACCATGG - Intergenic
1105834564 13:24197979-24198001 AAACAAACACGAGGTAACAGGGG - Intronic
1107907075 13:45071172-45071194 ATACAAGCATTAGCTAAGAGCGG + Intergenic
1108126774 13:47252987-47253009 ATAGAAACCTGACCAAATAGAGG - Intergenic
1110956418 13:81558552-81558574 ATACAAAAATGAGCTAGGAGTGG + Intergenic
1111328686 13:86733350-86733372 ATACAAACATTAGCTGACCGTGG + Intergenic
1113921210 13:113913620-113913642 ATTCACACATGAGCCAACAGTGG + Intergenic
1113921215 13:113913664-113913686 ATTCACACATGAGCCAACAGTGG + Intergenic
1113921220 13:113913708-113913730 ATTCACACGTGAGCCAACAGTGG + Intergenic
1113921279 13:113914155-113914177 ATTCACACATGAGCCAACAGTGG + Intergenic
1113921308 13:113914421-113914443 ATTCACACGTGAGCCAACAGTGG + Intergenic
1114172752 14:20289879-20289901 AGACAAAACTGAGCTAACACAGG + Intronic
1114282811 14:21209938-21209960 ACACAAAGATTAGCTAACAGGGG + Intronic
1115445661 14:33486465-33486487 AAGCAACCCTGGGCTAACAGGGG + Intronic
1116739978 14:48742079-48742101 ATAGAATCCTGAGCTAAGTGGGG + Intergenic
1116932852 14:50707258-50707280 AAAAAAACCTGATCTCACAGAGG + Intergenic
1117732652 14:58739378-58739400 ATAGAAACCTGAGCTTGCAGTGG + Intergenic
1117823120 14:59672168-59672190 TGACAAACCTGAGCTCAAAGAGG - Intronic
1118953000 14:70451950-70451972 TTACAAACCTGTGCTGTCAGGGG + Intergenic
1121469119 14:94138308-94138330 TTGCAAACCTGTGCTAAGAGCGG + Intergenic
1123815028 15:23969139-23969161 ATACAAATCTAAGCTACCATAGG - Intergenic
1125738865 15:41947460-41947482 AAATAAACCTAAGCTTACAGCGG + Intronic
1125916077 15:43488736-43488758 ATACAAACATTAGCCAGCAGTGG + Intronic
1127667361 15:61161432-61161454 AGACAAAACTGAGCTCAGAGAGG - Intronic
1131145925 15:90012047-90012069 ATACAAAAATGAGCTAAGTGTGG + Intronic
1131258183 15:90875188-90875210 ATACAAACATGAGCCAAGTGTGG - Intronic
1134634713 16:15783557-15783579 ATACAAATCTCAGCTACAAGTGG + Intronic
1136139082 16:28277198-28277220 GTACAAACCTCAGAGAACAGAGG - Intergenic
1136728139 16:32379232-32379254 AATCAAACCTAAGCTTACAGAGG - Intergenic
1138146063 16:54612766-54612788 AGATAAACCTGACCTAGCAGGGG - Intergenic
1140326625 16:74010420-74010442 ATACAAAAATGAGCCAAGAGTGG + Intergenic
1202998300 16_KI270728v1_random:138522-138544 AATCAAACCTAAGCTTACAGAGG + Intergenic
1143676954 17:8440652-8440674 TTAAAAACCTGAGTTATCAGGGG + Intronic
1145456033 17:23320483-23320505 ATTCAAACCTGAACTATCACAGG - Intergenic
1145546730 17:24639631-24639653 ATTCAAACCTGAACTATCACAGG - Intergenic
1145680450 17:26584192-26584214 ATTCAAACCTGAACTATCAAAGG - Intergenic
1145681703 17:26602100-26602122 ATTCAAACCTGAACTATCAAAGG - Intergenic
1145683249 17:26624148-26624170 ATTCAAACCTGAACTATCAAAGG - Intergenic
1145683412 17:26626529-26626551 ATTCAAACCTGAACTATCAAAGG - Intergenic
1145683662 17:26630584-26630606 ATTCAAACCTGAACTATCAAAGG - Intergenic
1146529002 17:33591919-33591941 AGAGAAACCTGAGCTAACCTAGG + Intronic
1147593137 17:41698433-41698455 ATACAAAACTTAGCGAACTGTGG + Intergenic
1150820203 17:68428554-68428576 ACACAGCCCTGAGCTCACAGTGG - Intronic
1152275089 17:79351807-79351829 ATTAAAACCTGAGGTATCAGAGG - Intronic
1153352538 18:4096865-4096887 CTATAAAACTGAGCTAACAATGG + Intronic
1155997194 18:32342571-32342593 CTACACACCTCAGCTCACAGTGG + Intronic
1157756005 18:50218430-50218452 TCACAAAAGTGAGCTAACAGTGG + Intergenic
1158449633 18:57552554-57552576 ATACAAAACTTAGCTAAGCGTGG - Intronic
1160377503 18:78424133-78424155 ATACAAAGCTGAGTTCGCAGCGG - Intergenic
1160434751 18:78840161-78840183 ACACAAACATGAGCTCACACAGG - Intergenic
1162217466 19:9148305-9148327 ATGCAAACCAGAGCTCAGAGTGG - Intronic
1165665797 19:37626834-37626856 CTACAAGCTTGAGCTTACAGGGG + Intronic
931100585 2:58995808-58995830 ATACAATCCTCAGCTAATATTGG + Intergenic
932300320 2:70662572-70662594 ATACAACCCAAAGCCAACAGAGG + Exonic
932868147 2:75368731-75368753 ATACAGACTTGAGCCACCAGAGG + Intergenic
933089742 2:78105895-78105917 AGCCAAACATGAGCTAACATGGG + Intergenic
