ID: 1182791109

View in Genome Browser
Species Human (GRCh38)
Location 22:32953830-32953852
Sequence ATGTTGATGAAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 613}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182791109_1182791115 7 Left 1182791109 22:32953830-32953852 CCCTCCTCCTTCTTCATCAACAT 0: 1
1: 0
2: 3
3: 63
4: 613
Right 1182791115 22:32953860-32953882 CTTGGCAATATAAGATGTTAGGG 0: 1
1: 0
2: 0
3: 10
4: 142
1182791109_1182791114 6 Left 1182791109 22:32953830-32953852 CCCTCCTCCTTCTTCATCAACAT 0: 1
1: 0
2: 3
3: 63
4: 613
Right 1182791114 22:32953859-32953881 ACTTGGCAATATAAGATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182791109 Original CRISPR ATGTTGATGAAGAAGGAGGA GGG (reversed) Intronic
900075424 1:812377-812399 ATGTTGGTGGAAATGGAGGATGG + Intergenic
900994201 1:6111666-6111688 AGATTGAGGAAGAACGAGGAAGG + Intronic
901218597 1:7569216-7569238 ATGGTGATGATGATGGATGATGG - Intronic
901509191 1:9707277-9707299 TTGTTGATGAAGATGAAGGCTGG - Intronic
901674852 1:10877156-10877178 TTCTTGAGGCAGAAGGAGGAGGG + Intergenic
901723569 1:11220606-11220628 ATGTTTAATAAGATGGAGGAAGG + Intronic
903000105 1:20259167-20259189 ATTATGGAGAAGAAGGAGGAAGG + Intergenic
903287338 1:22285395-22285417 ATGCTGATGAAGAGGAAGGTAGG + Intergenic
903335416 1:22621246-22621268 ATGTTTATGGAGCAGGAAGAGGG - Intergenic
903422880 1:23231396-23231418 ATCTTGAAAAAGAAGGAGCACGG + Intergenic
903491079 1:23729081-23729103 ATCTTGAAGGAGGAGGAGGAAGG - Intergenic
904109060 1:28110954-28110976 CTGTTAATGAAGAAGGGGAAGGG + Intergenic
905270662 1:36785483-36785505 ATGCTGATGAGGAGGGAGGAGGG + Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905502073 1:38447365-38447387 ATGATAATGAAGAATGAGAAGGG + Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906383619 1:45348371-45348393 GTGTTTCTGAGGAAGGAGGAAGG - Intronic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
906958408 1:50397160-50397182 CTGGTGTTGAAGAAAGAGGAAGG - Intergenic
908733799 1:67254992-67255014 ATGCGGATGGAGAAGGAGGCTGG - Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909428443 1:75556047-75556069 GTGATGGTGTAGAAGGAGGAGGG + Intronic
909556891 1:76963970-76963992 ATGTTTTTGAAGATAGAGGAGGG + Intronic
910278733 1:85475311-85475333 ATGATGATGGAGGAGGAGAAGGG + Intronic
910488461 1:87742077-87742099 AGCTTGATGAAAAAGGAGAAGGG - Intergenic
911119140 1:94277715-94277737 ACCTTGATGGAGAAGGAGGAGGG - Intergenic
911122740 1:94312327-94312349 AAAATGAAGAAGAAGGAGGAAGG - Intergenic
911459296 1:98169364-98169386 ATTTAGATGAAGAAGGTGGTGGG - Intergenic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
912168529 1:107069400-107069422 ATAATAATAAAGAAGGAGGAGGG + Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912748292 1:112264373-112264395 ATGTTGATTAAGAAGTATGTTGG - Intergenic
913498268 1:119448045-119448067 AGGTTGAAAAACAAGGAGGAAGG - Intergenic
913691518 1:121284247-121284269 ATCTTCATGAAGTAGGATGAAGG - Intronic
914146028 1:144995734-144995756 ATCTTCATGAAGTAGGATGAAGG + Intronic
914343731 1:146780880-146780902 CTTTTGATGAGGAAGCAGGAAGG - Intergenic
914450769 1:147789478-147789500 ATGTTGATGAAGAAGGGGAATGG + Intergenic
914689940 1:150016815-150016837 ATGTTGCTGAACAAGGAGCTGGG + Intergenic
914788227 1:150852779-150852801 ATTTTGATGATGATGGAGAAGGG - Exonic
914901780 1:151715025-151715047 ATGGTGATCAAGATGGAGGGAGG - Intronic
914915003 1:151814274-151814296 TTGTTGATGGAAGAGGAGGAAGG + Intronic
916091137 1:161308779-161308801 ATCTTGATGTATAAGGAAGAGGG - Intronic
916771010 1:167908144-167908166 ATGTTGATGAACAATTAGGTTGG - Intronic
916890482 1:169107871-169107893 ATGATGATGTTGGAGGAGGAGGG - Intronic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
918120767 1:181537665-181537687 ATGATGATGAAGCATGAGGGTGG + Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919061581 1:192640862-192640884 AGGTTCCTGAAGAAGAAGGAGGG - Intronic
919253386 1:195089592-195089614 ATGTTGAGGAAGAGGGAGCCTGG - Intergenic
919424871 1:197417496-197417518 GAGTTGATAAAGAAGGAAGAAGG + Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920478845 1:206302725-206302747 ATCTTCATGAAGTAGGATGAAGG - Intronic
921275305 1:213513168-213513190 ACTTTGAAGATGAAGGAGGAGGG + Intergenic
921667689 1:217892364-217892386 ATGTTGATTAAGAAAAAAGAAGG + Intergenic
921693129 1:218176334-218176356 TTCTTGATGAAGGAGGAGCAAGG - Intergenic
922271268 1:224037251-224037273 ATGTTGGTGGAAATGGAGGATGG + Intergenic
922435046 1:225596505-225596527 CTTCTGATTAAGAAGGAGGAAGG + Intronic
922584892 1:226726339-226726361 ATGATGATGATGAAGGAGAAAGG + Intronic
924451201 1:244180708-244180730 ATTATGATGAGGACGGAGGAAGG - Intergenic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
924654964 1:245966108-245966130 ATTATGATGAAGAAGAAAGAAGG - Intronic
1063636270 10:7786117-7786139 ATGTTGATGATGAGGGAGACTGG + Intronic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1064084924 10:12338298-12338320 GTGTTTCTGAAAAAGGAGGAAGG - Intergenic
1064295129 10:14072408-14072430 ATGTTTATAAAGTAGAAGGACGG - Intronic
1064297781 10:14093994-14094016 ATGATAATGGAGCAGGAGGATGG + Intronic
1064674564 10:17748266-17748288 ATGTGGCTGAAGAAGGGAGATGG + Intergenic
1064950636 10:20845796-20845818 AGTCTGATGAAGAAGGATGATGG - Intronic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1065297353 10:24289611-24289633 AGGTTGATGAGGAAGGAGACTGG + Intronic
