ID: 1182793768

View in Genome Browser
Species Human (GRCh38)
Location 22:32975436-32975458
Sequence GACTGACGACCTTAAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182793768_1182793770 29 Left 1182793768 22:32975436-32975458 CCATCAGCTTAAGGTCGTCAGTC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1182793770 22:32975488-32975510 TCTCACAATGTTGCCCAGGCTGG 0: 116
1: 11053
2: 63093
3: 229643
4: 364418
1182793768_1182793769 25 Left 1182793768 22:32975436-32975458 CCATCAGCTTAAGGTCGTCAGTC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1182793769 22:32975484-32975506 AGAGTCTCACAATGTTGCCCAGG 0: 10
1: 824
2: 15393
3: 65071
4: 185568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182793768 Original CRISPR GACTGACGACCTTAAGCTGA TGG (reversed) Intronic
907974220 1:59415105-59415127 GCCTGCTGACCTTGAGCTGAGGG - Intronic
910435365 1:87200632-87200654 GACTGTGGACTTTATGCTGAAGG + Intergenic
917748010 1:178029335-178029357 AACTGACGATATTAAGCTGGAGG + Intergenic
917901247 1:179545519-179545541 GACAGACGAGCTGAAGCTGTTGG + Intronic
919811473 1:201411512-201411534 GATTAAGGACCTGAAGCTGAAGG - Exonic
1064199719 10:13274186-13274208 GACTGAGGAGCTCAAGATGAAGG + Intergenic
1064434647 10:15300671-15300693 GACTGACAACCTAGAGTTGATGG + Intronic
1089328122 11:117671325-117671347 GACTGAGGCCCTTTAACTGAGGG - Intronic
1099718483 12:86330066-86330088 GACTGAGTATTTTAAGCTGAAGG + Intronic
1100280504 12:93113822-93113844 GATTGATGACTTTGAGCTGAAGG - Intergenic
1103322220 12:120098903-120098925 GAATGACGACCCTGAGCGGAAGG - Exonic
1111228930 13:85314883-85314905 GACTGAACACTTTAAGCTGCTGG - Intergenic
1111725702 13:92005431-92005453 GTGTGAGGACCTGAAGCTGAGGG - Intronic
1112622243 13:101064798-101064820 AACTTAGCACCTTAAGCTGAGGG - Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1133832805 16:9339759-9339781 GACTGTCTACATTCAGCTGAAGG + Intergenic
1147055352 17:37829974-37829996 GAGTGACAGCCTTAGGCTGATGG - Intergenic
1153674504 18:7444532-7444554 AACAGACAACCTTAAGGTGAAGG - Intergenic
1157947463 18:51996975-51996997 GACTAATGACCTTGAGATGAAGG + Intergenic
1163325852 19:16602709-16602731 GACTGAAGACATTATGCTGAGGG + Intronic
931969055 2:67565968-67565990 CACTGACGAGCCCAAGCTGAGGG - Intergenic
935047347 2:99494033-99494055 GATTGTGGAACTTAAGCTGAAGG + Intergenic
938833154 2:135073425-135073447 CACTGATGGCCTTGAGCTGAGGG - Intronic
938951147 2:136255979-136256001 GACTGACTTCCTCAAGCTTATGG + Intergenic
939666751 2:144962514-144962536 GACTGAAGATCCAAAGCTGAGGG + Intergenic
942444537 2:176069237-176069259 GACTGAGGACCTTGAGCCAAGGG + Intergenic
943948573 2:194099274-194099296 GACTGAGTACTTTAAGCTGAAGG + Intergenic
944788082 2:203094532-203094554 GATGGACAACCTTAAGCTGGCGG + Intronic
946811429 2:223530080-223530102 GACTGACAGCTTTAAGATGAGGG + Intergenic
1168847635 20:956457-956479 GACTGACTGCCTCAGGCTGAAGG - Intergenic
1169591906 20:7152959-7152981 GACTGAGGATATAAAGCTGATGG + Intergenic
1174508983 20:51036849-51036871 GACTAATGACCTTCAGGTGAAGG + Intergenic
1182665045 22:31951880-31951902 GAAGGACAACCTTAAACTGATGG - Intronic
1182793768 22:32975436-32975458 GACTGACGACCTTAAGCTGATGG - Intronic
961712079 3:128835561-128835583 CATTGACGACATTATGCTGACGG - Intergenic
970871229 4:20819326-20819348 GACTGAAGACCCAAAGATGAAGG + Intronic
980419597 4:132542582-132542604 CCCTGATGACCTTGAGCTGAAGG + Intergenic
984489161 4:180410344-180410366 GACTGTTGACCTGAAGCTCAGGG - Intergenic
984871452 4:184329113-184329135 CACTGAATATCTTAAGCTGAAGG + Intergenic
989677069 5:43984549-43984571 CACTGATGACATTATGCTGATGG - Intergenic
996353036 5:122566660-122566682 CACTGAGAAACTTAAGCTGAAGG - Intergenic
1001741790 5:174058957-174058979 GAGTGAGGACCTGAAGCTAAAGG + Intronic
1002004080 5:176217463-176217485 CCCTGATGGCCTTAAGCTGAAGG + Intergenic
1002222294 5:177693177-177693199 CCCTGATGGCCTTAAGCTGAAGG - Intergenic
1021212465 7:17871545-17871567 GACTGAGGAATTTAAGGTGAGGG - Intronic
1023596660 7:41836191-41836213 GACTGAAGACCTGAGGCTGCAGG - Intergenic
1028833003 7:95346139-95346161 CCCTGATGACCTTGAGCTGAAGG + Intergenic
1030123607 7:106134141-106134163 GACTGACGACCTTAGGAAGGGGG - Intergenic
1036592291 8:10180057-10180079 GACTGAGTCCCTTAAGCTGTGGG - Intronic
1044659139 8:94578531-94578553 CCCTGATGACCTTGAGCTGAAGG - Intergenic
1045103319 8:98866916-98866938 GACTTAATACCTTCAGCTGAAGG + Intronic
1047833537 8:128662337-128662359 GAATGACGACCATCAGCTGGAGG - Intergenic
1193934649 X:87601676-87601698 GTCTGACGACCATCAGGTGATGG - Intronic
1201924495 Y:19269895-19269917 CCCTGATGACCTTAAGCTGCAGG - Intergenic