933246486 2:79981175-79981197 ATACAAAACTAAGTAAACAGAGG + Intronic
934317835 2:91941857-91941879 AATCAAACCTAAGCTTACAGAGG + Intergenic
934633839 2:95962643-95962665 ATAAAAACCTAAACTAATAGGGG - Intronic
934799788 2:97142522-97142544 ATAAAAACCTAAACTAATAGGGG + Intronic
934930325 2:98416996-98417018 ATGCAAACCTCAGCTTTCAGGGG + Intergenic
936383813 2:112011358-112011380 CTACAAACCTGGGGTGACAGTGG + Intronic
936679676 2:114755990-114756012 AAACAACCCTGACCTAAGAGAGG + Intronic
937629033 2:124078680-124078702 AAACAAAACTGACATAACAGTGG - Intronic
941250496 2:163155781-163155803 ATACAAATCTGATCTGACTGAGG + Intergenic
942134641 2:172912669-172912691 ATACACAGATGAGCTAACAAAGG - Intronic
943931473 2:193859364-193859386 ATACAAAAATTAGCTAAGAGTGG - Intergenic
946356304 2:219187680-219187702 ATACAAACATTAGCCAAGAGTGG + Intergenic
1171773485 20:29345468-29345490 ATTCAAACCTAACCTATCAGGGG + Intergenic
1171815524 20:29783016-29783038 ATTCAAACCTAACCTATCAGGGG + Intergenic
1171902855 20:30873019-30873041 ATTCAAACCTAACCTATCAGGGG - Intergenic
1178103190 21:29291969-29291991 ATTCAATCATGAGCTAACTGAGG - Intronic
1179605157 21:42511219-42511241 ATACACACCTGAACAACCAGTGG + Intronic
1180336244 22:11578989-11579011 ATTCAAACCTAACCTATCAGGGG - Intergenic
1181500839 22:23314739-23314761 ATGCAACCCTGACCTGACAGAGG + Intronic
1182786726 22:32914172-32914194 ATACAAACCTGAGCTAACAGAGG + Intronic
1183033812 22:35125589-35125611 ATACAAAAATTAGCTAAGAGTGG + Intergenic
1183525849 22:38322152-38322174 ATACAAACATTAGCTAGGAGTGG + Intronic
952684938 3:36136392-36136414 ATACAAACAGGAGCTAAGAAGGG - Intergenic
956754936 3:72375818-72375840 GTAGAAACCGCAGCTAACAGTGG - Exonic
968248413 3:197179600-197179622 ATATAAAAATAAGCTAACAGGGG + Intronic
974709538 4:65572873-65572895 ATACAAACATTAGCCAAGAGTGG + Intronic
981176051 4:141684920-141684942 CTATAAAACTGAGCTTACAGTGG + Intronic
982136922 4:152281058-152281080 ATAGAAACCTGAGGAAGCAGGGG - Intergenic
983060900 4:163159423-163159445 ATAAAAACCTAAGTTAAAAGAGG + Intronic
983135540 4:164075099-164075121 AGAAAAGCCTGAGATAACAGAGG - Intronic
985403234 4:189612725-189612747 CTACAAACCTGTGCTGACAAAGG + Intergenic
987665988 5:20940596-20940618 ATACAAACTTCAAATAACAGTGG - Intergenic
988756699 5:34261582-34261604 ATACAAACTTCAAATAACAGTGG + Intergenic
989780458 5:45258156-45258178 ATAAAAACCTAAGCTGAAAGAGG + Intergenic
991961516 5:72049312-72049334 ATAGAAAACTCGGCTAACAGTGG + Intergenic
992262502 5:74985397-74985419 CTCCAAATCTGAGCTCACAGGGG + Intergenic
992661415 5:78965112-78965134 ATACAAACCTTTCCTAATAGAGG + Intronic
995500535 5:112800517-112800539 TTAAAAATCTGACCTAACAGTGG - Intronic
995647210 5:114326461-114326483 ATACCAACATGAGCCATCAGAGG + Intergenic
999086882 5:148900505-148900527 ATCCAGACCAGAGATAACAGTGG + Intergenic
1000147524 5:158467925-158467947 ATAGAAAACTGAGGAAACAGTGG + Intergenic
1001479082 5:172074861-172074883 ATACAAAAATGAGCTAAGTGTGG + Intronic
1002368654 5:178732003-178732025 ACAGAAACCTTTGCTAACAGTGG + Intergenic
1003796375 6:9609821-9609843 ATACAAACATCACTTAACAGTGG - Intronic
1004186694 6:13427094-13427116 GGACAAAACTGAGGTAACAGAGG + Intronic
1004198694 6:13528402-13528424 ATACAAACCTGAGTTGTAAGAGG + Intergenic
1006612010 6:35299752-35299774 CTGGAAACCTGGGCTAACAGTGG + Intronic
1006722427 6:36165555-36165577 ATACAAACGTTAGCTAAGTGTGG + Intergenic
1008241864 6:49123501-49123523 ATACAGACAGGAGCTAATAGTGG - Intergenic
1008788877 6:55204467-55204489 ATACAAACCTGAGCTAATACTGG + Intronic
1009310839 6:62150750-62150772 ACACAAAGCTGAGATAACAAAGG - Intronic
1010190470 6:73190409-73190431 ATAAAAGCCTGAGATTACAGTGG - Intronic
1011305182 6:85917718-85917740 AGAAAAACCTGAGCTAAAACTGG - Intergenic
1012706037 6:102532309-102532331 ATAAAAACTTGAGCTCAAAGAGG + Intergenic
1012894603 6:104934145-104934167 AAAAAGATCTGAGCTAACAGTGG - Intergenic
1013556127 6:111259190-111259212 ATACTTAGCTGAGCTCACAGAGG - Intergenic