1065753839 10:28912678-28912700 ATGTTCATGAAGGAGAAGCAGGG + Intergenic
1065978264 10:30863521-30863543 ATATTGATGGAGAAGAAGGATGG - Intronic
1067744323 10:48923992-48924014 ATGGTGATGAGGAAGCAGCACGG + Intronic
1068145090 10:53059172-53059194 ATGTTTATGCAAAAGAAGGAAGG - Intergenic
1068277271 10:54816887-54816909 AAGTTCATGAAGTAAGAGGAGGG - Intronic
1069058629 10:63870739-63870761 ATTCTCATGAAGAAGGAGGATGG - Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069937974 10:71932064-71932086 CTGTTGATAAAGCAGCAGGAGGG - Intergenic
1070203738 10:74234256-74234278 ATGTTAAAGAACAAGGAAGAAGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071973266 10:90929928-90929950 AGGCTGATGGAGGAGGAGGAGGG + Intergenic
1072009948 10:91293718-91293740 ATGTAGATTAAGAGGGAGGTAGG - Intergenic
1072557767 10:96536681-96536703 AGGCTGAGGAAGAAGAAGGAGGG - Intronic
1073631976 10:105158431-105158453 ATCTGGCTGAAGAAGGTGGAGGG + Intronic
1073671178 10:105591808-105591830 AGGGTGAGGAGGAAGGAGGAGGG + Intergenic
1073831498 10:107388752-107388774 ATGTTGGTGAAGATGGCGGCAGG + Intergenic
1074106018 10:110390206-110390228 ATATTGATGGATAAGGAGGCTGG - Intergenic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074717918 10:116236680-116236702 ATGGAGTTGAAGAAGGAGAATGG + Intronic
1075897295 10:126008203-126008225 ATGTAGATGAAGAAGCCGGTGGG + Intronic
1076116387 10:127904664-127904686 AAGATGGTGAAGAAGGATGAAGG + Intergenic
1076246347 10:128950283-128950305 GTCCTGAAGAAGAAGGAGGACGG + Intergenic
1076545480 10:131243016-131243038 ATGTTACTGAAGAAGAATGAGGG + Intronic
1076863495 10:133155122-133155144 TTCTTGAAGAAGAAGGAGGTGGG + Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1077392509 11:2306733-2306755 AGGAGGACGAAGAAGGAGGAGGG + Intronic
1077819140 11:5718720-5718742 ATGATGATGAAGAATGAAGTGGG - Intronic
1078090822 11:8263337-8263359 ATGGTGCTGGACAAGGAGGACGG - Exonic
1078649669 11:13177037-13177059 CTGTTGAAGAAGCAGGAGCATGG + Intergenic
1078675583 11:13409883-13409905 AGCTTGATTAAGAAGGAAGAGGG + Intronic
1078738182 11:14041191-14041213 ACTTTGGGGAAGAAGGAGGATGG - Intronic
1078769469 11:14334929-14334951 ATGTTGATGGAGGAGAAAGAAGG - Intronic
1079766335 11:24397794-24397816 ATGTTAAAGAAGAAGAAAGAGGG + Intergenic
1080056505 11:27912111-27912133 ATGTTGATGTTGGGGGAGGATGG + Intergenic
1080162506 11:29194115-29194137 ATGTTGATAAAGAAGTGAGATGG - Intergenic
1081060593 11:38470572-38470594 AGGATGAAGAAAAAGGAGGAGGG - Intergenic
1081248985 11:40805881-40805903 ATGTTCATCAAGAAAGAGCATGG + Intronic
1081317933 11:41653344-41653366 ATCTAGATGAAGAAGAAGGAGGG - Intergenic
1081607418 11:44536093-44536115 ATGATGCAGAAGAGGGAGGAGGG + Intergenic
1081766317 11:45613000-45613022 AAGTTGATGAAGTTGAAGGATGG + Intergenic
1081927762 11:46845177-46845199 AGGGTGATGAAAATGGAGGAAGG + Intronic
1082757400 11:57091749-57091771 TTGTTGGTGAGGAAGGAGGAAGG - Intergenic
1083061535 11:59877868-59877890 CTGCTGATGAAGGAGGAGGGAGG - Intergenic
1083142523 11:60733703-60733725 AAGTGGAGGAAGAAGGAGCATGG + Intronic
1083761672 11:64822036-64822058 AGGCTGATGAAGAGGGAGCAGGG - Intergenic
1084073542 11:66754074-66754096 GTGTTCAGGAAGAAGGAGAATGG + Intronic
1084163792 11:67365644-67365666 AGGGTGATGGGGAAGGAGGAGGG + Intronic
1084181776 11:67450488-67450510 ATGTGGATGAAGGAGAAGAAAGG + Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085880338 11:80459984-80460006 ATGCTGCTGAAGAAGTAGGAAGG - Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088353768 11:108920205-108920227 ATGGTGATGAACAAGAAGGTAGG + Intronic
1088466745 11:110147803-110147825 ATGATGAAGAAGAAGGAACAAGG - Intronic
1090236266 11:125150033-125150055 ATGTTGAAGAGATAGGAGGAGGG - Intergenic
1090453867 11:126830324-126830346 ATACTTATGAAGCAGGAGGATGG - Intronic
1090929874 11:131287618-131287640 ATGTTGGTAATAAAGGAGGAGGG + Intergenic
1091112189 11:132979838-132979860 ATGCTGATGGAGAAGAAGGCAGG + Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1091905102 12:4179369-4179391 ATTTAGATGAAGAAGAAGGAGGG + Intergenic
1092233903 12:6793568-6793590 AGGTTTCTGAAAAAGGAGGAAGG - Intronic
1092268435 12:7001776-7001798 ATGTTAGTGAAAAAGGAAGAGGG - Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092812797 12:12287379-12287401 ATATTGTTAAAGAGGGAGGAAGG - Intergenic
1092989890 12:13886528-13886550 GTATTGATGAACAAGCAGGAAGG + Intronic
1093115263 12:15202023-15202045 ATGTTGATTAGGAAGGAAGAAGG - Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1094350525 12:29519679-29519701 TTGTTGAAGTAAAAGGAGGAGGG + Intronic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1095614518 12:44172405-44172427 ATGTGAATGAAGATGGAGGCAGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096638477 12:52975989-52976011 ACCTTGATGAAGATGCAGGATGG - Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1096921250 12:55088044-55088066 AAGCTGGAGAAGAAGGAGGATGG + Intergenic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098645423 12:72894773-72894795 ATATAGATGGAAAAGGAGGAAGG + Intergenic
1099050802 12:77779728-77779750 ATGTTGATGAAGGAAGAAGCTGG - Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099383601 12:81986310-81986332 TTATTGATGAAGAAAGACGATGG + Intergenic
1099650443 12:85420785-85420807 CTCTTGTTGAAGAAGGTGGAGGG - Intergenic
1100874008 12:98943567-98943589 ATGGTCTTGAAGATGGAGGAAGG - Intronic
1100893514 12:99153539-99153561 ATATAGGTGAGGAAGGAGGATGG - Intronic
