ID: 1182799446

View in Genome Browser
Species Human (GRCh38)
Location 22:33019436-33019458
Sequence AATATCTATGAGAGTTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182799440_1182799446 1 Left 1182799440 22:33019412-33019434 CCCAGCTCTGCCACTTACTCATG 0: 2
1: 2
2: 38
3: 225
4: 1091
Right 1182799446 22:33019436-33019458 AATATCTATGAGAGTTGGGGTGG No data
1182799439_1182799446 6 Left 1182799439 22:33019407-33019429 CCAATCCCAGCTCTGCCACTTAC 0: 2
1: 30
2: 90
3: 291
4: 940
Right 1182799446 22:33019436-33019458 AATATCTATGAGAGTTGGGGTGG No data
1182799442_1182799446 -9 Left 1182799442 22:33019422-33019444 CCACTTACTCATGTAATATCTAT 0: 1
1: 0
2: 5
3: 16
4: 247
Right 1182799446 22:33019436-33019458 AATATCTATGAGAGTTGGGGTGG No data
1182799441_1182799446 0 Left 1182799441 22:33019413-33019435 CCAGCTCTGCCACTTACTCATGT 0: 1
1: 1
2: 14
3: 115
4: 592
Right 1182799446 22:33019436-33019458 AATATCTATGAGAGTTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182799446 Original CRISPR AATATCTATGAGAGTTGGGG TGG Intronic
No off target data available for this crispr