1014792204 6:125685905-125685927 ATTAAAACCAGAGCAAACAGAGG + Intergenic
1017692972 6:156985539-156985561 ATAAAAACATGAGTTAACTGAGG - Intronic
1018164523 6:161080710-161080732 ATTTAGACCTCAGCTAACAGTGG + Intronic
1020285975 7:6680979-6681001 ATGCAAACCTGAGGATACAGAGG + Intergenic
1021421066 7:20445069-20445091 ATTCAAACCTGTGATAACACTGG - Intergenic
1023316615 7:38944308-38944330 ATACAAACATTAGCTGAGAGTGG + Intergenic
1023485047 7:40677307-40677329 ATAGAACACTTAGCTAACAGTGG + Intronic
1026521191 7:71119487-71119509 ATACAAAAATTAGCTGACAGTGG - Intergenic
1029929000 7:104350882-104350904 ATACAAACATTAGCTGAGAGTGG + Intronic
1030552813 7:110985940-110985962 TTACAAACTTGAGCAAACATAGG + Intronic
1030712737 7:112770407-112770429 GAACAAATCTTAGCTAACAGAGG + Intronic
1033436218 7:141335736-141335758 ATGCCAACCTGACCCAACAGAGG - Intronic
1034022056 7:147655276-147655298 ATACAAACATTAGCTAAGCGTGG - Intronic
1034871253 7:154686032-154686054 ATACTAACTTGTGATAACAGCGG + Intronic
1036026256 8:4912598-4912620 AAACAAACTTGAGCTAAAATAGG - Intronic
1041668837 8:60472353-60472375 ATAGCAACCTGAGCTAAGACAGG + Intergenic
1042640325 8:70927249-70927271 ATAGACACAGGAGCTAACAGAGG + Intergenic
1042656962 8:71110302-71110324 ATACAAACATTAGCCAAGAGTGG + Intergenic
1044337361 8:91003088-91003110 ATACAAACCTAAAATAACAATGG + Intronic
1046241474 8:111501129-111501151 ATACAAAGCAGAGCTTAGAGAGG - Intergenic
1046392374 8:113592261-113592283 ATACAAAATTGAGCTCAAAGTGG - Intergenic
1046604903 8:116360796-116360818 AAACAAATCTGAGCAAACAAGGG - Intergenic
1053490836 9:38500622-38500644 ATACACTCTTGAGCTACCAGTGG - Intergenic
1055063111 9:72091237-72091259 ATACAAAACTTAGCTAAGTGTGG + Intergenic
1057093754 9:92284897-92284919 ATACAAACATGAGCACAGAGAGG + Intronic
1057671152 9:97089835-97089857 ATACACTCTTGAGCTACCAGTGG - Intergenic
1058740195 9:107935234-107935256 ATACAGAACTGACCTACCAGGGG + Intergenic
1187869900 X:23755827-23755849 ATACAAAACTTAGCTAAGTGTGG + Intronic
1189255848 X:39638408-39638430 ATCCAATCCTAAGCAAACAGAGG - Intergenic
1189784508 X:44547370-44547392 ATACAAAACTTAGCTAACCGTGG + Intergenic
1191076568 X:56460149-56460171 ATACTAATCTGAGCTAAAGGAGG - Intergenic
1191277729 X:58621413-58621435 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191280487 X:58658447-58658469 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191287812 X:58756571-58756593 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191291717 X:58808435-58808457 TTACAAACCTGAACTATCAAAGG - Intergenic
1191294946 X:58851637-58851659 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191296636 X:58874260-58874282 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191298323 X:58896547-58896569 TTACAAACCTGAACTATCAAAGG - Intergenic
1191298476 X:58898604-58898626 TTACAAACCTGAACTATCAAAGG - Intergenic
1191302174 X:58947971-58947993 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191302477 X:58952085-58952107 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191306338 X:59003100-59003122 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191311095 X:59066706-59066728 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191313402 X:59097588-59097610 TTACAAACCTGAACTATCAAAGG - Intergenic
1191313861 X:59103761-59103783 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191317669 X:59154656-59154678 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191319359 X:59177285-59177307 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191323356 X:59230765-59230787 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191323504 X:59232822-59232844 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191325496 X:59259561-59259583 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191330714 X:59329488-59329510 TTACAAACCTGAACTATCAAAGG - Intergenic