1102394296 12:112574360-112574382 GGGTTGATGAAGGTGGAGGAGGG + Intronic
1102394338 12:112574495-112574517 GGGTTGATGAAGGTGGAGGAGGG + Intronic
1102424009 12:112826258-112826280 ATGTTGAGGGAGCAGCAGGAAGG + Intronic
1102437615 12:112937702-112937724 ATTTTGGAGGAGAAGGAGGAAGG - Intergenic
1102582677 12:113900678-113900700 CTCCTGATGAAGGAGGAGGAAGG + Intronic
1102733541 12:115136712-115136734 AAGATGAAGAAGAAGGAGCAAGG + Intergenic
1103412466 12:120722172-120722194 ATGTGGAGGAAGGAGGAGGTGGG + Exonic
1103538925 12:121652741-121652763 ATGTTCAGGAAGACAGAGGAAGG - Exonic
1104272032 12:127290937-127290959 AAGTTGAAGAAGCAGAAGGATGG - Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104510269 12:129371372-129371394 ATGGTGATGATGAATGATGATGG + Intronic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1106411222 13:29513011-29513033 ATGCTGATGGGGGAGGAGGAGGG - Exonic
1106694467 13:32157327-32157349 ACCTTGATAAAGAAGTAGGAAGG + Exonic
1107415395 13:40195098-40195120 CTGGTGATGAAGAAGAAGGAGGG - Intergenic
1107704578 13:43087999-43088021 AAATTGATGAAGAAAGAGGTTGG + Intronic
1107943126 13:45392424-45392446 ATGTTGATGATGGAGGAGACAGG + Intergenic
1108051783 13:46450951-46450973 ATGATGATGAATAAGGTGGTGGG - Intergenic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1109512392 13:63396600-63396622 ATGTCTAGGAAGAAGGAGGTAGG - Intergenic
1109539507 13:63755260-63755282 ATGATGATGAATAAGGTGGTGGG + Intergenic
1109544337 13:63824574-63824596 ATGATGATGAATAAGGTGGTGGG - Intergenic
1109944716 13:69418990-69419012 ATGTCTATTAACAAGGAGGATGG - Intergenic
1110093408 13:71484264-71484286 ATGAGGATGAGGCAGGAGGATGG - Intronic
1110351867 13:74518187-74518209 ATGGTGATGAAGAAAGAAGGAGG - Intergenic
1110726809 13:78835113-78835135 AGGCTGATGAAGAAAGAGCAAGG + Intergenic
1110754175 13:79152303-79152325 ATATTGGAGAAAAAGGAGGAGGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113920387 13:113904895-113904917 AAGGTGATAAAGAAAGAGGAAGG + Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1115051625 14:29070458-29070480 ATGATGTTGAAGAAGTAGGTAGG + Intergenic
1116042880 14:39707134-39707156 ATGTGGATGATGAAAGAAGATGG - Intergenic
1117574199 14:57081755-57081777 GTGTGGATGAAGGAGGAGGGAGG - Intergenic
1117797243 14:59407023-59407045 ATGGTGATGAATAAAAAGGAAGG + Intergenic
1118022321 14:61730453-61730475 ATGATGCTGAAGAAGTAGGTAGG - Intronic
1118506809 14:66422564-66422586 ATGTTAAGGGAGAAGGAGGTTGG - Intergenic
1118763150 14:68892820-68892842 ATGGTGGTGGAGAAGGTGGAGGG + Intronic
1119552904 14:75528680-75528702 ATGTTGATTAAAAAAGAGAAAGG + Intronic
1119708566 14:76804114-76804136 ATGTCCATGAAACAGGAGGAGGG + Intronic
1119964809 14:78902532-78902554 AAGGAGATGAAGGAGGAGGAAGG + Intronic
1120774447 14:88418135-88418157 ATGATGAAGAAGAAGAATGAAGG - Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1121613128 14:95294669-95294691 AGGAAGATGAAGTAGGAGGAGGG - Intronic
1121654952 14:95588380-95588402 ATGAGGATGAAGACGGGGGAAGG + Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1123695793 15:22878236-22878258 ATGCTGAAGAAGAAGGAGCAAGG + Intronic
1124217774 15:27823308-27823330 ATGCTAATGAAGAAGAAAGAGGG + Intronic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1124861393 15:33445294-33445316 ATATTGAGGAATAAGGATGAGGG + Intronic
1127296699 15:57614946-57614968 AAGTTACTGAAGAAAGAGGAGGG - Intronic
1127931786 15:63601552-63601574 ATCTCGGTGAAGCAGGAGGAGGG + Exonic
1128341409 15:66825039-66825061 ATCTTGAACAAGAAGGAAGAAGG + Intergenic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128958446 15:71974243-71974265 AGTTTGATGAAGGAGTAGGATGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129645589 15:77428260-77428282 ATGGTAACAAAGAAGGAGGAAGG + Intronic
1129829893 15:78661836-78661858 ATATTGATGAGGGAGGAGGGTGG - Intronic
1130838102 15:87671679-87671701 ATGGTGATGAGGATGGAAGATGG - Intergenic
1131139816 15:89968077-89968099 ATGATGATGAAGAAAGAAGAGGG + Intergenic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134824776 16:17275722-17275744 ATGTTGGGGAGGAAGGATGATGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134916242 16:18073403-18073425 ATGTTGCTGAAGAAGCAGCCAGG + Intergenic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1135886896 16:26318386-26318408 ATGTTCAGGAAGAAGAAGGAAGG + Intergenic
1136599706 16:31276878-31276900 GGGTTGATGAGGAAGGAAGAAGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137846856 16:51698251-51698273 GTCTTGATGAAGTAGGAGGTGGG - Intergenic
1137975033 16:53024021-53024043 ATTTTGTTGAAGAAGAAGGTAGG + Intergenic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138444616 16:57055522-57055544 AAGTTGAGGGAGGAGGAGGAAGG + Intronic
1139233472 16:65309650-65309672 ATGTTGATGGAGTGGGAGGTGGG - Intergenic
1139406504 16:66723223-66723245 ATGTTGAGGGAGGTGGAGGAAGG - Exonic
1139618938 16:68121165-68121187 ATGTAGCTGAAAAAGGGGGAGGG - Intronic
1139990261 16:70934454-70934476 CTTTTGATGAGGAAGCAGGAAGG + Intronic
1140019641 16:71225673-71225695 AGGTTCAGAAAGAAGGAGGAGGG + Intronic
1140925068 16:79574791-79574813 ATGTCAATGAAGAACTAGGAAGG + Intergenic
1141105554 16:81230597-81230619 ATTTGGATGGGGAAGGAGGAGGG - Intergenic
1141845119 16:86603377-86603399 AGGAGGAGGAAGAAGGAGGAGGG - Intergenic
1143330272 17:6129630-6129652 ATGTTAATGAAATAGAAGGACGG + Intergenic
1143918858 17:10315026-10315048 ATAATGAAGAAGAAAGAGGAGGG + Intronic