1191332206 X:59349557-59349579 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191334200 X:59376299-59376321 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191338064 X:59427729-59427751 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191338989 X:59440072-59440094 TTACAAACCTGAACTATCAAAGG - Intergenic
1191340071 X:59454470-59454492 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191346422 X:59539200-59539222 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191346571 X:59541257-59541279 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191348881 X:59572112-59572134 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191355748 X:59663980-59664002 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191356360 X:59672214-59672236 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191357911 X:59692782-59692804 TTACAAACCTGAACTATCAAAGG - Intergenic
1191359729 X:59716959-59716981 TTACAAACCTGAACTATCAAAGG - Intergenic
1191360340 X:59725187-59725209 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191371716 X:59877412-59877434 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191372176 X:59883583-59883605 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191381645 X:60009946-60009968 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191383001 X:60028094-60028116 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191391086 X:60136095-60136117 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191392161 X:60150494-60150516 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191397055 X:60216309-60216331 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191397978 X:60228651-60228673 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191399517 X:60249220-60249242 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191401113 X:60270641-60270663 ATGCAAACCTGAACTATCAGAGG - Intergenic
1191403235 X:60298930-60298952 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191407191 X:60351879-60351901 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191409617 X:60384791-60384813 TTGCAAACCTGAGCTATCAAAGG - Intergenic
1191411222 X:60406212-60406234 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191411524 X:60410325-60410347 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191423532 X:60570838-60570860 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191424770 X:60587291-60587313 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191424920 X:60589347-60589369 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191425532 X:60597577-60597599 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191426909 X:60616092-60616114 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191427517 X:60624321-60624343 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191431484 X:60677795-60677817 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191437568 X:60759214-60759236 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191441215 X:60807734-60807756 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191442755 X:60828301-60828323 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191444449 X:60850935-60850957 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191448145 X:60900309-60900331 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191448298 X:60902367-60902389 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191450128 X:60926888-60926910 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191454488 X:60985345-60985367 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191456492 X:61011920-61011942 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191460613 X:61067464-61067486 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191461080 X:61073637-61073659 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191466223 X:61142370-61142392 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191467447 X:61158829-61158851 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191469049 X:61180248-61180270 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191469194 X:61182305-61182327 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191469813 X:61190534-61190556 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191469965 X:61192590-61192612 TTACAAACCTGAACTATCAAAGG - Intergenic