1144063404 17:11602997-11603019 ATGATGATCATGAAGGAGCATGG - Intronic
1146564492 17:33900728-33900750 ATGTTGAAGAAGTTGGAGGTGGG + Intronic
1146635704 17:34502842-34502864 ATGCTGATGAAAGGGGAGGAGGG - Intergenic
1146919581 17:36701561-36701583 ATGCAGTTGAAGGAGGAGGAAGG - Intergenic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1148001379 17:44389470-44389492 AGGTTGTGGAAGAAGGAAGATGG - Exonic
1148614888 17:48994815-48994837 ATATTGGGGAACAAGGAGGAGGG - Intergenic
1149333108 17:55606808-55606830 ATTTTTAAGAAGCAGGAGGAAGG - Intergenic
1149602272 17:57900631-57900653 ATGGTGATGATGATGGTGGAAGG - Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150961166 17:69913960-69913982 ATGATGATGATGCAGGAGGATGG + Intergenic
1152055352 17:78021122-78021144 AGGTAGCTGAAGAAGGAGGCTGG + Intronic
1152659333 17:81535224-81535246 ATGGGGATGATGGAGGAGGAAGG - Intronic
1153018220 18:603541-603563 ATGTTAATGATGGAGGAGGCTGG - Intronic
1153902032 18:9625800-9625822 ATGTTGCTGAAGATGAAGAAAGG - Intergenic
1154319281 18:13332336-13332358 ATGTTGATGGCGGAGGAGGCTGG - Intronic
1155434827 18:25801486-25801508 ATCTTGAAGAACATGGAGGAGGG + Intergenic
1155851523 18:30780786-30780808 ATGTGGATGAAGAAAGAGCAGGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1157049632 18:44147168-44147190 AAGTAGATGAAGAAAAAGGAAGG + Intergenic
1157543075 18:48525907-48525929 TTGGTGAGGAAGAAGGAGCATGG - Intergenic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158403418 18:57140911-57140933 GTGTCAGTGAAGAAGGAGGAAGG + Intergenic
1158886747 18:61835487-61835509 AGGTTCATGAATAAGGAGGCAGG + Intronic
1158967450 18:62635001-62635023 ACGCTGATGAAGGAGGGGGATGG - Intergenic
1159027371 18:63196405-63196427 GTATTGATAAAGAAGGAGGGGGG + Intronic
1159111510 18:64063638-64063660 AAGATGCTGAAGTAGGAGGATGG + Intergenic
1159652789 18:70997402-70997424 ATGTGGATGAATAAAGAGCAGGG + Intergenic
1159869957 18:73750075-73750097 TTGTTGATGAAAACGGAGGAAGG + Intergenic
1160201321 18:76798002-76798024 AGGGTGATGAAGAAGGAAAAAGG - Intronic
1160347742 18:78148104-78148126 ATGTTGATGCTGAAGGATCAGGG + Intergenic
1160676394 19:393629-393651 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676424 19:393752-393774 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676439 19:393806-393828 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676444 19:393831-393853 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676449 19:393856-393878 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676454 19:393881-393903 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676459 19:393906-393928 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676477 19:393974-393996 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676482 19:393999-394021 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676567 19:394319-394341 AAGGTGATGGAGAAGGATGATGG + Intergenic
1160676616 19:394569-394591 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676625 19:394607-394629 AGGATGATGGAGAAGGATGAAGG + Intergenic
1160676630 19:394632-394654 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676659 19:394767-394789 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676684 19:394877-394899 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676709 19:394987-395009 AGGATGATGGAGAAGGATGACGG + Intergenic
1160676729 19:395076-395098 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676755 19:395188-395210 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676780 19:395288-395310 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676805 19:395388-395410 AGGATGATGGAGAAGGATGATGG + Intergenic
1160676884 19:395707-395729 AGGGTGATGGAGAAGGACGATGG + Intergenic
1160689856 19:456486-456508 GTGTTGCTGAGGGAGGAGGAGGG - Intronic
1160695193 19:480493-480515 AGGATGATGGAGAAGGATGATGG + Intergenic
1160695227 19:480645-480667 AGGATGATGGAGAAGGATGATGG + Intergenic
1160695229 19:480658-480680 AGGATGATGGAGAAGGATGATGG + Intergenic
1160695346 19:481314-481336 ACGATGATGGAGAAGGATGATGG + Intergenic
1160695348 19:481327-481349 AGGATGATGGAGAAGGATGATGG + Intergenic
1160695366 19:481415-481437 AGGATGATGGAGAAGGATGATGG + Intergenic
1160695399 19:481539-481561 AGGATGATGGAGAAGGATGATGG + Intergenic
1160695408 19:481576-481598 AGGATGATGGAGAAGGATGATGG + Intergenic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1163090402 19:15015543-15015565 ATGTTGATGGTGCAGGAGAAGGG - Intronic
1163468738 19:17484881-17484903 ATTTTGATGCAGAAGCTGGAGGG + Intronic
1164410520 19:28001027-28001049 ATGTGGATGAAAACTGAGGATGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164592494 19:29514181-29514203 GGGATGAGGAAGAAGGAGGAGGG + Intergenic
1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG + Intergenic
1165257728 19:34589732-34589754 GTGTGGATGATGGAGGAGGAGGG + Intergenic
1165832966 19:38738282-38738304 CTGCTGGTGAAAAAGGAGGATGG - Exonic
1165922039 19:39305311-39305333 ATCTTGGGGAAGAAGGAGGAAGG - Intergenic
1166166242 19:40991186-40991208 ATGATGATGAAAAAGGAGGTGGG + Intergenic
1166351255 19:42199466-42199488 CTGTTGCTGATGGAGGAGGAAGG - Exonic
1166600095 19:44085957-44085979 TTGTTGATGAAGATCAAGGATGG - Exonic
1166604770 19:44131096-44131118 TTGTTGATGAAGATCAAGGACGG - Exonic
1166911279 19:46160072-46160094 AAGGTGATAAGGAAGGAGGAAGG - Intronic
1166922776 19:46241935-46241957 AAGGTGATTAGGAAGGAGGAAGG - Intergenic
1167262831 19:48468758-48468780 ATGGTGATAAAGAAGGAGTTCGG + Intronic
1167683630 19:50941742-50941764 ATGATGATGAAGGTGAAGGAAGG - Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
925407808 2:3617312-3617334 ATGTTGGTGAAGGAAGAGGTGGG - Intronic
925614957 2:5736005-5736027 ATTTTCATGAAGAAAGTGGAGGG - Intergenic
926301740 2:11609716-11609738 ATGGTCAGGAAGAAGGAGCAGGG + Intronic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
926592457 2:14754067-14754089 ATGATGATGTAGCAGGAAGAAGG - Intergenic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
926924888 2:17977268-17977290 ATTCTGTTGCAGAAGGAGGAAGG - Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
928106742 2:28475421-28475443 ATGGTGGTGGAGAAGGAGGAAGG - Intronic
928243003 2:29602719-29602741 ATGATGCTAAAGAAGGTGGAAGG + Intronic
928400573 2:30975277-30975299 ATGTCGATGATGAAGCAAGAGGG + Intronic
929637618 2:43541248-43541270 ATGTTGTTGGAGAAGTATGAAGG - Exonic
929781494 2:44960059-44960081 ATGCTGCTGAGGAAGGAGGGCGG + Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930271303 2:49260774-49260796 ATTATGATGCAGAAGAAGGATGG + Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930891055 2:56388517-56388539 ATATTGTTGAAAAAGGAAGATGG + Intergenic
932488307 2:72101050-72101072 ATGTTGAAGAGCAAGGTGGATGG - Intergenic
932620045 2:73259821-73259843 ATGTGGCTGAAGGGGGAGGAAGG + Intronic
932739164 2:74278641-74278663 ATGTTGGTGAAGTAGGAAAAAGG - Intronic
934079921 2:88458981-88459003 AGTCTAATGAAGAAGGAGGAGGG - Intergenic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935415885 2:102818323-102818345 ATGTTGAAAACCAAGGAGGATGG + Intronic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
937304144 2:120860805-120860827 ATGGTGATGAGGAAGGAGCTAGG + Intronic
938344674 2:130558561-130558583 ATGGTGATGAGGCTGGAGGAAGG + Intergenic
938345159 2:130562159-130562181 ATGGTGATGAGGCTGGAGGAAGG - Intergenic
938388473 2:130884912-130884934 TTATTGATGAAGAAGCTGGAGGG - Intronic
939320369 2:140612422-140612444 ATGGGGATGAAGATGAAGGAAGG - Intronic
940490310 2:154350972-154350994 ATGTTGATGAAGATTAAGGTAGG + Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941059973 2:160836078-160836100 ATGATGGTGAAGATGGAGGTAGG + Intergenic
941440045 2:165523371-165523393 ATGGTGGTGAAGAAAGAGGTTGG - Intronic
942119953 2:172766680-172766702 GTGTTGATGAAGAAAGGCGACGG - Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943471493 2:188299724-188299746 ATGTTGAGGAAGGAGGAGTGGGG + Intronic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
944560945 2:200937164-200937186 GTGGTGATTAAGAAGGAAGAGGG + Intronic
944913808 2:204336985-204337007 ATCTTGCTCACGAAGGAGGAGGG + Intergenic
946531230 2:220572464-220572486 ATGTTGATGAGAAATGAGGCTGG + Intergenic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946723295 2:222634554-222634576 AGGTTGAGGGAGAAGGAGGGAGG + Intronic
947383060 2:229563765-229563787 ATGTTGATGATGATGGAGATGGG - Intronic
947544069 2:230998585-230998607 ATGTTGGAGATGAAGGATGAGGG + Intronic
948091864 2:235301984-235302006 AGGAGGATGAAGAGGGAGGAGGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169515812 20:6315432-6315454 GAGTTGATGAAGAACGAAGAAGG + Intergenic
1169571844 20:6914767-6914789 TTGTTGCTGGAGAAGGAAGAGGG + Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1172261882 20:33574099-33574121 ATTATGATGAAGATTGAGGATGG + Exonic
1172434359 20:34918527-34918549 AAGTTGGTGAAGAAGGACCAAGG - Intronic
1172905243 20:38364276-38364298 AAGTAGGGGAAGAAGGAGGAGGG - Intronic
1172915854 20:38443142-38443164 ATGTTGATGCAAAAGAAGAAAGG + Intergenic
1173454299 20:43190578-43190600 ATGTGGGTGAAGAAGAAGGTGGG - Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174465228 20:50712138-50712160 TTCTTGATGAAGAGGGAGGTGGG + Intergenic
1174887192 20:54348820-54348842 AAGTTGAAGAAAAAGCAGGAAGG + Intergenic
1175029510 20:55938356-55938378 GTGTTGATGATGAGGGAGGTAGG - Intergenic
1175159471 20:56997134-56997156 ATGAAGCTGAAGAAAGAGGAAGG + Intergenic
1175348513 20:58300985-58301007 ATGTTGGAGAAGAAGGCGAAGGG - Intergenic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1179962047 21:44773053-44773075 GTGTTGATGAGGTAGGAGGGAGG - Intronic
1180507525 22:16028209-16028231 ATGAGGGTGGAGAAGGAGGACGG - Intergenic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181886029 22:26023107-26023129 GTGGTGATGGAGAAGAAGGAAGG - Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182951594 22:34381306-34381328 ATGGGGATGAAGAAAGAGGTAGG + Intergenic
1183282635 22:36940468-36940490 ATGTTGGTGTAGTTGGAGGAAGG + Intergenic
1184455432 22:44607278-44607300 ATGGGGATGGAGGAGGAGGAGGG + Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949401396 3:3668681-3668703 ATGACTTTGAAGAAGGAGGAAGG - Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
950708194 3:14796766-14796788 ATGTTGCTGAGAAAGGAGGAGGG - Intergenic
951053661 3:18122843-18122865 AGGTTGAGGAAGCAAGAGGAAGG - Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
953191373 3:40691042-40691064 AAGTAGATGAAAAAGGAGGTGGG + Intergenic
953704409 3:45220304-45220326 ATGTTAATGAATCTGGAGGAGGG + Intergenic
953781386 3:45874128-45874150 ATATTAATGAAGAATGAAGATGG - Intronic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955701969 3:61690618-61690640 GTGATGACGGAGAAGGAGGATGG - Intronic
955846161 3:63164922-63164944 AAGATGATGAAGAAGGAGAAAGG + Intergenic