1191472042 X:61220361-61220383 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191475096 X:61261329-61261351 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191476000 X:61273670-61273692 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191481683 X:61349453-61349475 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191485781 X:61404494-61404516 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191486695 X:61416837-61416859 TTACAAACCTGAACTATCAAAGG - Intergenic
1191492347 X:61492454-61492476 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191492651 X:61496569-61496591 TTACAAACCTGAACTATCAAAGG - Intergenic
1191503799 X:61645014-61645036 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191504404 X:61653245-61653267 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191507326 X:61692323-61692345 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191508866 X:61712894-61712916 TTACAAACCTGAACTATCAAAGG - Intergenic
1191510249 X:61731379-61731401 ATGCAAACCTGAACTATCAGAGG - Intergenic
1191511162 X:61743721-61743743 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191513440 X:61774411-61774433 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191513591 X:61776468-61776490 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191514497 X:61788470-61788492 TTACAAACCTGAACTATCAAAGG - Intergenic
1191515858 X:61806817-61806839 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191516164 X:61810931-61810953 TTACAAACCTGAACTATCAAAGG - Intergenic
1191522609 X:61896819-61896841 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191522910 X:61900934-61900956 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191527804 X:61966601-61966623 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191530795 X:62006551-62006573 TTACAAACCTGAACTATCAAAGG - Intergenic
1191533428 X:62041527-62041549 TTACAAACCTGAACTATCAAAGG - Intergenic
1191537567 X:62096964-62096986 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191541256 X:62146531-62146553 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191541409 X:62148587-62148609 TTACAAACCTGAACTATCAAAGG - Intergenic
1191542640 X:62165051-62165073 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191543099 X:62171228-62171250 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191547865 X:62234837-62234859 TTACAAACCTGAACTATCAAAGG - Intergenic
1191548472 X:62243051-62243073 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191549085 X:62251283-62251305 TTACAAACCTGAACTATCAAAGG - Intergenic
1191549857 X:62261568-62261590 TTACAAACCTGAACTATCAAAGG - Intergenic
1191551402 X:62282139-62282161 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191555387 X:62335455-62335477 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191556129 X:62345393-62345415 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191558446 X:62376244-62376266 ATGCAAACCTGAACTATCAAAGG - Intergenic
1191558903 X:62382416-62382438 ATGCAAACCTGAACTATCAAAGG - Intergenic
1192783156 X:74314301-74314323 ATACAAAGGTGAGCTGAGAGGGG + Intergenic
1193797946 X:85899334-85899356 ATTCAAACCAGGCCTAACAGTGG + Intronic
1195432277 X:104802576-104802598 ATACAAAACTGTGCATACAGCGG - Intronic
1195598594 X:106721040-106721062 ATACTAACTTGAGCTGACCGAGG + Intronic
1198396765 X:136226971-136226993 ATACAAAACTGAGCTGAGCGTGG + Intronic
1201185401 Y:11396889-11396911 AATCAAACCTAAGCTTACAGAGG + Intergenic