956585010 3:70854909-70854931 ATCTTGAGGCAGAAGGAGCAAGG + Intergenic
957129730 3:76207735-76207757 ATGTGGATCACAAAGGAGGAAGG + Intronic
957656076 3:83077652-83077674 ATGATGATGAAGTAGCATGATGG + Intergenic
958915185 3:100041973-100041995 ATATAGCTGAAGAAAGAGGAAGG - Intronic
958999406 3:100944947-100944969 ATGTTGTGGAAGAAGCAGGAGGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961372223 3:126438476-126438498 ATTGTCATGAAGAGGGAGGAGGG + Intronic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
961747102 3:129071232-129071254 AGGTGGGTGAATAAGGAGGAAGG - Intergenic
961817330 3:129557914-129557936 AGGTTGAAGATGAAAGAGGATGG - Intronic
963299598 3:143583973-143583995 GTAATGAAGAAGAAGGAGGAGGG + Intronic
963363762 3:144308742-144308764 AAGTTGATGAGGAAGGAGTCTGG - Intergenic
963662254 3:148141750-148141772 ACTTTTATGAAGAAGGAGAAGGG + Intergenic
964247445 3:154669905-154669927 ATGTTGAAGAGGCAGCAGGATGG + Intergenic
964672165 3:159238634-159238656 AGGTTGCTGAGGAAGGAGGGTGG + Intronic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
966812362 3:183858514-183858536 TTTTTGATCAAGAAGGAGCAAGG - Intronic
966985853 3:185179708-185179730 AAGTTGATGAAGCAGAAGAAAGG + Intergenic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
967347808 3:188477963-188477985 ATTTTGATGCAGATTGAGGATGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
969467548 4:7366546-7366568 AGGCTGATGAGGATGGAGGAGGG - Intronic
969991239 4:11265294-11265316 ATGTTGATGAAGAACGTACAAGG - Intergenic
970328507 4:14954302-14954324 ATAATGATGAATAAGAAGGAAGG - Intergenic
971118198 4:23673055-23673077 CTGATGTTGAAGATGGAGGAAGG + Intergenic
971978957 4:33729717-33729739 ATTTTGAAGAAGAAAGAGAACGG + Intergenic
972369313 4:38407455-38407477 AAGTTGGGGAAGAAGGCGGAAGG - Intergenic
972793373 4:42393886-42393908 ATACTGAGGAAAAAGGAGGAAGG - Intergenic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
973011954 4:45087275-45087297 ATATTGGTGATGAAGTAGGAAGG + Intergenic
973673654 4:53241755-53241777 ATGGTGGTGCAGCAGGAGGAGGG - Intronic
974145541 4:57943120-57943142 ATGGGGATGAAGGAGGAGAAGGG + Intergenic
974278434 4:59758823-59758845 ATGTTCAGGAAGAATGAGGTAGG + Intergenic
975342976 4:73261590-73261612 AAGTTGACGAAGAAAGAGTAAGG - Intergenic
975935079 4:79569918-79569940 ATGATGGTGTGGAAGGAGGATGG + Intergenic
977371415 4:96141829-96141851 ATATAGATGTAGAAGGAGAAAGG - Intergenic
977504903 4:97888945-97888967 ACATGGCTGAAGAAGGAGGAAGG - Intronic
977560712 4:98530844-98530866 AGGAGGATGAAGCAGGAGGATGG - Intronic
978445234 4:108773819-108773841 AGATTGAGGAAGAAGTAGGAAGG + Intergenic
978573647 4:110166759-110166781 GGGTTGATGAAAAAGGAAGACGG - Intronic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979220182 4:118214225-118214247 ATGAAGATGAAGAAGAAGGTAGG + Intronic
980295090 4:130903286-130903308 ATTTTGATGTTGAAGAAGGATGG - Intergenic
980469513 4:133233695-133233717 AGGTTGAGGAAGGAGGAGGCTGG + Intergenic
980810891 4:137877846-137877868 AGGATGAAGAAGAAGGAAGATGG + Intergenic
981032095 4:140135906-140135928 AGGTTGAAGGAGAAGGGGGAGGG - Intronic
981612036 4:146603973-146603995 ATGCTGTTGAAGATGGTGGAGGG + Intergenic
982115262 4:152093738-152093760 ACATTGAAGAAAAAGGAGGAAGG + Intergenic
982730835 4:158953745-158953767 ATGCTGATGATGTAGGAGGTAGG - Intronic
982777153 4:159453568-159453590 AGGTTGAAGAAGAGGCAGGAAGG - Intergenic
982907883 4:161100094-161100116 AAGTTAGTGAAGAAGGAGGCAGG + Intergenic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
982995972 4:162346109-162346131 ATGTTGATGGAGAATAAGGAAGG + Intergenic
983264330 4:165492187-165492209 ATGTTGATTTAGAAAGAAGATGG - Intronic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
983939051 4:173522827-173522849 ATGTTTAGAAAGAAGGGGGAGGG - Intergenic
984364833 4:178785135-178785157 CTTTTGAAGAAGAAGTAGGAAGG - Intergenic
984576642 4:181456505-181456527 AGGTTGATAAAGCAGGAGGCAGG + Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
986566745 5:9123346-9123368 ATGGTGAGGAAGAAGCAGGGAGG + Intronic
988297331 5:29382582-29382604 ATGTTACTGAGCAAGGAGGATGG + Intergenic
988518798 5:31927934-31927956 ATCTTGGTGAAGATGGAGGAAGG - Intronic
989342178 5:40388268-40388290 AAGTTAATTATGAAGGAGGAAGG - Intergenic
989653994 5:43724354-43724376 TCGTTGATGAAGAAAGAGCAGGG - Intergenic
989705707 5:44327813-44327835 CTGGTGATGATGAAAGAGGAAGG - Intronic
989799050 5:45513331-45513353 ATGATGTTAAAGAAGAAGGAGGG + Intronic
990753436 5:59041737-59041759 AACTTGGTGAAGATGGAGGAAGG - Intronic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
991117199 5:62968438-62968460 ATGCTGATGATGCAGGTGGAGGG - Intergenic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991400547 5:66246596-66246618 ATGTTGTTAAAGAAGAAGGCTGG + Intergenic
991511210 5:67378399-67378421 ATTTAGATGAAGAAGGAGACTGG - Intergenic
992416810 5:76559705-76559727 ATGTTGATGAAGAAAAAGAAGGG + Intronic
994677110 5:102837224-102837246 AAGATGATGAAGCAGGAGGCTGG - Intronic
994718468 5:103352242-103352264 ATATTGATGAATAAGGTGGAGGG + Intergenic
995591741 5:113706770-113706792 ATGTGGTGGAAGTAGGAGGACGG + Intergenic
995638763 5:114228020-114228042 ATGATGATGATGAAAGAAGAAGG + Intergenic
995678298 5:114688235-114688257 ATGATGATGATGGGGGAGGACGG - Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
996885151 5:128345314-128345336 CTGTTGGTGAAGAAGGACCAAGG + Intronic
997305356 5:132831797-132831819 ATGGTGTTGAAGAAGGAGCAGGG - Intergenic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997679266 5:135737838-135737860 GTGCTGATGAAGTAGGAGGCTGG - Intergenic
997696303 5:135863795-135863817 GTGTTACTGAAGTAGGAGGAAGG + Intronic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
997844185 5:137271082-137271104 ATGTCCAGGATGAAGGAGGAGGG + Intronic
998708088 5:144787953-144787975 GTGTTCATGAAGAAAGAAGATGG + Intergenic
998725721 5:145011619-145011641 ATGATGATGACCAAGGAAGAAGG - Intergenic
999880069 5:155852559-155852581 ATGTCAAAGAAGTAGGAGGATGG + Intergenic
1000194265 5:158942841-158942863 ATGTGGTCGAAGGAGGAGGAGGG + Intronic
1001688872 5:173617060-173617082 ATGTTGTTCAAGAAGGACGTGGG - Intergenic
1002020024 5:176358006-176358028 ATGATGATGAAGAAAGATGATGG - Intronic
1002326092 5:178407322-178407344 ATGCTGATGATAAAGGGGGAGGG - Intronic
1002447033 5:179296099-179296121 GTGATGGTGAAGCAGGAGGATGG + Intronic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003693186 6:8375049-8375071 ATTTTGATGAAGAAAGGAGATGG - Intergenic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1005801075 6:29425685-29425707 ATGTTGATGTTGAAGCTGGATGG + Exonic
1006101019 6:31686497-31686519 ATCTTGGTGAAGAGTGAGGAAGG - Intergenic
1006556957 6:34875325-34875347 ATGTTCTTGAAGGGGGAGGAAGG + Exonic
1007754240 6:44088544-44088566 ATTTAAATGAAGAAGGAGGCTGG - Intergenic
1007813979 6:44507075-44507097 ATGATGATGGAGGAAGAGGAGGG + Intergenic
1007813999 6:44507243-44507265 ATGATGATGAAAGAGGAAGAGGG + Intergenic
1008054388 6:46931191-46931213 ATGTTGCTGAGGAAGTAAGAGGG - Intronic
1008117604 6:47570281-47570303 GATTTAATGAAGAAGGAGGAGGG + Intronic
1009715633 6:67391058-67391080 ATGATGGTGGAGAAGGAGGACGG + Intergenic
1010126967 6:72443710-72443732 AAAATAATGAAGAAGGAGGAAGG + Intergenic
1010534637 6:77011931-77011953 ATGTTCAGGAAGAATGAGGTAGG - Intergenic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1013303675 6:108828325-108828347 ATGTTGATGTATAATGTGGAAGG + Intergenic
1014259618 6:119201400-119201422 ATGTTCAAGAAGAAGAAGAATGG - Intronic
1014569809 6:122995862-122995884 ATTTTGATGTAGAAGGAGTACGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015817457 6:137225214-137225236 ATGTTGATGAAAGATAAGGATGG - Intergenic
1016645711 6:146406044-146406066 AGGTTGAAGAAGAGGGAGGAAGG + Intronic
1016695750 6:146992942-146992964 CTGCTGATGAAGAGTGAGGAAGG - Intergenic
1016969721 6:149750387-149750409 AGGTTGATTATGGAGGAGGAAGG - Intronic
1017035371 6:150262428-150262450 AGGGTTATGAAGAAGGAGGGTGG - Intergenic
1018088331 6:160324449-160324471 ATTTTGATAAAGAAGGTGGTGGG + Intergenic
1018099580 6:160424801-160424823 ATCTTGAGGAAGACTGAGGAAGG + Intronic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1018306716 6:162464898-162464920 ATATTTATTAAGAAGGAGGAGGG - Intronic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022793892 7:33716667-33716689 ATGATGATGAAGGAGAAGGAGGG - Intergenic
1024112912 7:46164444-46164466 ATCCTGATGAAGAAGCTGGAAGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024586893 7:50849842-50849864 AGGATGAGGAAGAAGGAGGGTGG - Intergenic
1026460829 7:70613864-70613886 ATGTTGATGAAAAGGTAGGCAGG - Intronic
1027220822 7:76212870-76212892 AGGTAGAGGAAGAGGGAGGAAGG - Intronic
1028006488 7:85575952-85575974 ATGTTGAGAGAGAAGGAGAAAGG + Intergenic
1028888554 7:95961358-95961380 AAGGTAATTAAGAAGGAGGATGG + Intronic
1028921376 7:96314108-96314130 AGGAGGAGGAAGAAGGAGGAAGG + Intronic
1029574966 7:101397364-101397386 AAGAAGATGAAGAAGAAGGAAGG - Intronic
1029728865 7:102426249-102426271 ATGATGATGAACACAGAGGACGG + Exonic
1030120268 7:106103127-106103149 ATGTTCATGAAAAATGGGGAGGG + Intronic
1030202049 7:106915608-106915630 ATGATGATGATGATGGTGGAAGG + Intergenic
1031326719 7:120408982-120409004 ATGTTTCTTAAGAAGGAGGGAGG + Intronic
1031446703 7:121864006-121864028 ATGTTGAGGAAGAAGGAGCTAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032733371 7:134666412-134666434 GGGTTGATGACCAAGGAGGATGG + Intronic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033580084 7:142724967-142724989 ATTTTGAAGTAGAAGGATGAAGG + Intergenic
1033807488 7:144971378-144971400 GTGGTGATGGAGGAGGAGGATGG + Intergenic
1033981903 7:147175567-147175589 ATAGTGTTGAAGAAGGAAGAGGG + Intronic
1034150250 7:148909788-148909810 ATGTTGATGGTGTAGGAGGCTGG + Intergenic
1034187933 7:149193793-149193815 AAGCTGATGAAGATGGAGGAGGG - Intergenic
1034817197 7:154182759-154182781 CTCTTGATGAGGAAGCAGGATGG - Intronic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035920407 8:3669885-3669907 ATGTTAAGAAAGAAGAAGGAAGG - Intronic
1036448423 8:8843474-8843496 AGGATGCTGAAGCAGGAGGATGG + Intronic
1036926129 8:12907820-12907842 ATGTTGCTGAAGATGGAGTGTGG - Intergenic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037510797 8:19579900-19579922 AGCTGGATGAAGAAGAAGGAAGG + Intronic
1038150930 8:24942065-24942087 AGGTTGGGGAGGAAGGAGGAGGG - Intergenic
1038238385 8:25784452-25784474 GTGGTGATGGAGGAGGAGGAAGG - Intergenic
1038901677 8:31851153-31851175 ATGTTGACAAAGAAGTAGAAAGG + Intronic
1041198527 8:55426015-55426037 GTGTTGGTGAGGAACGAGGAGGG - Intronic
1041902893 8:63001494-63001516 ATATTGATGATGTAGGAGGAGGG + Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042301623 8:67288854-67288876 ATGTTGGTGAAAAAATAGGAAGG - Intronic
1042501782 8:69516335-69516357 ACATTGCTGAAGCAGGAGGAAGG + Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043248116 8:78032135-78032157 ATGCTGATCAAGAAGTAGCAGGG - Intergenic
1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG + Intergenic
1043406621 8:79941580-79941602 ATGTTGATTGAGAAGGACTAGGG - Intronic
1043524044 8:81076945-81076967 ATGATTATGAAGAATGAGAATGG + Intronic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044114994 8:88325148-88325170 ATCTTAATGAAGAAAGAGAAGGG + Intronic
1044384041 8:91566554-91566576 ATCTAGATGAAGATGAAGGAAGG - Intergenic
1045474660 8:102542616-102542638 ACGATGAAGAAGAAGAAGGAGGG - Intergenic
1045528901 8:102965354-102965376 ATGATGATGAACAACAAGGAGGG - Intronic
1045642494 8:104267092-104267114 ATGTTGGTGAGGAAGAAGTAAGG + Intergenic
1046030439 8:108776750-108776772 ATGATGATGATGATGAAGGAAGG + Intronic
1046216492 8:111154086-111154108 AAGTAGATGAAGTAGTAGGAAGG - Intergenic
1046305798 8:112365210-112365232 ATATTGAAGAGGAAGGAGGCAGG - Intronic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046744643 8:117863779-117863801 AGGGTGAGGAAGAAGGTGGAAGG + Intronic
1047083720 8:121493479-121493501 ATGTTGGAGAAAAATGAGGATGG + Intergenic
1047194178 8:122706431-122706453 ATTTTGATGATGATGGAAGAAGG + Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048645597 8:136415929-136415951 ATGGTGTTTAAGTAGGAGGATGG + Intergenic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1050202235 9:3157451-3157473 ATATTGATACAGAAGGGGGAAGG - Intergenic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050890011 9:10812761-10812783 AGATTGATGGAGATGGAGGATGG - Intergenic
1051109988 9:13624920-13624942 AAAGTGATGAAGAAAGAGGAGGG + Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051754713 9:20386314-20386336 ATGTTGAAGAGTAAGGAGAAGGG + Intronic
1051925088 9:22315925-22315947 ACATTGCTGAAGAAGAAGGAAGG - Intergenic
1053112694 9:35476601-35476623 AGGTTCCTGAAGAAGTAGGAAGG - Intergenic
1053292513 9:36890651-36890673 ATGTTGATGGAAAAGAAGGTGGG + Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054747362 9:68868245-68868267 AGGATAAAGAAGAAGGAGGATGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1056202762 9:84292366-84292388 ATGTTTATGAAGAGGATGGAAGG - Intronic
1056685271 9:88753962-88753984 ATGTTGAGGAAGAATGAAGCTGG + Intergenic
1059466248 9:114470592-114470614 ATGGTGGTGATGTAGGAGGAAGG + Intronic
1060623595 9:125090469-125090491 ATGATGAAGAAGGAGAAGGAAGG + Intronic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061511751 9:131065838-131065860 AAGATGATGATGATGGAGGAAGG + Intronic
1061751405 9:132780044-132780066 ATGCTGATTATGAAGGAGGAGGG + Intronic
1061927982 9:133815688-133815710 ATGTCCATAAAGAAGGAAGATGG - Intronic
1186093716 X:6077704-6077726 ATGTTGCTGAAATAGGAGGAAGG - Intronic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1186529366 X:10279685-10279707 ATGTTTATGAAAAGGAAGGAGGG - Intergenic
1187292878 X:17972263-17972285 ATGCTGGTGTAGGAGGAGGAAGG - Intergenic
1188340766 X:28998455-28998477 ATGTTTATGGAGAGGGAGGTGGG + Intronic
1188531286 X:31144241-31144263 ATGTTGAAGAAGATGGACGAGGG - Intronic
1189161408 X:38813018-38813040 ATGTTGAGGTAGAAGGGGTAGGG + Intergenic
1189216273 X:39327543-39327565 ATATTGCTGGAGAAGGAGGGAGG - Intergenic
1189285277 X:39847807-39847829 GTGATGATGAAGAAGGAGAGAGG + Intergenic
1189352301 X:40284943-40284965 ATGTTGAGGAGAAAGGAGGGTGG - Intergenic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1189746168 X:44171090-44171112 ATGTTGTGGAAAAAGGGGGAGGG + Intronic
1189997023 X:46648739-46648761 AAGTTGAGGAAGAAGGAGAGCGG + Exonic
1190296428 X:49030294-49030316 ATTCTGATGGAGGAGGAGGAGGG - Exonic
1190578639 X:51868736-51868758 ATGTTGATGTAGAGGGAGGTTGG + Intronic
1191010805 X:55756215-55756237 GTTTTGAAAAAGAAGGAGGAAGG + Intronic
1191026056 X:55914674-55914696 AAGTTGAGAAAGAAGGAGCATGG + Intergenic
1191952998 X:66614928-66614950 ATTTTGAAGGAAAAGGAGGAAGG - Intronic
1192432246 X:71120237-71120259 ATCTAGATTAAGAAGGAGGATGG - Intronic
1192671184 X:73143717-73143739 ATGGTGATGAGGAAGGCGGGAGG - Intergenic
1192728908 X:73782571-73782593 AACTTGATGAAGGAGGAGGAGGG - Intergenic
1193168922 X:78314185-78314207 ATGTGGAAGAATTAGGAGGAAGG + Intronic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193889689 X:87029633-87029655 ATGGTGATCAAGAGGGAGTAGGG + Intergenic
1193926375 X:87490735-87490757 ATGATGATGATGATGGAGGGAGG + Intergenic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195513317 X:105742892-105742914 ATGGTGATGGAGATGGAGAAGGG - Intronic
1197187220 X:123601359-123601381 ATATTGATAGAGAAGAAGGAAGG + Intronic
1197442217 X:126506477-126506499 ATTTTGTTGAAAATGGAGGATGG + Intergenic
1197730259 X:129803797-129803819 AGCTTGAGGAAGAAGGAGGAAGG + Exonic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198326665 X:135580576-135580598 GTTTTCATGAAGATGGAGGAAGG - Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199738018 X:150703436-150703458 ATAATGATGAAGCAAGAGGAAGG - Intronic
1199839840 X:151633609-151633631 ATGTAGCTGAAGATGGAGTATGG - Intronic
1200812357 Y:7499272-7499294 ATGATGAGGAAGAAGGAAGAAGG - Intergenic
1201269719 Y:12242975-12242997 ATGGTGTTGAAGTAGGAGGCGGG - Intergenic
1201300261 Y:12498784-12498806 ATGACGAAGAAGTAGGAGGAAGG - Intergenic
1201557845 Y:15283252-15283274 ATGACCATGAAGAGGGAGGAAGG + Intergenic
1201856297 Y:18548075-18548097 AGGTTGAAGGTGAAGGAGGAGGG - Exonic
1201877024 Y:18772309-18772331 AGGTTGAAGGTGAAGGAGGAGGG + Exonic